Search

By taking into account our previously described series of 1,3,5-tris[(4-(substituted-aminomethyl)phenyl)methyl]benzene compounds, we have now designed, prepared, and evaluated in vitro against Plasmodium falciparum a novel series of structural analogues of these molecules, i.e., the 1,3,5-tris[(4-(substituted-aminomethyl)phenoxy)methyl]benzene derivatives. The pharmacological data showed antimalarial activity with IC50 values in the sub and μM range. The in vitro cytotoxicity of these new nitrogen polyphenoxymethylbenzene compounds was also evaluated on human HepG2 cells. The 1,3,5-tris[(4-(substituted-aminomethyl)phenoxy)methyl]benzene derivative 1m was found as one of the most potent and promising antimalarial candidates with favorable cytotoxic to antiprotozoal properties in the P. falciparum strains W2 and 3D7. In conclusion, this 1,3,5-tris[(4-(pyridin-3-ylmethylaminomethyl)phenoxyl)methyl]benzene 1m (IC50 = 0.07 μM on W2, 0.06 μM on 3D7, and 62.11 μM on HepG2) was identified as the most promising antimalarial derivative with selectivity indexes (SI) of 887.29 on the W2 P. falciparum chloroquine-resistant strain, and of 1035.17 on the chloroquine-sensitive and mefloquine decreased sensitivity strain 3D7. It has been previously described that the telomeres of P. falciparum could represent potential targets for these types of polyaromatic compounds; therefore, the capacity of our novel derivatives to stabilize the parasitic telomeric G-quadruplexes was assessed using a FRET melting assay. However, with regard to the stabilization of the protozoal G-quadruplex, we observed that the best substituted derivatives 1, which exhibited some interesting stabilization profiles, were not the most active antimalarial compounds against the two Plasmodium strains. Thus, there were no correlations between their antimalarial activities and selectivities of their respective binding to G-quadruplexes. [ABSTRACT FROM AUTHOR]

Background: Cis-regulatory elements (CREs) are crucial for regulating gene expression, and G-quadruplexes (G4s), as prototypal non-canonical DNA structures, may play a role in this regulation. However, the relationship between G4s and CREs, especially with non-promoter-like functional elements, requires further systematic investigation. We aimed to investigate the associations between G4s and human cCREs (candidate CREs) inferred from the Encyclopedia of DNA Elements (ENCODE) data. Results: We found that G4s are prominently enriched in most types of cCREs, especially those with promoter-like signatures (PLS). The co-occurrence of CTCF signals with H3K4me3 or H3K27ac signals strengthens the association between cCREs and G4s. Genetic variants in G4s, particularly within their G-runs, exhibit higher regulatory potential and deleterious effects compared to cCREs. The G-runs within G4s near transcriptional start sites (TSSs) are more evolutionarily constrained compared to G-runs in cCREs, while those far from the TSS are relatively less conserved. The presence of G4s is often linked to a more favorable local chromatin environment for the activation and execution of regulatory function of cCREs, potentially attributable to the formation of G4 secondary structures. Finally, we discovered that G4-associated cCREs exhibit widespread activation in a variety of cancers. Conclusions: Our study suggests that G4s are integral components of human cis-regulatory elements, extending beyond their potential role in promoters. The G4 primary sequences are associated with the localization of CREs, while the G4 structures are linked to the activation of these elements. Therefore, we propose defining G4s as pivotal regulatory elements in the human genome. [ABSTRACT FROM AUTHOR]

Although more than 10% of the human genome has the potential to fold into non- B DNA, the formation of non-canonical structural motifs as part of long dsDNA chains are usually considered as unfavorable from a thermodynamic point of view. However, recent experiments have confirmed that non-canonical motifs do exist and are non-randomly distributed in genomic DNA. This distribution is highly dependent not only on the DNA sequence but also on various other factors such as environmental conditions, DNA topology and the expression of specific cellular factors in different cell types. In this study, we describe a new strategy used in the preparation of DNA minicircles containing different non-canonical motifs which arise as a result of imperfect base pairing between complementary strands. The approach exploits the fact that imperfections in the pairing of complementary strands thermodynamically weaken the dsDNA structure at the expense of enhancing the formation of non-canonical motifs. In this study, a completely different concept of stable integration of a non-canonical motif into dsDNA is presented. Our approach allows the integration of various types of non-canonical motifs into the dsDNA structure such as hairpin, cruciform, G-quadruplex and i-motif forms but also combinations of these forms. Small DNA minicircles have recently become the subject of considerable interest in both fundamental research and in terms of their potential therapeutic applications. [ABSTRACT FROM AUTHOR]

The interaction between proteins and nucleic acids is a core element of life. Many proteins bind nucleic acids via a sequence-specific manner, but there are also many types of proteins that recognize various structural motifs. Researchers have recently found that proteins that can recognize DNA and RNA G-quadruplexes (G4s) are very important for basic cellular processes, particularly in eukaryotes. Some of these proteins are located outside the nucleus and interact with RNA, potentially affecting miRNA functions in intercellular communication, which is facilitated by small extracellular vesicles (sEVs). Imbalances in the production of sEVs are associated with various pathologies and senescence in humans. The distribution of miRNA into sEVs is regulated by two RNA-binding proteins, Alyref and FUS. Both proteins possess G-rich recognition motifs that are compatible with the formation of RNA parallel G4 structures. This lends credence to the new hypothesis that G4-formation in RNAs and their interaction with G4-binding proteins can affect the fate of miRNAs and control their distribution in sEVs that are associated with senescence and aging. • The distribution of miRNA into sEVs is regulated by two RNA-binding proteins, Alyref and FUS. • Alyref and FUS.possess G-rich recognition motifs compatible with the formation of RNA parallel G4 structures. • G4-formation in RNAs can control sEVs that are associated with senescence and aging. [ABSTRACT FROM AUTHOR]

