Search

Backgroundjuvenile systemic lupus erythematosus (jSLE) is the most frequent pediatric connective tissue disease with multiorgan involvement and different outcomes and prognosis. Corticosteroids remain the base treatment option and steroid-sparing treatment is strongly required to avoid steroid toxicity. Rituximab (RTX) is one of biologics, which efficacy was proved in case reports and case series of SLE, but no data from big randomized trials, confirming the efficacy have existed.Objectivesto evaluate safety and efficiency of RTX in jSLE.Methodsin the retrospective observation study the information of 48 jSLE patients (12 boys, 36 girls) who received at least one RTX dose before 18 years, included. Diagnosis was made using SLICC criteria. The main indications for RTX were high disease activity with lupus nephritis (LN), CNS and hematology disturbances (hemolytic anemia, thrombocytopenia) and avoiding steroid toxicity. RTX was prescribed in dosage 375 mg/m2 every week (2-4 infusions) with repeated courses every 6-12 months according disease activity, the degree of B-cell depletion and hypoIgG-emia. The dynamics of clinical, laboratory data, activity of the disease by SLEDAI, GCS doses were assessed in the onset and during RTX trial.ResultsThe main patient’s characteristics were: onset age 13.0 (11.5; 15.0) years, inclusion age 18.0 (16.0; 20.0) years, LN 25 (52%)/III+IV class 9/11 (82%), CNS involvement 26 (54%). Pre-RTX non-biologic conventional treatment includes: cyclophosphamide 24 (50%), MMF 14 (29%), azathyoprine 7 (15%), methotrexate 6 (13%), cyclosporine A 2 (4%). Observation period ranged from 6 months to 6 years with median time 0.75 (0.2; 2.75) years. Initial pre-RTX treatment (GCS, hydroxychloroquine, non-biologic DMARDS) partially reduced SLE activity (SLEDAI, ANA titer, anti-dsDNA level), and median GCS dose by 25% from the initial dose, without changes in proteinuria, hematuria, C3, C4, WBC, hemoglobin, PLT and ESR levels. Administration of the RTX realized in prominent reducing of SLEDAI, anti-dsDNA level, proteinuria, hematuria, C4, ESR, number of patients with anemia, thrombocytopenia, and median GCS dose by 90% from the initial. The hemoglobin level and WBC have increased. 19 patients received IVIG for treatment of MAS (n=3), infection (n=5) and as replacement treatment in cases where IgGrd RTX infusion and meningitis, caused by Lysteria monocytogenis, after 1st RTX infusion (further RTX treatment continued without adverse events), patella osteomyelitis (n=1). 10 patients received antibiotics for respiratory infections. On pre-RTX 13 had antibiotics (p=1.0).Table 1.Dynamics of SLE features pre-RTX and during RTX trialParameterSLE onsetRTX (baseline)pLast visitp*SLEDAI16 (11.0; 23.5)13.5 (6.5; 21.5)0.00024 (0; 8.0)0.00002Patients with elevated anti-dsDNA n, (%)33 (69)20 (42)0.00811 (23)0.034Anti-dsDNA, U/ml (n.v.112 (1; 200)24.7 (1; 130)0.0590 (0; 27)0.008Proteinuria, g/l2.6 (0.8; 4.4)3.8 (0.3; 7.5)0.6870 (0; 0.2)0.004Hematuria, # cells40 (8; 86)50 (6; 120)0.1910 (0; 1)0.0016C4, g/l0.12 (0.1; 0.24)0.12 (0.06; 0.19)0.3980.15 (0.11; 0.21)0.016Patients with leucopenia, n(%)12 (25)10 (21)0.6295 (10)0.00001Patients with anemia n (%)19 (40)16 (33)0.097 (15)0.0015Hemoglobin, g/l113 (95;131)115 (91; 132)0.830128 (107; 134)0.063Patients with thrombocytopenia n (%)17 (35)9 (19)0.0052 (4)0.00001ESR, mm/h17 (8; 31)15 (7; 22)0.1347 (2; 20)0.054Patients with GCS therapy n, (%)45 (94)45 (94)1.040 (83)0.00001GCS, mg/kg1.0 (0.6; 1.0)0.75 (0.2; 1.0)0.0350.1 (0.08; 0.28)0.000001*compare to RTX baselineConclusionRTX showed effectiveness in the cases, where previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of RTX.AcknowledgementsThis research was funded by the Ministry of Science and Higher Education of the Russian Federation (Agreement No. 075-15-2020-901)Disclosure of InterestsNone declared

Background:Hip osteoarthritis (HOA) is a severe outcome of juvenile idiopathic arthritis (JIA) itself and also can be result of corticosteroid (CS) treatment, if it was used. Total hip arthroplasty (THA) is the last step in JIA treatment and indicates ineffectiveness of conservative treatment.Objectives:We aimed to evaluate risk factors which lead to THA in JIA patients with HOA.Methods:753 patients aged 2-17 years were included in our retrospective study during the last 10 years. Diagnosis was made according to ILAR criteria. Clinical, laboratory and radial examinations were evaluated. Diagnosis of HOA was made on MRI, CT and planar radiograms and confirmed by morphological examination of removed femoral heads.Results:Total 153/753 (20.3%) patients with JIA had hip involvement. HOA developed in 48/153 (31.4%) of JIA patients and 16/48 (33.3%) of them had THA was undergone. Prevalence of HOA and THA (%) in JIA subtypes: in polyarticular (5/32 (15.6%) and 8/16 (50%), systemic (6/32 (18.7%) and 5/16 (31.2%)), enthesitis-related (19/32 (59.4%) and 3/16 (18.8%)) and psoriatic (2/32 (6.7%) and 0/16) subtypes respectively, р=0,0000001. Patients who underwent THA initially had higher level of inflammation: elevated ESR (33 vs 5 mm/h, p=0.002) and CRP (14.7 vs 1.9 mg/l, p=0.03), more active joint, and especially involvement of joints of upper limbs: elbows (p=0.004) and proximal interphalangeal joints (p=0.001), arthritis of subtalar joint (p=0.02). Delayed biologic treatment (7.5 vs 3.4 years, p=0.043) and delayed achievement of remission (9.2 vs 5.6 years, p=0.047) were main predictors of THA. Patients with HOA without biologics had increased cumulative probability of THA: HR=1.99 (1.01; 3.98), p=0.049 (Figure 1). Patients with THA received corticosteroids (93.7 vs 50%, p=0.003) more often including high dose pulse-therapy regimes, but differences in the cumulative doses were not observed (5000 vs 4500 mg, p=0.54) between groups, CS administration was independent risk factor of HOA and THA.Figure 1.Cumulative probability of THA in JIA patients with hip osteoarthritis.Conclusion:the main risk factors of THA are systemic and polyarticular course because of their activity, systemic CS and delayed biologic treatment. Corticosteroids should be avoided in those group of patients because of risk of avascular pathway HOA formation.This work supported by the Russian Foundation for Basic Research (grant № 18-515-57001).Table 1.The features of JIA patients with hip osteoarthritis depending onJIA featuresTHA, (n=16)HOA without THA, (n=32)pTime to THA, years5.2 (3.6; 10.2)4.6 (2.2; 8.7)0.4Onset age, years7.95 (3.5; 11.1)8.3 (4.3; 13.1)0.5JIA duration, years8.5 (6.5; 13.2)5.43 (2.8; 11.1)0.07Polyarticular JIA, n (%)8 (50.0)5 (15.6)0.037Systemic JIA, n (%)5 (31.3)6 (7.0)0.037ANA, n (%)3/8 (37.5)5/16 (31.3)0.760HLA B27, n (%)3/6 (50)9/19 (47.4)0.911RF, n (%)0/9 (0)1/15 (6.7)0.429Uveitis, n (%)1/16 (6.3)3/24 (12.5)0.519ESR, mm/h33 (13; 54)5 (3; 27)0.002CRP, mg/l14.7 (2.9; 72.3)1.9 (0.3; 12.7)0.03Active joints, n21.5 (8.5; 52.5)9 (5; 16)0.02Elbows, n (%)11 (68.7)8 (25.0)0.004Proximal interphalangeal joints, n (%)10 (62.5)5 (15.6)0.001Subtalar, n(%)4 (25.0)1 (3.1)0.02Pulse-therapy GCS, n(%)11 (68.7)10 (31.3)0.014Cumulative GCS dose, mg5000 (3000; 14000)4500 (500; 20000)0.54Time to biologic, years7.6 (4.3; 11.4)3.4 (1.9; 8.6)0.04Achievement of remission, years9.2 (6.6; 15.4)5.6 (3.3; 11.4)0.047Disclosure of Interests:None declared

