Search

Accurate detection of viable Leishmania parasites is critical for evaluating visceral leishmaniasis (VL) treatment response at an early timepoint. We compared the decay of kinetoplast DNA (kDNA) and spliced-leader RNA (SL-RNA) in vitro, in vivo, and in a VL patient cohort. An optimized combination of blood preservation and nucleic acid extraction improved efficiency for both targets. SL-RNA degraded more rapidly during treatment than kDNA, and correlated better with microscopic examination. SL-RNA quantitative polymerase chain reaction emerges as a superior method for dynamic monitoring of viable Leishmania parasites. It enables individualized treatment monitoring for improved prognoses and has potential as an early surrogate endpoint in clinical trials., Competing Interests: Potential conflicts of interest. All authors: No reported conflicts. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed., (© The Author(s) 2024. Published by Oxford University Press on behalf of Infectious Diseases Society of America. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)

Spliced leader trans-splicing of pre-mRNAs is a critical step in the gene expression of many eukaryotes. How the spliced leader RNA and its target transcripts are brought together to form the trans-spliceosome remains an important unanswered question. Using immunoprecipitation followed by protein analysis via mass spectrometry and RIP-Seq, we show that the nematode-specific proteins, SNA-3 and SUT-1, form a complex with a set of enigmatic non-coding RNAs, the SmY RNAs. Our work redefines the SmY snRNP and shows for the first time that it is essential for nematode viability and is involved in spliced leader trans-splicing. SNA-3 and SUT-1 are associated with the 5' ends of most, if not all, nascent capped RNA polymerase II transcripts, and they also interact with components of the major nematode spliced leader (SL1) snRNP. We show that depletion of SNA-3 impairs the co-immunoprecipitation between one of the SL1 snRNP components, SNA-2, and several core spliceosomal proteins. We thus propose that the SmY snRNP recruits the SL1 snRNP to the 5' ends of nascent pre-mRNAs, an instrumental step in the assembly of the trans-spliceosome., (© The Author(s) 2024. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Trans-splicing of a spliced leader (SL) to the 5' ends of mRNAs is used to produce mature mRNAs in several phyla of great importance to human health and the marine ecosystem. One of the consequences of the addition of SL sequences is the change or disruption of the open reading frames (ORFs) in the recipient transcripts. Given that most SL sequences have one or more of the trinucleotide NUG, including AUG in flatworms, trans-splicing of SL sequences can potentially supply a start codon to create new ORFs, which we refer to as slORFs, in the recipient mRNAs. Due to the lack of a tool to precisely detect them, slORFs were usually neglected in previous studies. In this work, we present the tool slORFfinder, which automatically links the SL sequences to the recipient mRNAs at the trans-splicing sites identified from SL-containing reads of RNA-Seq and predicts slORFs according to the distribution of ribosome-protected footprints (RPFs) on the trans-spliced transcripts. By applying this tool to the analyses of nematodes, ascidians and euglena, whose RPFs are publicly available, we find wide existence of slORFs in these taxa. Furthermore, we find that slORFs are generally translated at higher levels than the annotated ORFs in the genomes, suggesting they might have important functions. Overall, this study provides a tool, slORFfinder (https://github.com/songbo446/slORFfinder), to identify slORFs, which can enhance our understanding of ORFs in taxa with SL machinery., (© The Author(s) 2023. Published by Oxford University Press.)

Spliced-leader trans -splicing (SLTS) has been described in distantly related eukaryotes and acts to mark mRNAs with a short 5' exon, giving different mRNAs identical 5' sequence-signatures. The function of these systems is obscure. Perkinsozoa encompasses a diversity of parasitic protists that infect bivalves, toxic-tide dinoflagellates, fish and frog tadpoles. Here, we report considerable sequence variation in the SLTS-system across the Perkinsozoa and find that multiple variant SLTS-systems are encoded in parallel in the ecologically important Perkinsozoa parasite Parvilucifera sinerae . These results demonstrate that the transcriptome of P. sinerae is segregated based on the addition of different spliced-leader (SL) exons. This segregation marks different gene categories, suggesting that SL-segregation relates to functional differentiation of the transcriptome. By contrast, both sets of gene categories are present in the single SL-transcript type sampled from Maranthos, implying that the SL-segregation of the Parvilucifera transcriptome is a recent evolutionary innovation . Furthermore, we show that the SLTS-system marks a subsection of the transcriptome with increased mRNA abundance and includes genes that encode the spliceosome system necessary for SLTS-function. Collectively, these data provide a picture of how the SLTS-systems can vary within a major evolutionary group and identify how additional transcriptional-complexity can be achieved through SL-segregation.