A series of new 1,3,5-tris[(4-(substituted-aminomethyl)phenyl)methyl]benzene compounds were designed, synthesized, and evaluated in vitro against two parasites (Plasmodium falciparum and Leishmania donovani). The biological results showed antimalarial activity with IC50 values in the sub and μM range. The in vitro cytotoxicity of these new aza polyaromatic derivatives was also evaluated on human HepG2 cells. The 1,3,5-tris[(4-(substituted-aminomethyl)phenyl)methyl]benzene 1m was found as one of the most potent and promising antimalarial candidates with a ratio of cytotoxic to antiprotozoal activities of 83.67 against the P. falciparum CQ-sensitive strain 3D7. In addition, derivative 1r was also identified as the most interesting antimalarial compound with a selectivity index (SI) of 17.28 on the W2 P. falciparum CQ-resistant strain. It was previously described that the telomeres of P. falciparum could be considered as potential targets of these kinds of aza heterocycles; thus, the ability of these new derivatives to stabilize the parasitic telomeric G-quadruplexes was measured through a FRET melting assay. [ABSTRACT FROM AUTHOR]

G-quadruplexes (G4s) have been long considered rare and physiologically unimportant in vitro curiosities, but recent methodological advances have proved their presence and functions in vivo. Moreover, in addition to their functional relevance in bacteria and animals, including humans, their importance has been recently demonstrated in evolutionarily distinct plant species. In this study, we analyzed the genome of Pisum sativum (garden pea, or the so-called green pea), a unique member of the Fabaceae family. Our results showed that this genome contained putative G4 sequences (PQSs). Interestingly, these PQSs were located nonrandomly in the nuclear genome. We also found PQSs in mitochondrial (mt) and chloroplast (cp) DNA, and we experimentally confirmed G4 formation for sequences found in these two organelles. The frequency of PQSs for nuclear DNA was 0.42 PQSs per thousand base pairs (kbp), in the same range as for cpDNA (0.53/kbp), but significantly lower than what was found for mitochondrial DNA (1.58/kbp). In the nuclear genome, PQSs were mainly associated with regulatory regions, including 5′UTRs, and upstream of the rRNA region. In contrast to genomic DNA, PQSs were located around RNA genes in cpDNA and mtDNA. Interestingly, PQSs were also associated with specific transposable elements such as TIR and LTR and around them, pointing to their role in their spreading in nuclear DNA. The nonrandom localization of PQSs uncovered their evolutionary and functional significance in the Pisum sativum genome. [ABSTRACT FROM AUTHOR]

The long‐standing history of platinum coordination complexes in nucleic acid recognition attests to the unique suitability of such species for therapeutic applications. Here, we report the synthetic exploration and development of a family of di‐imine ligands, and their platinum(II) complexes, elaborated on a 3‐(2‐pyridyl)‐[1,2,4]triazolo[4,3‐a]pyridine platform which, in its unsubstituted form, has recently been shown to display exceptional capabilities for guanine quadruplex (G4) targeting. The identification of facile, high‐yielding synthetic methods for the derivatization of this platform for the incorporation of additional sites of interactions with guanine quadruplex loops and grooves, along with the optimization of platinum(II) complexation methods, are discussed. Gratifyingly, preliminary biophysical screening of this novel family of binders validates all but one family members as robust G4 binders and highlights enhanced selectivity for quadruplex versus duplex DNA compared to the parent compound. These results bear promise for practical developments based on this platform. [ABSTRACT FROM AUTHOR]

G-quadruplexes are non-B secondary structures with regulatory functions and therapeutic potential. Improvements in sequencing methods recently allowed the completion of the first human chromosome which is now available as a gapless, end-to-end assembly, with the previously remaining spaces filled and newly identified regions added. We compared the presence of G-quadruplex forming sequences in the current human reference genome (GRCh38) and in the new end-to-end assembly of the X chromosome constructed by high-coverage ultra-long-read nanopore sequencing. This comparison revealed that, even though the corrected length of the chromosome X assembly is surprisingly 1.14% shorter than expected, the number of G-quadruplex forming sequences found in this gapless chromosome is significantly higher, with 493 new motifs having G4Hunter scores above 1.4 and 23 new sequences with G4Hunter scores above 3.5. This observation reflects an improved precision of the new sequencing approaches and points to an underestimation of G-quadruplex propensity in the previous, widely used version of the human genome assembly, especially for motifs with a high G4Hunter score, expected to be very stable. These G-quadruplex forming sequences probably remained undiscovered in earlier genome datasets due to previously unsolved G-rich and repetitive genomic regions. These observations allow a precise targeting of these important regulatory regions. • The number of stable G-quadruplex prone motifs was strongly underestimated in the previous version of the human X-chromosome. • G4-forming sequences are abundant in regions surrounding genes, pointing to the importance of the regulatory functions. • These results should prompt a re-evaluation of G4 propensity in all species once gapless genomes are available. [ABSTRACT FROM AUTHOR]

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G‐tetrads. Three‐ or four‐tetrad G4s and antiparallel two‐tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e. not dimeric or multimeric) two‐tetrad parallel‐stranded DNA G4 has never been experimentally observed. Many sequences compatible with two‐tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel‐stranded G4 upon increasing the number of GGG‐to‐GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G‐triad, whose topology depends on the location of the deletion. Removal of another guanine from another G‐tract leads to di‐ or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two‐tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two‐tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes. [ABSTRACT FROM AUTHOR]