Background:While efficacy of tofacitinib (TOF) has been proven in many adult immune-mediated conditions, the information on its’ safety and efficacy in the pediatric population is limited.Objectives:to evaluate the safety and efficacy of TOF in children with immune-mediated diseases.Methods:from 23 children whom TOF has been initiated, 17 children with treatment duration of > 6 months were extracted including 16 girls and 1 boy with the following diagnosis: JIA (n=10), autoinflammatory diseases (AID) (n=5) and juvenile dermatomyositis (JDM) (n=2) due to impossibility to taper corticosteroids (CS) or previous biologic treatment failed. The treatment outcome was classified according to the opinion of the attending physicians as complete response (CR) i.e., the absence of disease activity, partial response (PR) – a significant improvement of symptoms and disease activity or no response (NR) - no changes in disease activity.Results:Mean duration of TOF treatment was 25.4±18.9 months. TOF was used as monotherapy in 3 cases, in combination with methotrexate (MTX) in 6, and in combination with other biologics in 3 children: tocilizumab (n=2) and canakinumab (n=1). Nine patients received CS. (Table 1). In two JIA patients with alopecia TOF induced intensive hair growth and controlled joint inflammation. 9 patients had CR: AID (n=3), JIA (n=4) and JDM(n=1): 7 patients had PR and 1 was NR. 13 patients had a previous history of several subsequent failed biologic: 4 biologics (n=1), 3 biologics (n=6), 2 biologics (n=1), 1 biologic (n=5). TOF treatment allowed discontinuation of CS in patient#6 and reducing the CS in 8/10 patients from 0.4 ±0.27 mg/kg to 0.15±0.1 mg/kg in 3.7±3.4 times: in 2 cases the tapering of steroids failed (Figure 1). 4 patients had side effects not requiring treatment discontinuation: liver enzymes elevation (n=2), hypercholesterolemia (n=1), lymphadenitis (n=1). In pt#6 after achievement of the remission the TOF dosage was decreased up to 2 times and tocilizumab intervals were increased up to 6 weeks.Table 1.#DiagnosisIndicationPrevious biologicsCurrent treat-mentTOF, dose, mg/kgDurationof TOF treatment, monthsGeneticvariantsdetectedEfficacy1AIDSevere inflamma-tion, aortitis, colitisINX, TCZ, ADACS, TOF0.57NOD2 c.2578G>A (p.A860T); NOD2 c.2722G>C (p.G908R)ADA2 c.927G>A (p.M309I)PR2JDMrecurrent skin rashCS, TOF, MTX0.55PR3JDMskin involvement, ulcerationCS, MTX, TOF0.77NLRP12c.154G>A (p.G52S)CR4AID,IFPskin rash, recurrent inflammation, failure to thriveCAN, TCZCS, TOF, CAN0.532RNASEH2Bc.916dupA (p.I309Nfs*7)CR5JIA,polysevere arthritisETA,TCZ, ADATOF,TCZ0.2722PR6soJIAresistant to CS and biologic systemic inflammation, arthritisTCZ, ABC, CANTOF, TCZ0.423PR7JIA,poly (RF+) alopeciaSevere arthritis, lung involvement,alopeciaETA, ABC, TCZ, ADATOF, MTX, CS0.337IL1RN c.10G>C (p.A4P); NLRP3 c.2113C>A (p.Q705L); MEFV c.1105C>T (p.P369S)CR8IFP, CANDLE-likerecurrent inflammation, digital ischemia, ulcers, CS-dependencyETA, RTX, CANTOF, CS0.2543MDA5NLRP3CR9AID, IFPsystemic inflammation, ulcersETATOF, CS0.513СR10JIA, ERAarthritisETATOF, MTX0.244CR11JIA, polyarthritisABC, ETATOF, MTX0.2538CR12JIA, polyArthritis, alopeciaETATOF0.1531PR13soJIA + MASsystemic inflammation, arthritisTCZ, CAN, ETATOF, CS0.538NR14JIA, polyarthritisINX, ETA, ADA, TCZTOF, MTX0.224PR15AIDSystemic inflammation, CS-dependencyTCZTOF,CS0.521STAT3, c1343A>CPR16JIA, ERAarthritisETATOF0.2521PR17JIA, polyarthritisADA, TCZ, ETATOF0.1539СRFigure 1.Conclusion:Tofacitinib is a promising agent in treating pediatric rheumatic diseases. In our study the best results were in AID patients with rare alleles in interferon pathway genes, patients with arthritis and alopecia and in children with JDM. Future studies are needed to identify clear indications for treatment with JAK-inhibitors.Acknowledgements:This work was supported by the RSF grant №20-45-01005.Disclosure of Interests:None declared.

Background:Macrophage activation syndrome (MAS) is a severe life-threatening complication of the systemic-onset juvenile idiopathic arthritis (soJIA). The treatment options included high-dose of the corticosteroids (CS), cyclosporine A (CsA), intravenous immunoglobulin (IVIG) and biologics, predominantly IL-1 antagonist – anakinra. In Russia anakinra has not approved yet, so canakinumab (CAN) is a single anti-IL-1 option, available in Russia.Objectives:To evaluate the safety and efficacy of canakinumab in patients with severe MAS in soJIA, who failed the previous treatment.Methods:In the retrospective case series study were included 9 soJIA patients (4 boys and 5 girls) with severe MAS, resistant to combination of high-dose CS, IVIG and CsA.Results:All patients had a MAS during the onset of JIA. The main clinical features of disease onset included: fever 9 (100%), active arthritis 5 (56%), pleuritis 7 (78%), pericarditis – 5 (56%), peritonitis 2 (22%), rash 6 (67%), hepatomegaly 9 (100%), splenomegaly 9 (100%), lymphadenopathy 7 (78%), bleeding 4 (44%), CNS involvement – 3 (33%). Initial treatment included high doses CS 8 (89%), oral CS 9 (100%), methotrexate 5 (56%), tocilizumab 4 (44%), and canakinumab 5 (56%), CsA 4 (44%), IVIG 6 (67%). TCZ was discontinued due to infusion reaction (n=2), TCZ inefficacy (n=3) and presence of MAS in all patients (n=5). In children whom TCZ was switched on CAN we used the standard dose of CAN 4 mg/kg, but if MAS occurred on the CAN we temporally increased the doses since 8 to 25 mg/kg (300 mg). In all cases MAS episodes were successfully resolved during CAN treatment. In 5 (56%) MAS had repeated course during the CAN which lead to temporally increasing the doses of CAN (pt3, pt5, pt8, pt 9) or required to increase immunosupression with abatacept or tofacitinib. Three patients with repeated MAS developed interstitial lung disease (ILD). Two patients who successfully resolved MAS after CAN had relapses of arthritis and switched CAN to TCZ.IDSexJIA onset, yRepeated MASInitial biologicMAS on CANExperience of increased CAN dosesOutcomesCurrent treatment1F7.7NTCZNNRemissionCAN2F11.5NCANNNsoJIA flare, ILDTCZ3F7.9YCANYYRemissionCAN4F3.4NTCZNYRemission, ILDCAN, CS, MMF5M0.8YTCZYYRemission, ILDCAN, abatacept, CsA, CS6M14.2YCANNNRemissionTCZ7M1.1YCANNNRemissionN8М1.3NCANYYRemissionCAN every 12 months9F9.1NTCZYYMinimal disease activityCAN, tofacitinibFootnotes: CAN – canakinumab, CS – corticosteroids, CsA – cyclosporine A, ID – identification, ILD – interstitial lung disease, F – females, M – males, N- no, TCZ – tocilizumab, Y – yes.Conclusion:Canakinumab is an effective rescue treatment either soJIA either MAS. In patients with MAS developed on CAN required the temporal increasing of the doses.Funding statement:This work was supported by the Russian Foundation for Basic Research (grant № 18-515-57001).Disclosure of Interests:None declared