Spliced leader trans-splicing is essential for gene expression in many eukaryotes. To elucidate the molecular mechanism of this process, we characterise the molecules associated with the Caenorhabditis elegans major spliced leader snRNP (SL1 snRNP), which donates the spliced leader that replaces the 5' untranslated region of most pre-mRNAs. Using a GFP-tagged version of the SL1 snRNP protein SNA-1 created by CRISPR-mediated genome engineering, we immunoprecipitate and identify RNAs and protein components by RIP-Seq and mass spectrometry. This reveals the composition of the SL1 snRNP and identifies associations with spliceosome components PRP-8 and PRP-19. Significantly, we identify a novel, nematode-specific protein required for SL1 trans-splicing, which we designate SNA-3. SNA-3 is an essential, nuclear protein with three NADAR domains whose function is unknown. Mutation of key residues in NADAR domains inactivates the protein, indicating that domain function is required for activity. SNA-3 interacts with the CBC-ARS2 complex and other factors involved in RNA metabolism, including SUT-1 protein, through RNA or protein-mediated contacts revealed by yeast two-hybrid assays, localisation studies and immunoprecipitations. Our data are compatible with a role for SNA-3 in coordinating trans-splicing with target pre-mRNA transcription or in the processing of the Y-branch product of the trans-splicing reaction., (© The Author(s) 2022. Published by Oxford University Press on behalf of Nucleic Acids Research.)

In the parasite Trypanosoma brucei, the causative agent of human African sleeping sickness, all mRNAs are trans -spliced to generate a common 5' exon derived from the spliced leader (SL) RNA. Perturbations of protein translocation across the endoplasmic reticulum (ER) induce the spliced leader RNA silencing (SLS) pathway. SLS activation is mediated by a serine-threonine kinase, PK3, which translocates from the cytosolic face of the ER to the nucleus, where it phosphorylates the TATA-binding protein TRF4, leading to the shutoff of SL RNA transcription, followed by induction of programmed cell death. Here, we demonstrate that SLS is also induced by depletion of the essential ER-resident chaperones BiP and calreticulin, ER oxidoreductin 1 (ERO1), and the Golgi complex-localized quiescin sulfhydryl oxidase (QSOX). Most strikingly, silencing of Rhomboid-like 1 (TIMRHOM1), involved in mitochondrial protein import, also induces SLS. The PK3 kinase, which integrates SLS signals, is modified by phosphorylation on multiple sites. To determine which of the phosphorylation events activate PK3, several individual mutations or their combination were generated. These mutations failed to completely eliminate the phosphorylation or translocation of the kinase to the nucleus. The structures of PK3 kinase and its ATP binding domain were therefore modeled. A conserved phenylalanine at position 771 was proposed to interact with ATP, and the PK3 F771L mutation completely eliminated phosphorylation under SLS, suggesting that the activation involves most if not all of the phosphorylation sites. The study suggests that the SLS occurs broadly in response to failures in protein sorting, folding, or modification across multiple compartments. IMPORTANCE In this study, we found that SLS is induced by depletion of the essential ER-resident chaperones BiP and calreticulin, ER oxidoreductin 1 (ERO1), and the Golgi complex-localized quiescin sulfhydryl oxidase (QSOX). Most strikingly, silencing of Rhomboid-like 1 (TIMRHOM1), involved in mitochondrial protein import, also induces SLS. We also report on the autophosphorylation of PK3 during SLS induction. This study has implications for our understanding of how trypanosomes keep the homeostasis between the ER and the mitochondria and suggests that PK3 may participate in the connection between these two organelles. The pathway, when induced, leads to the suicide of these parasites, and its induction offers a potential novel drug target against these parasites.