The industrial world exposes living organisms to a variety of metal pollutants. Here we investigated whether such elements affect G-rich sequences susceptible to fold into G-quadruplex (GQ) structures. Thermal stability and conformation of these oligoncleotides was studied at various molar ratios of a variety of heavy metal salts using thermal FRET, transition-FRET (t-FRET) and circular dichroism. Metal ions affected the thermal stability of the GQs to different extents; some metals had no effect on T m while other metals caused small to moderate changes in T m at 1:1 or 1:10 molar ratio. While most of the metals had no major effect, Al3+, Cd2+, Pb2+, Hg2+ and Zn2+ altered the thermal stability and structural features of the GQs. Some metals such as Pb2+ and Hg2+ exhibit differential interactions with telomere, c-myc and c-kit GQs. Overall, toxic heavy metals affect G-quadruplex stability in a sequence and topology dependent manner. This study provides new insight into how heavy metal exposure may affect gene expression and cellular responses. • Heavy metal ions affect the thermal stability of the G-quadruplexes to different extents. • Al3+, Cd2+, Pb2+, Hg2+ and Zn2+ altered the thermal stability and structural features of the GQs. • Pb2+ and Hg2+ exhibit differential interactions with telomere, c-myc and c-kit G-quadruplexes. • Toxic heavy metals affect stability of G-quadruplexes in a sequence and topology dependent manner. • Heavy metal exposure may affect gene expression and cellular responses through direct DNA binding. [ABSTRACT FROM AUTHOR]

Guanine-rich sequences can form G-quadruplexes (G4) in living cells, making these structures promising anti-cancer targets. Compounds able to recognize these structures have been investigated as potential anticancer drugs; however, no G4 binder has yet been approved in the clinic. Here, we describe G4 ligands structure-activity relationships, in vivo effects as well as clinical trials. Addressing G4 ligand characteristics, targeting challenges, and structure-activity relationships, this review provides insights into the development of potent and selective G4-targeting molecules for therapeutic applications. [Display omitted] [ABSTRACT FROM AUTHOR]

Guanine quadruplex recognition has gained increasing attention, inspired by the growing awareness of the key roles played by these non‐canonical nucleic acid architectures in cellular regulatory processes. We report here the solution and solid‐state studies of a novel planar platinum(II) complex that is easily assembled from a simple ligand, and exhibits notable binding affinity for guanine quadruplex structures, while maintaining good selectivity for guanine quadruplex over duplex structures. A crystal structure of this ligand complexed with a telomeric quadruplex confirms double end‐capping, with dimerization at the 5′ interface. [ABSTRACT FROM AUTHOR]

Background: Influenza viruses are dangerous pathogens. Seventy-Seven genomes of recently emerged genotype 4 reassortant Eurasian avian-like H1N1 virus (G4-EA-H1N1) are currently available. We investigated the presence and variation of potential G-quadruplex forming sequences (PQS), which can serve as targets for antiviral treatment. Results: PQS were identified in all 77 genomes. The total number of PQS in G4-EA-H1N1 genomes was 571. Interestingly, the number of PQS per genome in individual close relative viruses varied from 4 to 12. PQS were not randomly distributed in the 8 segments of the G4-EA-H1N1 genome, the highest frequency of PQS being found in the NP segment (1.39 per 1000 nt), which is considered a potential target for antiviral therapy. In contrast, no PQS was found in the NS segment. Analyses of variability pointed the importance of some PQS; even if genome variation of influenza virus is extreme, the PQS with the highest G4Hunter score is the most conserved in all tested genomes. G-quadruplex formation in vitro was experimentally confirmed using spectroscopic methods. Conclusions: The results presented here hint several G-quadruplex-forming sequences in G4-EA-H1N1 genomes, that could provide good therapeutic targets. [ABSTRACT FROM AUTHOR]

Oxidative damage of guanine to 8-oxoguanine triggers a partial and variable loss of G-quadruplex/hemin DNAzyme activity and provides clues to the mechanistic origins of DNAzyme deactivation, which originates from an interplay between decreased G-quadruplex stability, lower hemin affinity and a modification of the nature of hemin binding sites. [ABSTRACT FROM AUTHOR]

DNA is prone to structural polymorphism: beyond the iconic Watson-Crick double helix, nucleic acids can adopt a number of unusual motifs, at least in vitro. Scientists around the world gather every two years to discuss two of these oddities: G-quadruplexes and i-DNA. The seventh international meeting on G-quadruplex Nucleic Acids was held in Changchun, in Jilin province of the P.R. of China, approx. 1000 km North-east of Beijing. Nearly 320 participants gathered from Asia, Europe, North America and Oceania. More than 80 talks and as many posters summarized our current knowledge of these unusual DNA and RNA structures. During this meeting, the creation of the G4 society was announced, in order to coordinate efforts and share tools and knowledge in our field (https://www.g4-society.org). • Meeting report for the seventh International Meeting on Quadruplex Nucleic Acids, Changchun, China, 6–9 Sept 2019. • Over 300 scientists gathered to share their newest results in the Quadruplex field. • Recurrent themes were: structure and folding, applications to biotechnologies, formation in cells, proteins & ligands. [ABSTRACT FROM AUTHOR]