Background:Uveitis is the most common extra-articular manifestation of juvenile idiopathic arthritis (JIA). Usually uveitis developed during first two years after arthritis occurred [1]. In the previous studies was shown the shorter time interval between arthritis and uveitis the severe uveitis course was observed [2]. Information about course of uveitis developed before arthritis is scarce.Objectives:We aimed to evaluate the clinical features and therapy of JIA-associated uveitis, which developed before and after joint manifestation.Methods:In the retrospective study 191 pediatric autoimmune uveitis included. The onset age ranged from 1 to 17 years. We evaluated differences in clinical, laboratorial and treatment differences between groups, i) where uveitis developed before (n=58) and ii) after (n=133) arthritis. Chronic autoimmune uveitis without joint manifestations was excluded.Results:Uveitits before arthritis developed in 58 (30.4%) cases. Patients whom uveitis developed before arthritis had were elder and characterized equal gender involvement, rare ANA positivity, and rare use of immunosupression, e.g. corticosteroids, biologics and methotrexate, due to treatment by ophthalmologist predominantly. Patients developed uveitis before arthritis received biologics earlier due to severity of uveitis (LogRank test, p=0.016, HR=1.97 (95%CI: 1.3; 3.1, p=0.004). Data are in the Table 1 and Figure 1.Conclusion:Patients with JIA associated uveitis with initial ocular presentation demonstrated more severe course and delayed diagnostics and treatment due to lack of contacts with pediatric rheumatologist. Cooperation between ophthalmologist and pediatric rheumatologist is strictly required in all cases with chronic anterior uveitis.Table 1.Table 1.ParameterUveitis before arthritis (n=58)Uveitis after arthritis (n=133)pSex, female32 (55,2)97 (72,9)0.016Onset age, years6.7 (4.6; 10.2)3.2 (2; 6.1)0.000001JIA categoryOligoarthritis41 (70.7)84 (63.6)0.174Polyarthritis9 (15.5)36 (27.3)Enthesytis-related arthritis8 (13.8)12 (9.1)Type of uveitisAnterior44 (75.9)111 (84.1)0.315Peripheral3 (5.2)2 (1.5)Posterior3 (5.2)3 (2.3)Panuveitis8 (13.8)16 (12.1)Unilateral uveitis, n (%)19 (32.8)48 (36.1)0.632ANA posititivity, n (%)25/54 (46.3)72/110 (65.5)0.019HLA B27 positivity, n (%)8/35 (22.9)13/62 (21.0)0.828Methotrexate, n (%)3 (5.2)57/132 (43.2)0.0000001Systemic corticosteroids, n (%)3 (5.2)44/131 (33.6)0.00003Biologic, n (%)26 (44.8)88 (66.2)0.006ESR, mm/h19.0 (4.0; 25.0)23 (15.0; 32.0)0.095CRP, mg/l97.0 (0.1; 107.5)8.1 (0.9; 57.4)0.493Time between arthritis and uveitis, years2.7 (0.9; 4.3)4.0 (2.0; 7.1)0.016Time before biologic, years2.5 (0.9; 3.5)1.3 (0.5; 5.0)0.462This work supported by the Russian Foundation for Basic Research (grant № 18-515-57001).References:[1]Verazza S, et al. Pediatr Rheumatol Online J 2008;6(Suppl 1):77.[2]Zannin ME, et al. Acta Ophthalmol 2012;90:91-5.Disclosure of Interests:None declaredFigure 1.

Background:JIA is the most common chronic condition in pediatric rheumatology. The cervical spine (CS) involvement is associated with severe disease activity and disability and has been recognized as a factor of a poor prognosis. Data about the CS involvement is contradictory due to silent CS involvement in some patients.Objectives:the aim of our study was to provide a clinical profile of the patients with the CS involvement.Methods:753 patients for last 10 years with JIA were analyzed. Patients were divided depending on the CS involvement, which was confirmed by clinical (pain, LOM) and radiological features (effusion in the CS joints). We evaluated active joints and routine tests, such as CRP, ESR, ANA-positivity and HLA B27Results:The CS involvement was in 101 patients (13.4%). The data are in the table. The CS involvement was more frequently associated with joints of upper body, such as TMJ (23.7% vs 2.9%, p=0.000001), shoulder (29.7% vs 2.9%, p=0.000001), elbow (34.2% vs 12.2%, p=0.000001), wrist (61.4% vs 21.8%, p=0.0000001), MCP (43.6% vs 18.4%, p=0.0000001), PIP (52.5% vs 21.3%, p=0.0000001), DIP (23.8% vs 7.1%, p=0.0000001) and hip (44.6% vs 16.6%, p=0.0000001), and ankle (60.4% vs 40.2%, p=0.0001) from lower body.ParametersCS, yes (n=101)CS, no (n=652)pFemale, n (%)69 (68.3)388 (59.5)0.092ANA-positivity, n (%)22/57 (38.6)190/403 (47.2)0.226HLA B27-positivity, n (%)12/33 (36.4)88/275 (32.0)0.613Onset age, years5.3 (2.7-10.1)6.1 (3.0- 10.4)0.241ESR, mm/h12.0 (5.0-31.0)7.0 (3.0- 18.0)0.0006CRP, mg/l3.9 (0.0- 20.0)1.1 (0.0-9.2)0.002Active joints, n (%)16.0 (9.0-28.0)5.0 (3.0-10.0)0.000000Time before remission, years2.9 (1.5-5.1)2.2 (1.1-4.6)0.046OligoarthritisPolyarthritisPsoriatic arthritisEnthesitis-related arthritisSystemic arthritis5 (5.0)48 (48.0)7 (7.0)22 (21.8)19 (18.9)199 (30.5)217 (33.3)33 (5.1)164 (25.2)39 (6.0)0.0000001Uveitis, n (%)9/76 (11.9)107/444 (24.1)0,018Oral glucocorticosteroids, n (%)37 (36.7)115/651 (17.7)0.00001Biologic, n (%)68 (67.3)283 (43.4)0.000007Remission, n (%)57 (56.4)428 (65.6)0.072Flare, n (%)10 (9.9)128/651 (19.7)0.018Conclusion:The main risk factors of CS involvement in JIA were polyarthicular and systemic arthritis, high inflammatory activity and involvement of joints of upper body. Patients with CS involvement required more often biologics.Disclosure of Interests:None declared