Background: Spliced leader (SL) trans-splicing replaces the 5' end of pre-mRNAs with the spliced leader, an exon derived from a specialised non-coding RNA originating from elsewhere in the genome. This process is essential for resolving polycistronic pre-mRNAs produced by eukaryotic operons into monocistronic transcripts. SL trans-splicing and operons may have independently evolved multiple times throughout Eukarya, yet our understanding of these phenomena is limited to only a few well-characterised organisms, most notably C. elegans and trypanosomes. The primary barrier to systematic discovery and characterisation of SL trans-splicing and operons is the lack of computational tools for exploiting the surge of transcriptomic and genomic resources for a wide range of eukaryotes., Results: Here we present two novel pipelines that automate the discovery of SLs and the prediction of operons in eukaryotic genomes from RNA-Seq data. SLIDR assembles putative SLs from 5' read tails present after read alignment to a reference genome or transcriptome, which are then verified by interrogating corresponding SL RNA genes for sequence motifs expected in bona fide SL RNA molecules. SLOPPR identifies RNA-Seq reads that contain a given 5' SL sequence, quantifies genome-wide SL trans-splicing events and predicts operons via distinct patterns of SL trans-splicing events across adjacent genes. We tested both pipelines with organisms known to carry out SL trans-splicing and organise their genes into operons, and demonstrate that (1) SLIDR correctly detects expected SLs and often discovers novel SL variants; (2) SLOPPR correctly identifies functionally specialised SLs, correctly predicts known operons and detects plausible novel operons., Conclusions: SLIDR and SLOPPR are flexible tools that will accelerate research into the evolutionary dynamics of SL trans-splicing and operons throughout Eukarya and improve gene discovery and annotation for a wide range of eukaryotic genomes. Both pipelines are implemented in Bash and R and are built upon readily available software commonly installed on most bioinformatics servers. Biological insight can be gleaned even from sparse, low-coverage datasets, implying that an untapped wealth of information can be retrieved from existing RNA-Seq datasets as well as from novel full-isoform sequencing protocols as they become more widely available.

Spliced leader trans -splicing is essential for the processing and translation of polycistronic RNAs generated by eukaryotic operons. In C. elegans , a specialized spliced leader, SL2, provides the 5' end for uncapped pre-mRNAs derived from polycistronic RNAs. Studies of other nematodes suggested that SL2-type trans -splicing is a relatively recent innovation, confined to Rhabditina, the clade containing C. elegans and its close relatives. Here we conduct a survey of transcriptome-wide spliced leader trans -splicing in Trichinella spiralis , a distant relative of C. elegans with a particularly diverse repertoire of 15 spliced leaders. By systematically comparing the genomic context of trans -splicing events for each spliced leader, we identified a subset of T. spiralis spliced leaders that are specifically used to process polycistronic RNAs-the first examples of SL2-type spliced leaders outside of Rhabditina. These T. spiralis spliced leader RNAs possess a perfectly conserved stem-loop motif previously shown to be essential for SL2-type trans -splicing in C. elegans We show that genes trans -spliced to these SL2-type spliced leaders are organized in operonic fashion, with short intercistronic distances. A subset of T. spiralis operons show conservation of synteny with C. elegans operons. Our work substantially revises our understanding of nematode spliced leader trans -splicing, showing that SL2 trans -splicing is a major mechanism for nematode polycistronic RNA processing, which may have evolved prior to the radiation of the Nematoda. This work has important implications for the improvement of genome annotation pipelines in nematodes and other eukaryotes with operonic gene organization., (© 2020 Wenzel et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.)

Background: In eco-epidemiological studies, Leishmania detection in vectors and reservoirs is frequently accomplished by high-throughput and sensitive molecular methods that target minicircle kinetoplast DNA (kDNA). A pan-Leishmania SYBR green quantitative PCR (qPCR) assay which detects the conserved spliced-leader RNA (SL RNA) sequence was developed recently. This study assessed the SL RNA assay performance combined with a crude extraction method for the detection of Leishmania in field-collected and laboratory-reared sand flies and in tissue samples from hyraxes as reservoir hosts., Methods: Field-collected and laboratory-infected sand fly and hyrax extracts were subjected to three different qPCR approaches to assess the suitability of the SL RNA target for Leishmania detection. Nucleic acids of experimentally infected sand flies were isolated with a crude extraction buffer with ethanol precipitation and a commercial kit and tested for downstream DNA and RNA detection. Promastigotes were isolated from culture and sand fly midguts to assess whether there was difference in SL RNA and kDNA copy numbers. Naive sand flies were spiked with a serial dilution of promastigotes to make a standard curve., Results: The qPCR targeting SL RNA performed well on infected sand fly samples, despite preservation and extraction under presumed unfavorable conditions for downstream RNA detection. Nucleic acid extraction by a crude extraction buffer combined with a precipitation step was highly compatible with downstream SL RNA and kDNA detection. Copy numbers of kDNA were found to be identical in culture-derived parasites and promastigotes isolated from sand fly midguts. SL RNA levels were slightly lower in sand fly promastigotes (ΔCq 1.7). The theoretical limit of detection and quantification of the SL RNA qPCR respectively reached down to 10 -3 and 10 parasite equivalents. SL RNA detection in stored hyrax samples was less efficient with some false-negative assay results, most likely due to the long-term tissue storage in absence of RNA stabilizing reagents., Conclusions: This study shows that a crude extraction method in combination with the SL RNA qPCR assay is suitable for the detection and quantification of Leishmania in sand flies. The assay is inexpensive, sensitive and pan-Leishmania specific, and accordingly an excellent assay for high-throughput screening in entomological research.