A UV-vis, CD, and differential pulse voltammetric study was performed on the deactivation of the activity of parallel G-quadruplex/hemin DNAzymes (G4 DNAzymes) by Pb(II). The G4 DNAzyme carries a d[TC] sequence at its 3′ end and is stabilized by potassium(I). On addition of Pb(II), the K(I) ions in the parallel G4 are replaced by Pb(II) to keep the parallel topology. Intruded Pb(II) decrease the affinity between the topology and hemin, this leads to a decrease of DNAzyme activity for catalyzing the oxidation of 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) by hydrogen peroxide to form a green dye with an absorption maximum at 420 nm. The assay does not use any amplification, and has a linear response in the 0.01 to 10 μM Pb(II) concentration range and a 7.1 nM limit of detection. The method was successfully applied to the analysis of spiked water samples. [ABSTRACT FROM AUTHOR]

Scar formation after wound healing is a major medical problem. A better understanding of the dynamic nuclear architecture of the genome during wound healing could provide insights into the underlying pathophysiology and enable novel therapeutic strategies. Here, we demonstrate that TGF‐β‐induced fibrotic stress increases formation of the dynamic secondary DNA structures called G‐quadruplexes in skin fibroblasts, which is coincident with increased expression of collagen 1. This G‐quadruplex formation is attenuated by a small molecule inhibitor of intracellular Ca2+ influx and an anti‐fibrotic compound. In addition, we identify G‐quadruplex‐forming sequences in the promoter region of COL1A1, which encodes collagen 1, and confirm their ability to form G‐quadruplex structures under physiologically relevant conditions. Our findings reveal a link between G‐quadruplexes and scar formation that may lead to novel therapeutic interventions. [ABSTRACT FROM AUTHOR]

Porphyrins represent a valuable class of ligands for G-quadruplex nucleic acids. Herein, we evaluate the binding of cationic porphyrins metallated with gold(iii) to G-quadruplex DNA and we compare it with other porphyrin derivatives. The G-quadruplex stabilization capacity and the selectivity of the various porphyrins were evaluated by biophysical and biochemical assays. The porphyrins were also tested as inhibitors of telomerase. It clearly appeared that the insertion of gold(iii) ion in the center of the porphyrin increases the binding affinity of the porphyrin for the G-quadruplex target. Together with modelling studies, it is possible to propose that the insertion of the square planar gold(iii) ion adds an extra positive charge on the complex and decreases the electron density in the porphyrin aromatic macrocycle, both properties being in favour of stronger electrostatic and π-staking interactions. [ABSTRACT FROM AUTHOR]

The 2‐(1,2,3‐triazol‐4‐yl)pyridine motif, with its facile "click" synthesis and remarkable coordinative properties, is an attractive chelate for applications in the metal‐directed self‐assembly of intricate three‐dimensional structures. Organic ligands that bear two such chelates bridged by flexible hinge moieties readily undergo self‐assembly with metal ions of different coordination geometries to generate a series of topologically diverse metallomacrocycles that can be used for numerous applications. Herein, the synthesis and self‐assembly of one such ligand with zinc(II), copper(II), and palladium(II) ions is reported, and the stability of the resulting metallomacrocycles described. An investigation into the use of these metallomacrocycles for the recognition of both small‐molecule substrates, such as deoxyguanosine monophosphate, and larger biological assemblies, such as DNA and RNA guanine quadruplexes, is also described. In (or out of) the loop: The unique coordinative properties of the 1,2,3‐triazole–pyridine motif can be harnessed to guide the coordination‐driven folding of rationally designed ligands into metallomacrocycles with different topologies (see picture). These 3D structures can be used to target biomolecules that range from a simple nucleic acid to larger and more intricate guanine‐quadruplex architectures. [ABSTRACT FROM AUTHOR]

Herein we report a new class of G-quadruplex stabilising ligands, multicarbazoles, which display high G-quadruplex DNA selectivity in the presence of 250 times excess duplex DNA. We report the synthesis of these compounds in moderate to high yields. Ligands in the series with optimal G-quadruplex selectivity contain an N-propylamino chain length where the amino functionalities are either pyrrolidine or piperidine. [ABSTRACT FROM AUTHOR]

Abstract: A new fluorescent, non‐cytotoxic perylene diimide derivative with two biotins at the peri position, PDI2B, has been synthesized. This molecule is able to interact selectively with G‐quadruplexes with scarce or no affinity towards single‐ or double‐stranded DNA. These features have made it possible to design a simple, effective, safe, cheap, and selective method for fishing G‐quadruplex structures in solution by use of PDI2B and streptavidin coated magnetic beads. The new cyclic method reported leads to the recovery of more than 80 % of G‐quadruplex structures from solution, even in the presence of an excess of single‐stranded or duplex DNA as competitors. Moreover, PDI2B is a G4 ligand that can display higher thermal stabilization and greater affinity for 2‐ over 3‐tetrad quadruplexes, which constitutes a novel type of behavior. [ABSTRACT FROM AUTHOR]

The Sixth International Meeting on Quadruplex Nucleic Acids was held at the Hotel Internationale in Prague, Czech Republic from 31 May – 3 June 2017. A vibrant interdisciplinary community of over 300 scientists gathered to share their newest results in this exciting field and exchange ideas for further investigations. [ABSTRACT FROM AUTHOR]