Background:Hip osteoarthritis (HOA) is a severe irreversible complication of patients with juvenile idiopathic arthritis (JIA) leads to intensive pain, disability and required total hip arthroplasty (THA) in childhood or in the young adults.Objectives:the aim of our study was to evaluate risk factors of HOA in JIA patients.Methods:we analyzed 753 patients with JIA for last 10 years. In each patient we observed if the HOA developed or no. We evaluated the main clinical JIA measurements, such a JIA category, CRP, ESR, WBC, PLT, active joints, initial or delayed hip involvement, ANA, HLA B27, onset age, JIA duration, time before HOA and before THA, bone metabolic markers, treatment, particularly glucocorticosteroids (GCS), their cumulative doses, route of administration (oral, intra-articular, pulse therapy). HOA was confirmed with radiological assessment (MRI and CT). For comparison analysis used nonparamentric statistics. Each possible variable was evaluated with univariate regression analysis and further multiple regression analysis was applied.Results:the comparative study between 2 groups shown in the table 1. HOA was detected in 48 (6.4%), in oligoarthritis-0%, in polyarthritis - 4.9%, in psoriatic arthritis - 5.0%, in enthesitis-related arthritis -11.8%, in systemic arthritis 19% (p=0.0000001), THA was performed in 16 (2.1%). Hip involvement at onset of JIA was similar in both groups (49.5% vs 41.7%, p=0.367).Table 1.Characteristics of JIA patients, depends on HOA development.ParameterHOA (n=48)No HOA (n=705)pOnset age, y8.0 (4.0; 12.5)5.9 (3.0; 10.7)0.045HLA B27, n (%)13/25 (52.0)88/283 (31.1)0.033JIA duration, y7.5 (3.2; 12.1)4.2 (1.8; 7.2)0.00007CRP, mg\l2.8 (0.8; 20.9)1.3 (0; 7.1)0.006Active joints, n11.0 (6.0; 27.0)6.0 (3.0; 12.0)0.000001Oral GCS, n(%)21 (43.8)131/704 (18.6)0.00003GCS pulse-therapy, n (%)21 (43.8)114/702 (16.2)0.000002GCS, cumulative doses, mg5000 (3000; 16000)2000 (1000; 4000)0.001Biologics, n (%)43 (89.6)308 (43.7)0.0000001Remission, n (%)24 (50.0)461 (65.4)0.03Time, before remission, y7.4 (3.9; 12.3)3.0 (1.4; 6.2)0.0000001Alkaline phosphatase, U\l129.3 (84; 244)223 (147; 386)0.00001Delayed hip involvement, n (%)28 (58.3)24/87 (27.6)0.00004We calculated cut-off and OR of variables, associated with HOA development (table 2). After selection of 26 clinically meaningful and statistical significant risk factors only 22 pass the univariate regression analysis. In multiple regression analysis the main independent risk factors of HOA development were: HLA b27 (p=0.001), oral GCS/pulse therapy GCS (p=0.03) and alkaline phosphatase≤165 U/l (p=0.00006).Table 2.Cutt-offs, odds ratio for HOA risk factors in JIA patients.ParameterSeSpOR (95%CI)pActive joints > 489,642,06,2 (2,4-15,9)0,000002Alkaline phosphatase ≤ 165 U/l65,970,84,7 (2,4-9,2)0,000001GCS > 2700 mg82,658,16,6 (2,1-20,6)0,0004Time before remission>5 years66,778,97,5 (3,1-18,0)0,0000001Time before biologics >7,8 years44,286,75,2 (2,6-10,2)0,0000001Conclusion:the main risk factors of HOA were increased inflammatory activity, systemic arthritis, HLA B27, systemic corticosteroids, delayed remission and biologics, decreased bone metabolism. Delayed hip involvement underline the possible non-inflammatory mechanism of HOA, such as avascular necrosis.Disclosure of Interests:None declared

Cryopyrin-associated periodic syndrome (CAPS) is an inherited disease which is caused by gain-of function mutations in CIAS1 gene function resulting in increased secretion of active IL-1β. IL-1β also can stimulate the production of other proinflammatory cytokines, such as IL-6, TNFα and so on (downstream cascade). The use of IL-1 blockers dramatically controls inflammation in CAPS patients and provide a persistent amelioration of the inflammatory manifestations. The data about using of IL-6 or TNFα blockers in CAPS are very limited.

Hepcidin - 25-amino acid peptide - is known to be a key regulator of systemic iron metabolism [Ganz T., Nemeth E., 2012]. Hepcidin acts indirectly through ferroportin, which is both a receptor for hepcidin and the only known exporter of iron in the human body [De Falco L. et. al., 2013]. Hyperproduction of hepcidin due to the influence of pro-inflammatory cytokines, especially IL-6, triggers to transport of iron from circulation to the storage, consequently, limiting iron accessibility for erythropoiesis [Weiss G., Goodnought T., 2005]. Thus, overproduction of hepcidin seems to be the leading mechanism of development of anemia in children with Juvenile Idiopathic Arthritis (JIA). A set of negative factors of a chronic disease, particularly disbalance of vitamins, proteins, amino acids and minerals, which are also the known causes, of anemia can weaken control of iron metabolism by hepcidin.

Background Systemic juvenile idiopathic arthritis (SoJIA) is the most striking form of juvenile idiopathic arthritis. The aim of our study was to evaluate the clinical responses and outcomes of children with SoJIA to IL-6 blockade using two different tocilizumab (TCZ) treatment protocols designed for milder and more severe SoJIA patient groups, and evaluate the possibility of achieving biologic-free remission. Methods Thirty-seven active SoJIA children who have failed treatment with corticosteroids and other DMARDs were included in our retrospective study. TCZ doses were prescribed in two treatment approaches: every 2 weeks TCZ dosing (Q2W) and every 4 weeks TCZ dosing (Q4W). The patients were assigned to these two groups by the study physicians depending on the severity of the SoJIA disease as judged by each clinician. Results Thirty-three of the 37 children successfully completed the trial. TCZ was discontinued in 11patients during the trial. Seven children achieved inactive disease and were allowed to stop the TCZ and 4 had severe adverse events requiring drug cessation. Currently 7 patients continue to have TCZ-free remission [4/7 remission off-medication, 3/7still on methotrexate (MTX)]. This mixed group had a median treatment duration of 1002 days. The children in remission off of all medications, TCZ and MTX, had a median remission duration of 1162 days (ranged 932–1301 days). Compared to the patients assigned to the Q2W TCZ treatment group, the patients assigned to the Q4W TCZ group had a milder SoJIA course. The patients had higher levels of hemoglobin, total proteins, and serum albumins. They had lower white blood cell counts (WBC), % granulocytes, CRP, ESR, ferritins, and LDH. These children had a lower frequency of internal organ involvement, fewer relapses during TCZ treatment, and no macrophage activation syndrome episodes. Conclusions Our experience with TCZ for SoJIA supports the excellent result of other studies. What may be novel is our finding that thisIL-6 blockade with TCZ may be able to be utilized at a less frequent dosing schedule in mild SoJIA compared to severe SoJIA. We discuss other factors that may increase the probability of a patient reaching TCZ-free remission.

Background Chronic non-bacterial osteomyelitis (CNO) is a heterogenous group of immune-mediated inflammatory bone diseases, often co-exist with other rheumatic diseases. There are no approved treatments for CNO except non-steroid anti-inflammatory drugs (NSAID). The efficacies of methotrexate (MTX), sulfasalazine, pamidronate (PAM), anti-IL1 and TNFα-inhibitors (TNFα-inh) were shown in different reports. Objectives The aim of study: to compare the efficacy of non-randomized different treatment approaches in pediatric patient CNO cohort. Methods 52 children (25 M and 27 F) with CNO has average age at the onset of disease 8.4 years (5.4÷11.0), the number of foci - 3.0 (2.0÷6.0, incl. multifocal cases in 80.8%), fever at the onset – 38.5%, spine involvement - 34.6%, positive family autoimmune diseases (AID) history - 7.7%, concomitant AID - 67.3%. NSAID was the first-line treatment for non-vertebral cases, as well as PAM for vertebral involvement. Second-line treatment includes MTX, PAM and TNFα-inh. Dynamics of pain, patient9s (PVAS) and physician9s (MDVAS) assessment and ability to each medication to achieve remission of CNO activity we evaluated. Results According to the NSAID, MTX, SSZ, PAM and TNFα-inh groups next data were registered: PVAS: -14.2% (p=0.05), -50.0% (p=0.04), -23.1 (p=0.89), -83.3% (p=0.0001), -73.6% (p=0.0007); pain: -21.9% (p=0.01), -18.6% (p=0.13), +36,4 (p=0.89), -79.7% (p=0.00016), -74.1%, (p=0.0015); MDVAS: -13.8% (p=0.13); -56.4% (p=0.09), +30.8% (p=0.89), -74.7%, (p=0.0001), -82.1 (p=0.0015) respectively. The ability of each treatment strategy to achieve the CNO remission was 52.6%, 44.4%, 57,1%, 88.8% and 73.3% respectively (log-rank test, p=0,001, figure). TNFα-inh usually used as second-third line treatment in cases where other options, especially PAM were fall. Conclusions The most effective treatment approaches for CNO were PAM and TNFα-inh. The randomized controlled trials for assessment efficacy and safety of these medications is mandatory to confirm these results. Disclosure of Interest None declared

Background Juvenile idiopathic arthritis (JIA) is a chronic rheumatic disease with onset before 16 years. According ILAR classification there are several categories based on number of joints, clinical and laboratorial features. Patients with JIA without systemic features who fall or not tolerated to methotrexate (MTX) or sulfasalasine (SSZ) usually treated by biologics, especially TNFα-inhibitors. Currently only 2 TNFα-inhibitors approved in JIA: etanercept and adalimumab (ADA). Objectives The aim of study was to evaluate the efficacy of ADA in children with JIA without systemic features and ability to induce remission. Methods In the retrospective observation study were included 53 children (67.9% girls) with active JIA without systemic features, who were resistant to previous therapy with MTX alone (or SSZ in enthesytis-related arthritis) or with combination with other non-biologic DMARDs and were treated with subcutaneous ADA injections every 2 weeks. The onset age was 3.9 (1.7–7.8) years, the interval between onset of JIA and start of ADA was 4.2 (0.3–15.2). Uveitis was detected in 32 (60.3%) patients. According number of active joints and clinical features all patients were divided into 3 groups: oligoarthicular course (OA) – 4 active joints or less, polyarthricular course (PA) – 5 active joints or more and enthesitis-related arthritis (ERA) with any active joints. We evaluated routine clinical and laboratorial test for JIA and ability and time to achieve inactive disease, according to C. Wallace criteria (2004). Results Number of active joints (NAJ) and erythrocyte sedimentation rates significantly decreased, while levels of C-reactive protein, WBC, Hb and platelets still unchanged. In 12 months after start of ADA median of NAJ was equal 0. During the trial 44 (84.6%) patients reached the status of inactive disease (ID) according the C. Wallace criteria in median time 122.0 (36.5–220.0). We have not found any significant differences of initial JIA parameters between patients who achieved and not achieved status of ID. We have found differences in JIA groups in achievement ID: patients with OA similar to PA faster and frequently get into remission than patients with ERA (p=0.03, Log-Rank test, OA vs ERA). During the trial 26 (50.0%) have experienced the flare throw the median time 551.0 (317.0–809.0) days after 1st ADA injection. Patients with flare had less NAJ [1.0 (0,0; 2,0) vs 4.0 (1,0; 8,0), p=0.007]. The main predictors of JIA flare during the ADA trial were calculated with Cox-regression models: JIA duration ≥4 years before start of ADA (HR=2.4, p=0.055), presence of concomitant uveitis (HR=4.8, p=0.0008) and discontinuation of MTX (HR=3.2, p=0.19). During the trial 1 SAE was detected: disseminated tuberculosis in patient who received ADA near 3 years (unrecognized family contact). Conclusions In our study the efficacy of ADA was shown. Further trials required for evaluation long-term outcomes. Disclosure of Interest None declared

Background Juvenile idiopathic arthritis (JIA) is a chronic rheumatic disease with onset before 16 years. According ILAR classification there are several subtypes were defined based on number of joints and clinical and laboratorial features. Polyarticular course includes patients with more than 4 affected active joints and consists of RF-positive and RF-negative polyarticular JIA (pJIA) and extended oligoarticular JIA. Methotrexate (MTX) is standard therapy for patients with pJIA. Patients who fall or not tolerated to MTX usually treated by biologics, block the main pro-inflammatory cytokines such as TNFα, Il-1 and IL-6. Recently, toclizumab, an anti-Il-6-receptor antibody has been approved for pJIA in children after 2 years. Objectives The aim of our study to evaluate the efficacy and safety of tocilizumab in children with pJIA. Methods In the retrospective observation study were included 20 children (85% girls) with active pJIA, who were resistant to previous therapy with MTX alone or with combination with other non-biologic DMARDs and were treated with IV infusion of tocilizumab in the dosage 8 mg/kg every 4 weeks. The onset age was 2.85 (1.4; 6.4) years, the interval between onset of JIA and start of TCZ was 6.0 (1.6; 9.8). The duration of TCZ ranged 6 to 42 months (since 2010). 25% of patients were received tocilizumab monotherapy. Results NSAIDS were successfully discontinued in all patients during the trial, in 4 patients second non-biologic DMARD was successfully discontinued and methotrexate was discontinued in 3 patients. Erythrocyte sedimentation rates (p=0.001), C-reactive protein (p=0.005), WBC (p=0.001) and platelets (p=0.002) count were significant decreased to normal range during the first 6 months, then number of active joints decreased slower (p=0.01) ([Fig.1][1]). During the trial 8 (44.4%) patients in different time reached the status of inactive disease (ID) according the C. Wallace criteria. There were no significant differences in achievement of ID between biologic-naive patients (n=12) and patients who were treated with biologics before (n=8, p=0.18). The main predictors of achievement of ID were CRP ≤7.5 mg/l (HR=5.3, p=0.035), ESR ≤19 mm/h (HR=8.9; p=0.01) and tocilizumab monotherapy (HR=9.1; p=0.01). The more frequent adverse events (AE) were transient hypercholesterolemia, and single episodes of low-grade neutropenia which did not lead to tocilizumab discontinuation or using any other medications. ![Figure][2] Conclusions In our study the long-term efficacy and safety of tocilizumab in children with pJIA was shown. During the trial the high proportion of children reached the ID. The tocilizumab monotherapy was as effective as combination with methotrexate. No significant differences were observed in achievement of ID between biologic-naive patients and children, who fall previous biologic treatment. No serious AE leading to tocilizumab discontinuation were detected during the trial. Disclosure of Interest None declared [1]: #F1 [2]: pending:yes

Background Uveitis is the most common extra-articular manifestation of juvenile idiopathic arthritis (JIA), often entirely asymptomatic but could be sight-threatening. The main predictors of uveitis in JIA are oligoarticular (OA) subtype, ANA-positivity and younger age at the JIA onset. Methotrexate (MTX) has been able to decrease the incidence of uveitis in JIA up to 2 times [1]. Treatment of JIA depends on number of active joints: NSAID and intra-articular (IAC) steroid injection are the first line-therapy for OA subtype of JIA. In Russia there is a restricted access to prolonged intra-articular steroids, such as triamcinolone hexacetamide. In the cases of relapse after short-term IAC followed by start of MTX therapy, which lead to higher proportion of patients with JIA, treated with MTX then in Europe and North America. Objectives To re-evaluate the possibility of MTX to prevent the onset of uveitis in Russian JIA cohort patients with increased proportion of applying of MTX. Methods The clinical charts of all consecutive patients who had received a stable management for at least 2 years with or without MTX were reviewed. Patients who were given systemic medications other than MTX (except NSAID) were excluded. Patients with systemic arthritis, rheumatoid factor-positive arthritis, or enthesitis-related arthritis were also excluded. In each patient, the al least 2-year follow-up period after first visit was examined to establish whether uveitis had occurred. Results A total of 281 patients with a median disease duration of 3.8 year were included. One hundred and ninety one patients (68%) were treated with MTX compare to 33.9% in previous study [1]. During the at least 2-year follow-up, 64 patients (22.8%) developed uveitis, a median of 1.6 year after the disease onset. The frequency of uveitis was lower in MTX-treated than in MTX-untreated patients (11.5% vs 46.7%, respectively, OR=6.7 (95%CI:3.7-12.3), p=0.0000001). In previous study the frequency of uveitis was 10.5 in MTX-treated vs 20.2 in MTX-untreated patients [1]. Survival analysis confirmed that patients treated with MTX had a lower probability of developing uveitis (HR=4.35, p=0.000001) (Fig.). In subgroup analysis was shown that MTX more preventive in boys (HR=6.7, p=0.0007) than in girls (HR=3.6, p=0.000001); in patient with onset age more than 5 years (HR=22.2, p=0.000001) than whom disease onset less 5 years (HR=2.3, p=0.003). The data of survival analysis of MTX prevention not shown benefits depend on number of active joints: in OA (HR=4.0, p=0.000001) similar to polyarthritis (HR=3.7, p=0.02) and ANA status: ANA-positive (HR=4.4, p=0.00002) similar to ANA-negative (HR=3.6, p=0.003). Conclusions MTX therapy may prevent the onset of uveitis in children with JIA. Further randomized controlled trial required to confirmation our results. References Papadopoulou C, Kostik M, Bohm M, Nieto-Gonzalez JC, Gonzalez-Fernandez MI, Pistorio A, Martini A, Ravelli A. Methotrexate Therapy May Prevent the Onset of Uveitis in Juvenile Idiopathic Arthritis. J Pediatr 2013;163:879-84 Disclosure of Interest None declared