G-quadruplexes (G4) are stacked non-canonical nucleic acid structures found in specific G-rich DNA or RNA sequences in the human genome. G4 structures are liable for various biological functions; transcription, translation, cell aging as well as diseases such as cancer. These structures are therefore considered as important targets for the development of anticancer agents. Small organic heterocyclic molecules are well known to target and stabilize G4 structures. In this article, we have designed and synthesized 2,6-di-(4-carbamoyl-2-quinolyl)pyridine derivatives and their ability to stabilize G4-structures have been determined through the FRET melting assay. It has been established that these ligands are selective for G4 over duplexes and show a preference for the parallel conformation. Next, telomerase inhibition ability has been assessed using three cell lines (K562, MyLa and MV-4-11) and telomerase activity is no longer detected at 0.1 µM concentration for the most potent ligand 1c. The most promising G4 ligands were also tested for antiproliferative activity against the two human myeloid leukaemia cell lines, HL60 and K562. [ABSTRACT FROM AUTHOR]

G-quadruplexes (G4) are one of the several different forms of non-canonical DNA structures that can occur in our genome. Their existence is thought to be implicated in important biological functions such as positive and negative transcription regulation or telomeric extension. The human telomeric sequence G4 formed by repetitive nucleotide sequences (T2AG3) at each chromosome end is an important example of intramolecular G4. Knowing the atomic details for different families of ligands targeting G-quadruplex structures hypothetically found in the telomeric repeat it is an important step for rational drug design. Especially if the aim is to prevent or interfere with telomerase extending the 3′ end of telomeres. In this study, we report the structure of the complex formed between the telomeric repeat sequence (d[AG 3 (T 2 AG 3 ) 3 ]) intramolecular G-quadruplex and the 2,4,6-Triarylpyridine compound. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. [ABSTRACT FROM AUTHOR]

Motivation Expanding research highlights the importance of guanine quadruplex structures. Therefore, easy-accessible tools for quadruplex analyses in DNA and RNA molecules are important for the scientific community. Results We developed a web version of the G4Hunter application. This new web-based server is a platform-independent and user-friendly application for quadruplex analyses. It allows retrieval of gene/nucleotide sequence entries from NCBI databases and provides complete characterization of localization and quadruplex propensity of quadruplex-forming sequences. The G4Hunter web application includes an interactive graphical data representation with many useful options including visualization, sorting, data storage and export. Availability and implementation G4Hunter web application can be accessed at: http://bioinformatics.ibp.cz. Supplementary information Supplementary data are available at Bioinformatics online. [ABSTRACT FROM AUTHOR]

G-quadruplexes formed by nucleic acids are implicated in pathologies ranging from cancers to neurodegenerative diseases. We evaluated interactions of 29 bi- and terpyridine derivatives with G-quadruplexes and duplexes. FRET-melting, circular dichroism, and 1H NMR spectroscopy showed that one terpyridine derivative interacted very selectively with G-quadruplexes. This G-quadruplex ligand inhibited helicase activity and should influence G-quadruplex-related biological processes. [ABSTRACT FROM AUTHOR]

G-quadruplexes are non-canonical DNA structures formed by guanine-rich DNA sequences that are implicated in cancer and aging. Understanding how small molecule ligands interact with quadruplexes is essential both to the development of novel anticancer therapeutics and to the design of new quadruplex-selective probes needed for elucidation of quadruplex biological functions. In this work, UV-visible, fluorescence, and circular dichroism spectroscopies, fluorescence resonance energy transfer (FRET) melting assays, and resonance light scattering were used to investigate how the Pt(II) and Pd(II) derivatives of the well-studied 5,10,15,20-tetrakis( N-methyl-4-pyridyl)porphyrin (TMPyP4) interact with quadruplexes formed by the human telomeric DNA, Tel22, and by the G-rich sequences from oncogene promoters. Our results suggest that Pt- and PdTMPyP4 interact with Tel22 via efficient π- π stacking with a binding affinity of 10-10 M. Under porphyrin excess, PtTMPyP4 aggregates using Tel22 as a template; the aggregates reach maximum size at [PtTMPyP4]/[Tel22] ~8 and dissolve at [PtTMPyP4]/[Tel22] ≤ 2. FRET assays reveal that both porphyrins are excellent stabilizers of human telomeric DNA, with stabilization temperature of 30.7 ± 0.6 °C for PtTMPyP4 and 30.9 ± 0.4 °C for PdTMPyP4 at [PtTMPyP4]/[Tel22] = 2 in K buffer, values significantly higher as compared to those for TMPyP4. The porphyrins display modest selectivity for quadruplex vs. duplex DNA, with selectivity ratios of 150 and 330 for Pt- and PdTMPyP4, respectively. This selectivity was confirmed by observed 'light switch' effect: fluorescence of PtTMPyP4 increases significantly in the presence of a variety of DNA secondary structures, yet the strongest effect is produced by quadruplex DNA. Graphical abstract: [Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

DNA circuits tethered to nanoplatforms can perform cascade reactions for signal amplification. One DNA single strand activates a strand-displacement cascade generating numerous outputs, and therefore amplifying the signal. These localized circuits present, however, an important limitation: the spontaneous activation of the cascade reaction. Current methods to stabilize these circuits employ combination of protective DNA strands, which need to be removed to activate the device. This protection-deprotection process generates an important amount of unwanted side reactions. This is indeed an important limitation for the large potential application of these amplification circuits. In the present work, G-quadruplex DNA structures were used to stabilize localized DNA circuits. This new protocol generates nanoplatforms that no longer requires protective-deprotective systems and is therefore completely neutral to the sample. In addition, cations such as Pb2+ or Ca2+ can be also employed to activate the device enlarging the potential applications from biosensors devices to metal detector sensors. [ABSTRACT FROM AUTHOR]