Background/Purpose: Systemic juvenile idiopathic arthritis (SJIA) is one of the most striking forms of juvenile arthritis, required biologics due to failure of corticosteroids (CS) and DMARDs. In Russia until March 2013 no Il-1 blockers were available. Since tocilizumab (TCZ) was approved in adults with rheumatoid arthritis we used it for treatment of SJIA. The aim of our study was to evaluate outcomes and to find possible criteria, related with different treatment TCZ protocols and achievement TCZ-off remission. Methods: our retrospective study was included 33 active SJIA children who fall CS, methotrexate (MTX), cyclosporine A (CsA) and their combination. We used TCZ in 2 branches in standard doses: every 2 (Q2W) or every 4 weeks (Q4W). The randomization was based on efficacy which was evaluated in 14th day. If patient had no signs of TCZ inefficacy during next 2 weeks (days 15–29) the patient was referred to Q4W group (n=24), if any clinical or laboratorial signs of inefficacy during first 4 weeks were occurred the patient was treated Q2W (n=9). The protocol of this trial was approved by local Ethic Committee of our University. The term “efficacy” means at least ACR70 improvement and absence of systemic features. Results: The main demographic parameters (Me;IQR) included the age-10.2 (6.0–12.75) years and delay of TCZ-36.0 (11.2–97.0) months. Treatment before TCZ were CS-31 (93.9%), MTX-29 (87.9%), CsA-16 (48.5%) and their combination. The macrophage activation syndrome (MAS) before TCZ was in 8 (24.2%). During the trial CS successfully discontinued 19/31 (61.3), CsA 9/16 (56.3%), MTX 8/29 (27.6%) patients. In 5 children TCZ was discontinued due to stable remission with median duration 640 days (3/5 remission off-medication, 2/5 still on MTX). After TCZ initiation 4 children have experienced MAS, but all of them had MAS before TCZ, so no “new cases” were observed on TCZ. 3 children early withdrew during the trial due to adverse events (infusion reaction, MAS) and 1 child died (severe uncontrolled MAS). Patients which were treated every 4 weeks had milder SJIA course compare with Q2W (table 1). Factors, related with milder SJIA course and allowed to use Q4W TCZ were: Hb>10.3 g/dl (p=0.00001), WBC ≤12.6*109/l (p = 0.013), granulocytes ≤8556 cells/μl (p = 0.00037), CRP ≤82.2 mg/l (p = 0.002), ESR ≤26 mm/h (p = 0.02), ferritin ≤605 mg/ml (p = 0.0001) before start of TCZ and granulocytes in 1 week after 1st TCZ ≤8142 cells/μl (p = 0.014). Criteria, associated with TCZ-off remission were: absence of knee (p = 0.045) and cervical spine involvement (p = 0.03), number of active joints ≤12 (p = 0.05), ESR ≤40 mm/h (p = 0.05), total protein ≤6.6 g/dl (p = 0.04) at the moment of 1st TCZ infusion and granulocytes in 2 week ≤2907/μl (p = 0.038), WBC in 4 week ≤6300/μl (p = 0.026) after 1st TCZ. Table 1. Parameters Q2W (n = 9) Q4W (n = 24) p a Me (IQR), Fisher's exact test Hemoglobin, g/dl 9.8 (9.6–10.3) 11,5 (10,9–13,1) 0,003 Anemia, n (%) 8 (88.9) 10 (41,7) 0,02a WBC,a109/l 17.2 (13.6–20.8) 9,5 (7,65–13,2) 0,016 Granulocytes, cells in 1 μl 13728 (11424–18382) 6318 (4822–8184) 0,005 Granulocytes in 1 week, cells 1 μl 8944 (6560–12375) 3314 (1840–7240) 0,015 CRP, mg/l 84.5 (20.6–104.8) 17.6 (6.7–74.5) 0.025 ESR, mm/h 45.0 (42.0–61.0) 25.0 (10.5–47.5) 0.016 Ferritin, mg/ml 858.0 (326.0–1859.0) 128.0 (48.5–238.0) 0.004 LDH, U/l 714.0 (655.5–792.5) 464.0 (360.0–513.0) 0.02 Total protein, g/dl 6.6 (6.2–6.9) 7.1 (6.8–7.7) 0.003 Albumin, g/dl 2.1 (1.7–2.6) 3.1 (2.9–3.3) 0.002 Hepatomegaly 8 (88.9) 9 (37.5) 0.017a Coagulopathy 3 (33.3) 0 (0.0) 0.015a Interstitial lung disease 4 (44.4) 1 (4.2) 0.013a CNS dysfunction 5 (55.6) 0 (0.0) 0.001a Knee arthritis 2.0 (2.0–2.0) 1.5 (0.0–2.0) 0.02 Knee arthritis, n (%) 9 (100.0) 14 (58.3) 0.03a MAS before TCZ 4 (44.4) 4 (16.7) 0.17 MAS during TCZ 4 (44.4) 0 (0.0) 0.003a TCZ efficacy, n (%) 6 (66.7) 23 (95.8) 0.05a SJIA relapses 4/9 (44.4) 1 (4.2) 0.013a TCZ discontinuation. due to: 3 (100.0) 6 (100.0) 0.038 -remission 0/3 (0.0) 5/6 (83.3) -infusion reaction 0/0 (0.0) 1/6 (16.7) -MAS + infusion reaction 2/3 (66.7) 0/6 (0.0) -MAS death 1/3 (33.3) 0/6 (0.0) Conclusion: We found clinical and laboratorial criteria for mild/moderate SJIA allowed to use TCZ Q4W and provisional criteria, related to achievement TCZ-off remission.

Background Systemic-onset juvenile idiopathic arthritis (SoJIA) is one of the most striking forms of juvenile arthritis, which can lead to severe joint disability, organ involvement and potentially could be life-threatening. Objectives The aim of our study was to evaluate clinical response to IL-6 blockade, according to different tocilizumab (TCZ) treatment, outcomes and possibility to achieve drug-free remission. Methods Our retrospective study was included 37 active SJIA children who fall corticosteroids (CS) and DMARDs and their combination and in whom TCZ was initiated in standard dosage. We used TCZ in 2 branches: every 2 weeks (Q2W) and every 4 weeks (Q4W), depended on the severity of disease, steroid-dependence, presence of MAS and organ involvement. Patients with milder SJIA course (CS≤0.2-0.3 mg/kg, no signs of MAS and no organ involvement) were considered as suitable for Q4W treatment. Only patients who had no signs of flare, exacerbation, side effects and signs of TCZ inefficacy during 4 weeks and received TCZ Q4W (n=26). Patients who successfully treated with TCZ Q4W were recognized as group of low disease activity (LDA). If any signs of inefficacy during first 4 weeks were occurred the patient was treated with TCZ Q2W (n=11). Also if patient later had any signs of insufficient efficacy of TCZ Q4W this patient was re-assessed as HDA patient and referred to appropriate group. Results From 37 children included in the trial 33 (89.1%) successfully completed it. TCZ was discontinued in 10 patients during the trial: 6 children achieved inactive disease, allowed to stop TCZ, 4 had severe adverse events. Currently 6 patients have TCZ-free remission (3/6 remission off-medication, 3/6 still on MTX) with median duration 661 days. Patients who treated Q4W had milder SJIA course: higher hemoglobin, total protein, albumin, lower WBC, granulocytes, CRP, ESR, ferritin, LDH, no new cases of macrophage activation syndrome (MAS), lower frequency of organ involvement and relapses during TCZ treatment. No patients, who required TCZ every 2 weeks, experienced TCZ-free remission by now. All cases of MAS relapses during TCZ course were only in Q2W group. Q4W patients decreased the granulocytes number intensively than Q2W. Hb>10.3 g/dl, granulocytes≤9792 cells in 1 μl, granulocytes in 1 week≤8142 cells in 1 μl, WBC in 2 weeks≤7.5*109/l, granulocytes in 2 weeks≤3975 cells in 1 μl, platelets>208*109/l, ESR≤26 mm/h, ferritin≤605 mg/ml, LDH≤571 U/l, total protein>7.2 g/dl, albumin>2.8 g/dl, absence of hepatosplenomegaly, coagulopathy, cardiorespiratory, CNS and kidney involvement, no MAS during TCZ were factors increased possibility to use TCZ Q4W and referred the patient to LDA group. Fever before and MAS after TCZ initiation, lymphadenopathy, coagulopathy, CNS dysfunction and treatment Q2W decreased possibility to achieve TCZ-off remission. Conclusions Different response to IL-6 blockade distinguishes two different subsets of SJIA. We offer the provisional criteria distinguish patients with LDA and HDA and provisional criteria probability to rich TCZ-free remission. Disclosure of Interest None declared DOI 10.1136/annrheumdis-2014-eular.2273

Background/Purpose: macrophage activation syndrome (MAS) is a life-threatening complication of systemic juvenile idiopathic arthritis (SJIA). More than half cases of MAS are steroid-resistant and required to use second-line agents, such as cyclosporine A (CsA), intravenous immunoglobulin (IVIG) and biologic agents. Known interleukin-1 (IL-1) is the key cytokine in pathogenesis of MAS and SJIA, so anti-IL-1 treatment considered as potential effective treatment. There are several publication about efficacy of increased doses of anakinra during the MAS episodes. Data about efficacy others new IL-1 blockers (canakinumab and rilonacept) for MAS in SJIA are limited. There are only several cases of MAS during and after canakinumab (CNKB) treatment of SJIA in randomized controlled trials. Methods: a retrospective study of the clinical notes, reports of laboratory investigations and radiological images. We included 3 patients with SJIA who developed MAS. First patient (Pt#1) had the severe form of MAS, resistant to high doses of steroids, IVIG, CsA. After failure of previous treatment anakinra was added, and later changed on CNKB. Second patient (Pt#2) developed SJIA flare with severe MAS after 3rd CNKB injection, resistant to high doses steroids, IVIG, required Fresh Frozen Plasma, third patient (Pt#3) developed only mild MAS after 8th CNKB injection without signs of SJIA flare. Indications for increased doses of CNKB were inefficacy of previous anti IL-1 treatment in standard and increased doses and severity of MAS (Pt#1, Pt#2) according the manufacture's manual permitted to use the maximum dose of 300 mg per injection. The initial CNKB dose before MAS was 4 mg/kg every 4 weeks in Pt#2 and Pt#3. All patient during the MAS received one single injection of increased dose of CNKB: 15 mg/kg (Pt#1), 12.5 mg/kg (Pt#2) and 7.5 mg/kg (Pt#3). CNKB was injected every 4 weeks with gradually tapering dose up to 4 mg/kg every 4 weeks. All parents signed the inform consent. Institutional Review Board affirmed this kind of treatment. Results: in Pt#1 initial treatment with standard doses of anakinra was insufficient and dose was increased up to 20 mg/kg/day with good response. Later anakinra was changed on CNKB in 1st dose 15 mg/kg every 4 weeks with gradually tapering dose up to 6 mg/kg up to now. The switching from anakinra to CNKB did not loose the efficacy. In Pt#2 after initiation of increased dose of CNKB the flare of JIA and active MAS was dramatically abrupt up to 7th day after 1st injection. Total normalization of lab tests occurred in 2 weeks. After normalization we tapered corticosteroids. In Pt#3 MAS also quickly disappeared, the normalization of lab test also occurred in 10 days. No side and adverse effects were noticed during using of increased anakinra and CNKB doses. Conclusion: SJIA and MAS are both IL-1- dependent conditions. The SJIA flare and MAS usually associated with increased production of pro-inflammatory cytokines, especially IL-1β. So we suppose that increased levels of IL-1β require increased doses of IL-1 blockers. Our data shows the efficacy and safety of increased doses of IL-1 blockers. It is necessary to provide future trials to evaluate the efficacy and safety increased doses of IL-1 blockers for treatment MAS in SJIA.

Background/Purpose: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32—a 32 base pair deletion in the coding region—in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. Methods: 234 children (193 of European origin, 25–Hispanic or Latino, 14–Afro-Americans, 3–of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5′CTTCATTACACCTGCAGTC3′, CCR5-Δ32-R: 5′TGAAGATAAGCCTCACAGCC3′ by following condition: 95°–5′×1; 95°–15″55°–15″72°–60″×40; 72°–10′×34°–∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus. Results: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10–18% for Northwestern Russia, Kofiady, 2008; 11,8%– for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see 1). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. Table 1. Sign CCR5-delta32 (+)Mediana (frst quartile; thrd quartile) CCR5-delta32 (–) Mediana (frst quartile; thrd quartile) p AST, U/l 30.5 (25.1; 36.5) 50.6 (36.1; 69.0) 0.003 LDH, U/l 386.0 (382.0; 543.0) 1049.0 (635.0; 1086.0) 0.02 Total protein, g/l 76.5 (73.1; 82.5) 67.0 (65.0; 70.0) 0.01 Ferritin, µg/l 1200.0 (1200.0; 1200.0) 1278.0 (117.0; 2629.0) 0.0000001 Polyarticular course, (%) 100.0 20.0 0.015 Conclusion: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations—most of them related to the signs of the Macrophage Associated Syndrome—can be the basis for a more sophisticated research.

Background/Purpose: Uveitis often is the only initial clinical manifestation of JIA for years. There are no reliable markers of JIA-associated uveitis and impossibility to overcome ocular barriers impede diagnosis and treatment leading to blindness. During the last years the number of proteins identified in tears increased from 200 (Herber et al., 2001) of only 17 (Zhou et al., 2003) different molecular weights (MW) to 491 (de Souza et al., 2006) with 80 chemokines, cytokines, and growth factors (Sack et al., 2005). Objective of the study is to reveal protein markers of JIA-associated uveitis in tears using high-resolution mass-spectrometry and hierarchical clustering methodology. Methods: Standard clinical protocol was used to diagnose uveitis and JIA. Tear samples drawn from 17 JIA-patients with uveitis, 4 JIA-patients without uveitis, 3 patients with systemic vasculitis, 4 patients with idiopathic uveitis and 3 healthy subjects were analyzed. Tears were collected on a filter paper, digested with trypsin and the peptides were purified on Zip tips. The samples were loaded to nano C18 column attached to Shimadzu nano LC coupled in-line to LTQ Orbitrap XL tandem mass spectrometer (Thermo Fischer Scientific, GA, USA). The mass spectra of the peptides were detected with a data-dependent 4-event scan method (a survey FT-MS parent scan followed by sequential datadependent FT-MS/MS scans on the three most abundant peptide ions from the parent scan). Proteins were identified from the mass spectra results with Proteome Discoverer software for protein database search using the International Protein Index (IPI) Human Protein Database (version 1.79). Quantification was conducted using SIEVE. Results: About 3000 proteins were detected in tears. Among those, 236 proteins (MW 7.4–466 kDa) were chosen as candidates for early diagnosis of the JIA-associated uveitis. Besides the rheumatoid factors RFET12, RF-IP14, RF-IP24, cytokines and T-cell receptor alpha-chain, we identified anti-CD40 single-chain antibody fragment A49, inhibiting protein CD40 which is a member of the TNF-receptor superfamily, lipocalin-1 precursor, associated with immune response and prostaglandin synthesis, clusterin inhibiting the cytolytic reaction of complement components, anti-TNF-alfa antibody light chain Fab fragment, protein phosphatase, regulatory subunit 15B, which plays a role in cell progression, apoptosis and regulation of membrane receptors and channels, DMBT/8kb.2 protein, which takes part in the interaction of tumor cells and the immune system. Conclusion: The result of our study demonstrates the benefits of high resolution mass- spectrometry for analysis and development of molecular signatures which can be used in diagnostics. Hierarchical clustering methodology allowed grouping according to expression profiles and the dendrogram construction procedure revealed clusters of proteins associated with iron metabolism as the most promising markers of JIA-associated uveitis. Earlier it was shown that induced anterior uveitis in the eyes of rats can be described in terms of proteins drawn from the anterior chamber (Sobn et al., 2000), which result is close to our terms of description.