Four-stranded G-quadruplex (G4) DNA structures are promising drug targets as these non-canonical structures appear to regulate gene expression and telomere growth. Although all types of G4 are stabilised by quartets of four guanosines, differences in loops, grooves, and flanking bases, result in an impressive structural diversity among G4 structures that may allow selective recognition by small molecule ligands. We adapted the previously described Förster resonance energy transfer (FRET) melting assay to evaluate the selectivity of G4 ligands for different G-quadruplex topologies. We demonstrated that the incorporation of FAM and Tamra fluorescent dyes and the presence of PEG influenced the structures adopted by certain sequences with G-quadruplex-forming potential. Optimisation of the measurement conditions ensured the folding and thermal stability of a selected set of G4 DNA oligonucleotides in a measurable temperature range with and without ligand. The optimised method enabled comparison of well known G4 ligands such as TmPyP4, Braco19, pyridostatin, 360A, PhenDC3, and TrisQ. [ABSTRACT FROM AUTHOR]

To gain new insights into G-quadruplex–drug interactions, we captured the solution-state structures of the complexes between a drug-like small molecule and a G-hairpin/G-triplex. Our results indicated that the ligand initially binds to the intermediates and induces stepwise folding into a quadruplex. [ABSTRACT FROM AUTHOR]

With the aim of finding selective and biologically active G-quadruplex ligands, modified porphyrin with bulky cationic substituents, meso-5,10,15,20-tetrakis(4-guanidinophenyl)porphyrin tetrahydrochloride, referred to as guanidinium phenyl porphyrin, was prepared. The corresponding nickel(II) and cobalt(III) metallated porphyrins were also synthesized. Interaction with quadruplexes was examined by means of fluorescence resonance energy transfer melting and surface plasmon resonance-based assays: the three compounds proved to bind to G-quadruplex DNA in a similar and highly selective way. Guanidinium phenyl porphyrin and its nickel(II) metallated derivative exhibit moderate cytotoxicity toward cells in culture. Strikingly, the nickel porphyrin derivative was able to displace hPOT1 shelterin protein from telomeres in human cells. Graphical Abstract: Nickel(II) guanidinium phenyl porphyrin, a cationic bulky porphyrin is a powerful specific G-quadruplex DNA ligand. It enters the cells and induces shelterin modification.[Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

DNA and RNA G-quadruplexes (G4) are unusual nucleic acid structures involved in a number of key biological processes. RNA G-quadruplexes are less studied although recent evidence demonstrates that they are biologically relevant. Compared to DNA quadruplexes, RNA G4 are generally more stable and less polymorphic. Duplexes and quadruplexes may be combined to obtain pure tetrameric species. Here, we investigated whether classical antiparallel duplexes can drive the formation of antiparallel tetramolecular quadruplexes. This concept was first successfully applied to DNA G4. In contrast, RNA G4 were found to be much more unwilling to adopt the forced antiparallel orientation, highlighting that the reason RNA adopts a different structure must not be sought in the loops but in the G-stem structure itself. RNA antiparallel G4 formation is likely to be restricted to a very small set of peculiar sequences, in which other structural features overcome the formidable intrinsic barrier preventing its formation. [ABSTRACT FROM AUTHOR]

G-quadruplex DNA ligands attract much attention because of their potential use in biology. Indeed they may interfere with G-quadrulex nucleic acid function in cells. Most of the G-quadruplex ligands so far reported (including also metal complexes) are large planar aromatic compounds that interact by π–π stacking with an external G-quartet of quadruplex. Porphyrins are well-known G-quadruplex ligands. We report herein a new porphyrin scaffold (meso-tetrakis(4-(N-methyl-pyridinium-2-yl)phenyl)porphyrin) able to strongly and selectively bind to G-quadruplex DNA. We show that even when this porphyrin is metallated with cobalt(iii), i.e. it carries two water molecules as axial ligands on the cobalt ion, on each face of the porphyrin, the interaction occurs by a π-stacking-like mode with an external G-quartet of quadruplex DNA. [ABSTRACT FROM AUTHOR]

This study demonstrates that the intronic TP53 polymorphisms rs1642785 and rs17878362 impact on the formation of G4 structures, mRNA splicing and stability, and thus on the differential expression of isoform-specific transcripts of the TP53 gene.G-quadruplex (G4) structures in intron 3 of the p53 pre-mRNA modulate intron 2 splicing, altering the balance between the fully spliced p53 transcript (FSp53, encoding full-length p53) and an incompletely spliced transcript retaining intron 2 (p53I2 encoding the N-terminally truncated Δ40p53 isoform). The nucleotides forming G4s overlap the polymorphism rs17878362 (A1 wild-type allele, A2 16-base pair insertion) which is in linkage disequilibrium with rs1642785 in intron 2 (c.74+38 G>C). Biophysical and biochemical analyses show rs17878362 A2 alleles form similar G4 structures as A1 alleles although their position is shifted with respect to the intron 2 splice acceptor site. In addition basal FSp53 and p53I2 levels showed allele specific differences in both p53-null cells transfected with reporter constructs or lymphoblastoid cell lines. The highest FSp53 and p53I2 levels were associated with combined rs1642785-GG/rs17878362-A1A1 alleles, whereas the presence of rs1642785-C with either rs17878362 allele was associated with lower p53 pre-mRNA, total TP53, FSp53 and p53I2 levels, due to the lower stability of transcripts containing rs1642785-C. Treatment of lymphoblastoid cell with the G4 binding ligands 360A or PhenDC3 or with ionizing radiation increased FSp53 levels only in cells with rs17878362 A1 alleles, suggesting that under this G4 configuration full splicing is favoured. These results demonstrate the complex effects of intronic TP53 polymorphisms on G4 formation and identify a new role for rs1642785 on mRNA splicing and stability, and thus on the differential expression of isoform-specific transcripts of the TP53 gene. [ABSTRACT FROM AUTHOR]

Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers.G-quadruplexes (G4) are regulatory secondary structures in guanine tracts in DNA or RNA. Polymorphisms in two G4-forming regions of TP53 modulate age at cancer onset in susceptible germline TP53 mutation carriers, suggesting that these G4 regulate p53 suppressor functions. [ABSTRACT FROM AUTHOR]

Abstract: The fourth international meeting on G-quadruplex Nucleic Acids was held in the Nanyang Technological University (NTU) of Singapore. Over 150 participants gathered from more than 25 countries. Over 40 talks and 100 posters summarized our current knowledge of these unusual DNA and RNA structures. [Copyright &y& Elsevier]

Peaceful coexistence: A double quadruplex composed of an i‐motif and a G‐quadruplex was constructed within one oligonucleotide strand (see picture). The defined double‐quadruplex structure can serve as a NOTIF logic gate on the basis of the fluorescence of crystal violet. [ABSTRACT FROM AUTHOR]

Abstract: The meeting entitled “Guanosines and quadruplexes” was held in London on September 2010. It attracted over 80 participants from all over the world, combining researchers interested in nucleoside/nucleotide self-assembly and nucleic acids structures, working in fields ranging from chemistry, biology, physics, theory to material sciences and nanotechnology. [ABSTRACT FROM AUTHOR]

A collection of 26 polyammonium cyclophane-type macrocycles with a large structural diversity has been screened for Gquadruplex recognition. A two-step selection procedure based on the FRET-melting assay was carried out enabling identification of macrocycles of high affinity (ΔT½ up to 30°C) and high selectivity for the human telomeric G-quadruplex. The four selected hits possess sophisticated architectures, more particularly the presence of a pendant side-arm as well as the existence of a particular topological arrangement appear to be strong determinants of quadruplex binding. These compounds are thus likely to create multiple contacts with the target that may be at the origin of their high selectivity, thereby suggesting that this class of macrocycles offers unique advantages for targeting G-quadruplex-DNA. [ABSTRACT FROM AUTHOR]

Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the "standard" B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkablequadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes), and in addressing both synthetic issues and biological aspects. [ABSTRACT FROM AUTHOR]

In budding yeast, the Pif1 DNA helicase is involved in the maintenance of both nuclear and mitochondrial genomes, but its role in these processes is still poorly understood. Here, we provide evidence for a new Pif1 function by demonstrating that its absence promotes genetic instability of alleles of the G-rich human minisatellite CEB1 inserted in the Saccharomyces cerevisiae genome, but not of other tandem repeats. Inactivation of other DNA helicases, including Sgs1, had no effect on CEB1 stability. In vitro, we show that CEB1 repeats formed stable G-quadruplex (G4) secondary structures and the Pif1 protein unwinds these structures more efficiently than regular B-DNA. Finally, synthetic CEB1 arrays in which we mutated the potential G4-forming sequences were no longer destabilized in pif1Δ cells. Hence, we conclude that CEB1 instability in pif1Δ cells depends on the potential to form G-quadruplex structures, suggesting that Pif1 could play a role in the metabolism of G4-forming sequences. [ABSTRACT FROM AUTHOR]

Although the impact of telomeres on physiology stands well established, a question remains: how do telomeres impact cellular functions at a molecular level? This is because current understanding limits the influence of telomeres to adjacent subtelomeric regions despite the wide-ranging impact of telomeres. Emerging work in two distinct aspects offers opportunities to bridge this gap. First, telomere-binding factors were found with non-telomeric functions. Second, locally induced DNA secondary structures called G-quadruplexes are notably abundant in telomeres, and gene regulatory regions genome wide. Many telomeric factors bind to G-quadruplexes for non-telomeric functions. Here we discuss a more general model of how telomeres impact the non-telomeric genome – through factors that associate at telomeres and genome wide – and influence cell-intrinsic functions, particularly aging, cancer, and pluripotency. Shelterin proteins are known for telomeric functions only. Emerging evidence shows non-telomeric presence and function of shelterin factors. DNA secondary structure G-quadruplex motifs are enriched in gene promoters. Recent work shows how G-quadruplex-dependent non-telomeric binding of telomere-associated proteins regulates transcription. Interstitial G-quadruplex motifs associate with telomeric protein in a telomere-length-dependent fashion. [ABSTRACT FROM AUTHOR]

We report herein a simple and convenient luminescent assay for detection of base excision repair enzyme activity using an Ir(iii) complex as a G-quadruplex selective probe. Using uracil-DNA glycosylase (UDG) as a model enzyme, the assay achieved high sensitivity and selectivity for UDG over other tested enzymes. The utility of the assay for screening potential UDG inhibitors was also demonstrated. [ABSTRACT FROM AUTHOR]

DOTASQ (for DOTA-templated Synthetic G-quartet) is the first prototype of nature-inspired G-quadruplex ligand: its design, founded on a possible intramolecular G-quartet formation, enables it to interact with G-quadruplex DNA viaan unprecedented nature-mimicking binding mode, based on the association between two G-quartets, one being native (quadruplex) and the other one artificial (ligand). [ABSTRACT FROM AUTHOR]