Results Fever at onset, high painVAS and parental VAS scores highly correlated with risk of relapse disease course. Treatment: effectiveness of NSAID only 3/10 (30%), SSZ - 1/5 (20%), corticosteroids - 0/3 (short-term effect only), MTX - 4/7 (57.1%), pamidronate (PAM) with partial response 2/12 (16.7%) and with complete response 10/12 (83.3%). Biologics - adalimumab and etanercept were effective in 3/4 (75%) patients, who fail to NSAID, MTX, PAM and SSZ. During disease course treatment lead to decreasing sings of disease activity, such as: parental VAS (p = 0.015), pain VAS (p = 0.026), MDVAS (p = 0.026), CRP (p = 0.0008), WBC (p = 0.006), ESR (p = 0.00024), PLT (0.014). The main effectiveness belonged to PAM (p = 0.003) and biologics (p = 0.07) in decreasing of pain VAS (-100% and -80%), parental VAS (-92% and -74%) and MD VAS (-93% and -70%, respectively). We calculated the cumulative probability of survival (event of interest: CNO flare) in the entire patient sample, depending the kind of treatment (PAM, MTX and NSAID) obtained by the Kaplan-Meier method. Significant difference was proved comparing 3 therapeutical branches (p = 0.028). MTX treatment was effective (p = 0.04), as well as PAM (p = 0.01) than NSAID. Only flulike syndrome during PAM treatment was in 10/12 (83.3%). No any others side effects were reported. All patients who had flu-like syndrome on first infusion had complete response to PAM, vice verse patients, who had no such complication had only partial response to this treatment.

Background Juvenile idiopathic arthritis is a quite widespread pathology in the group of connective tissue diseases and leads to severe disability in case of inefficient treatment. With the extension of medical drug offer, it became possible to bring a patient into remission, to prevent the joint destruction and organ involvement. Still the selection of basic drug for particular child remains a difficult task, as well as the selection of the biologics, usually TNF-a blocker, in case of failure. There are different approaches in this case: to take another TNF-a blocker or the medicine with different work principle, for example, Abatacept. Methods Experience of Abatacept application in the centre counts about 2 years. The retrospective analysis of efficiency, reasons of the cancellation and undesirable side effects was held. Results Total number of children who received Abatacept was 20 patients. 17 of them were females and 3 – males. Length of disease before Abatacept prescription was 6,2 years on average. Average age of children was 11 years (from 4 to 15 years). Dose corresponded with standard: 10 mg/kg according to scheme 1-15-29 days and then each 28th day by intravenous diffusion. All children had active arthritis: polyarthritis, RF – 11 children, oligoarthritis + uveitis – 4 children, systemic JIA without systemic signes – 5 children, oligoarthritis – 1 child. The average length of application was 8 months (from 3 to 20 months). It is interesting to mention that for 17 of 20 children Abatacept was the first biologic after failure of standard basic therapy that included application of glucocorticoids at 12 of 20 children (60%). One basic medicine was inefficient at 3 of 20 children, two were uneffective at 9 of 20 children, three – at 7 of 20 and four were inefficient at 1 person. It is easily seen that the arthritis was very active, because most part of children received 2 or 3 basic medicines, while the observation period for efficiency assessment was more than 3 months. 78% of patients achieved ACR Pedi 30, that corresponds with published research data. The maximal effect is connected with VAS of pain which is the most sensitive and dynamic measure. Positive dynamics also were seen by SRP and ESR that reflect the inflammation activity. Abatacept was cancelled at 7 of 20 patients (35%), while 65% continue receiving the treatment. Reasons for cancellation were remaining exacerbation of uveitis, activity of joint syndrome, diffusion of arthritis. For one child Orencia was cancelled because of an impossible venous access. The medicine was cancelled: in case of oligoarthritis at 2 children (60%), systemic arthritis at 1 person (20%), seronegative polyarthritis at 3 person (27%). Undesirable side effects are: severe headache and stomachache, that appeared at 1 patient on 7th day after Orencia infusion (she received 3 infusion in general). Conclusions Efficiency of Abatacept can be compared to the other biologics by ACR Pedi criteria. A good safety profile: low frequency of undesirable side-effects, low frequency of severe undesirable side-effects and infusion reactions. No cases of tuberculosis, opportunistic infections, pneumonia were registered. Disclosure of Interest None Declared

Chronic non-bacterial osteomyelitis (CNO) is a heterogenous group of immune-mediated inflammatory bone diseases, which often co-exist with other rheumatic diseases. There are no approved treatments for CNO, except non-steroid anti-inflammatory drugs (NSAID). The efficacy of methotrexate (MTX), sulfasalazine, pamidronate (PAM), anti-IL1 and TNFα-inhibitors was shown in different reports, but there are some concerns about safety of pamidronate due to long-term accumulation and persistation in bone. The aim of our study was to compare the efficacy of non-randomized different treatment approaches in pediatric patient cohort with CNO.

Cryopyrin-associated periodic syndrome (CAPS) is an inherited disease which is caused by gain-of function mutations in CIAS1 gene function resulting in increased secretion of active IL-1β. As known more than 40% of patients with CAPS are genetic negative in CIAS1 gene. One of theories explains this is a fact is a somatic mozaicism.

Objectives The purpose of our study was to detect early clinical and laboratory signs that help to discriminate macrophage activation syndrome (MAS) from active systemic juvenile idiopathic arthritis (SJIA) without MAS. Methods Our retrospective study was based on reviewing the medical charts of the children admitted to the rheumatology department with active SJIA and definite MAS ( n = 18) and without MAS ( n = 40). We evaluated the data related to SJIA and MAS at the moment of the patient׳s admission. If the patient had signs of MAS since admission or developed definite MAS later during this flare, he was referred to the main group. The children who did not have MAS during the flare episode and did not have MAS in the past medical history were in the control group. We calculated the cutoff points for MAS parameters, performed the analysis of sensitivity and specificity, identified the predictors, and provided the preliminary diagnostic rule through "the-number-of-criteria-present" approach. Results The clinical signs were relevant to MAS in SJIA: oligoarticular disease course (OR = 5.6), splenomegaly (OR = 67.6), hemorrhages (OR = 33.0), and respiratory failure (OR = 11.3). The involvement of wrist (OR = 0.2), MCP (OR = 0.1), and PIP joints (OR = 0.1) was protective against MAS development. The best cutoffs for laboratory parameters were PLT ≤ 211 × 10 9 /l, WBC ≤ 9.9 × 10 9 /l, AST > 59.7U/l, LDH > 882U/l, albumin ≤ 2.9g/dl, ferritin > 400μg/l, fibrinogen ≤ 1.8g/l, and proteinuria. The laboratory variables were more precise in the discrimination of early MAS than clinical: any 3 or more laboratory criteria provided the highest specificity (1.0) and sensitivity (1.0) and OR=2997. Conclusions We detected clinical and laboratory markers and created preliminary diagnostic (laboratory) guidelines for early discrimination of MAS in active SJIA.

Macrophage activation syndrome (MAS) - is a severe life-threatening hematological condition, complicated different rheumatic diseases. MAS is characterized by uncontrolled proliferation of T cells and macrophages, associated with decreased natural killer (NK) cells and cytotoxic T cell function due to mutations in perforin gene.