The majority of drugs are metabolized by cytochrome P450 (CYP) enzymes, primarily belonging to the CYP1, CYP2 and CYP3 families. Genetic variations are the main cause of inter-individual differences in drug response, which constitutes a major concern in pharmacotherapy. G-quadruplexes (G4s), are non-canonical DNA and RNA secondary structures formed by guanine-rich sequences. G4s have been implicated in cancer and gene regulation. In this study, we investigated putative G4-forming sequences (PQSs) in the CYP genes. Our findings reveal a high density of PQSs in the full genes of CYP family 2. Moreover, we observe an increased density of PQSs in the promoters of CYP family 1 genes compared to non-CYP450 genes. Importantly, stable PQSs were also identified in all studied CYP genes. Subsequently, we assessed the impact of the most frequently reported genetic mutations in the selected genes and the possible effect of these mutations on G4 formation as well as on the thermodynamic stability of predicted G4s. We found that 4 SNPs overlap G4 sequences and lead to mutated DNA and RNA G4 forming sequences in their context. Notably, the mutation in the CYP2C9 gene, which is associated with impaired (S)-warfarin metabolism in patients, alters a G4 sequence. We then demonstrated that at least 10 of the 13 chosen cytochrome P450 G4 candidates form G-quadruplex structures in vitro , using a combination of spectroscopic methods. In conclusion, our findings indicate the potential role of G-quadruplexes in the regulation of cytochrome genes, and emphasize the importance of G-quadruplexes in drug metabolism. • G-quadruplexes (G4s) can influence drug response by modulating CYP gene expression. • G4-forming sequences are enriched in CYP family 2 genes. • Some SNPs are located within PQSs or in their immediate vicinity; one non-overlapping mutation changed the DNA G4 sequence. • Cytochrome P450 enzymes-associated mutations may affect DNA and/or RNA G4 formation and stability in CYP genes. [ABSTRACT FROM AUTHOR]

Besides the well-known DNA double-helix, non-canonical nucleic acid structures regulate crucial biological activities. Among these oddities, guanine-rich DNA sequences can form unusual four-stranded secondary structures called G-quadruplexes (G4s). G4-prone sequences have been found in the genomes of most species, and G4s play important roles in essential processes such as transcription, replication, genome integrity and epigenetic regulation. Here, we present a short overview of G-quadruplexes followed by a detailed description of the biophysical and biochemical methods used to characterize G4s in vitro. The principles, experimental details and possible shortcomings of each method are discussed to provide a comprehensive view of the techniques used to study these structures. We aim to provide a set of guidelines for standardizing research on G-quadruplexes; these guidelines are not meant to be a dogmatic set of rules, but should rather provide useful information on the methods currently used to study these fascinating motifs. [ABSTRACT FROM AUTHOR]

The article discusses the role of DNA G-quadruplex ligand in determining G-quadruplex DNA clusters present in human cells. It notes that the target of G4 ligands is the sequences in the nucleus that has the potential to form G4 structures. These structures involve molecules such as pyridostatin with little or no binding to other DNA conformations and has high affinity for G4 DNA. This molecule which interacts with nontelomeric DNA loci promotes growth arrest in human cancer cells.

G ‐ Quadruplexes Duplex DNA formation allows the predictable construction of nanomaterials with a large number of potential applications. Additionally, duplexes and quadruplexes may be combined to form predictable supramolecular structures. In their Full Paper on page 6732 ff., J. ‐ L. Mergny et al. show how classical duplex DNA can guide the strand polarity of a quadruplex motif in a duplex – quadruplex substrate. [ABSTRACT FROM AUTHOR]

G-quadruplexes (G4s) are high-order secondary structures that modulate several key cell processes such as telomere function, gene expression and DNA replication. In the past years G4s have emerged as promising targets for drug development due to the discovery of small molecules which bind and stabilize these structures. In this work, we report the synthesis of indole-based compounds and the study of their interaction with the biological relevant G4s c-MYC and human telomeric repeat 22AG using several biophysical techniques. The ligands are G4 specific and they can discriminate different G4 structures namely parallel and hybrid-1 topologies. The NMR study of interaction between the most promising indole-derivative (compound 3 ) and c-MYC quadruplex suggests that the ligand binds on the external tetrads with additional actions in the loops/grooves in a 2:1 ratio. The molecular docking calculations of compound 3 to c-MYC quadruplex corroborates with the 1 H and NOESY NMR studies. Overall, the results suggest that indole-based ligands are promising candidates for future lead optimizations in drug development. [ABSTRACT FROM AUTHOR]

The equilibrium between G-quadruplex (G4) and duplex DNA structures is a fundamental question whenever G4 are considered within a genomic context. In this study, we performed a detailed thermodynamic and kinetic analysis of this equilibria using a new fast and high throughput technique for the screening of G4 structures. This assay examines the isothermal stability of G-quadruplexes in the presence of complementary strands monitoring the unwinding process by fluorescence techniques. Unlabelled G4 structures were used in order to avoid any thermodynamic effect that fluorophores could have on the G4 stability. The assay was applied to investigate the effect that flanking sequences can have on the thermodynamic stability of the quadruplex motifs. Interestingly, the presence of adjacent bases to the G4 structure facilitates the recognition of the complementary strand accelerating the G4 unfolding reaction. The simplicity of the systems employed and the use of fluorescence emission allowed the use of high throughput techniques and to monitor the opening reaction in real time in a “pseudo” label-free method. This G4 opening reaction may be easily implemented as a new isothermal assay for the screening of G4 structures, G4 ligands or G4-binding proteins. [ABSTRACT FROM AUTHOR]