Infections with parasitic nematodes are among the most significant of the neglected tropical diseases affecting about a billion people living mainly in tropical regions with low economic activity. The most effective current strategy to control nematode infections involves large scale treatment programs with anthelmintic drugs. This strategy is at risk from the emergence of drug resistant parasites. Parasitic nematodes also affect livestock, which are treated with the same limited group of anthelmintic drugs. Livestock parasites resistant to single drugs, and even multi-drug resistant parasites, are appearing in many areas. There is therefore a pressing need for new anthelmintic drugs. Here we use the nematode Caenorhabditis elegans as a model for parasitic nematodes and demonstrate that sinefungin, a competitive inhibitor of methyltransferases, causes a delay in development and reduced fecundity, and inhibits spliced leader trans-splicing. Spliced leader trans-splicing is an essential step in gene expression that does not occur in the hosts of parasitic nematodes, and is therefore a potential target for new anthelmintic drugs. We have exploited the ability of sinefungin to inhibit spliced leader trans-splicing to adapt a green fluorescent protein based reporter gene assay that monitors spliced leader trans-splicing for high-throughput screening for new anthelmintic compounds. We have established a protocol for robust high-throughput screening, combining mechanical dispensing of living C. elegans into 384- or 1536- well plates with addition of compounds using an acoustic liquid dispenser, and the detection of the inhibition of SL trans-splicing using a microplate reader. We have tested this protocol in a first pilot screen and envisage that this assay will be a valuable tool in the search for new anthelmintic drugs., (Copyright © 2019 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Spliced leader trans-splicing (SLTS) plays a part in the maturation of pre-mRNAs in select species across multiple phyla but is particularly prevalent in Nematoda. The role of spliced leaders (SL) within the cell is unclear and an accurate assessment of SL occurrence within an organism is possible only after extensive sequencing data are available, which is not currently the case for many nematode species. SL discovery is further complicated by an absence of SL sequences from high-throughput sequencing results due to incomplete sequencing of the 5'-ends of transcripts during RNA-seq library preparation, known as 5'-bias. Existing datasets and novel methodology were used to identify both conserved SLs and unique hypervariable SLs within Heterodera glycines, the soybean cyst nematode. In H. glycines, twenty-one distinct SL sequences were found on 2,532 unique H. glycines transcripts. The SL sequences identified on the H. glycines transcripts demonstrated a high level of promiscuity, meaning that some transcripts produced as many as nine different individual SL-transcript combinations. Most uniquely, transcriptome analysis revealed that H. glycines is the first nematode to demonstrate a higher SL trans-splicing rate using a species-specific SL over well-conserved Caenorhabditis elegans SL-like sequences.

We analyzed the compositional changes and the stable base pairs in the predicted secondary structure of the 5' UTR calmodulin mRNA in T. cruzi. The three copies of calmodulin in T. cruzi genome display variable position of the trans splicing sites and give rise to several mRNA that differs slightly on 5' UTR composition in the epimastigote stage. We show that the pattern of high probability base pairs in the minimum free energy predicted secondary structures of the calmodulin 5' UTR remains unchanged despite the nucleotide composition variation. However, the 39 nt spliced leader (mini-exon, the 5' exon sequence transferred to trypanosome mRNAs by the mechanism of trans splicing) shows a variable pattern of high and low probability base pairing as consequence of the altered composition of the 5' UTR.

Paulinella micropora is a rhizarian thecate amoeba, belonging to a photosynthetic Paulinella species group that has a unique organelle termed chromatophore, whose cyanobacterial origin is distinct from that of plant and algal chloroplasts. Because acquisition of the chromatophore was quite a recent event compared with that of the chloroplast ancestor, the Paulinella species are thought to be model organisms for studying the early process of primary endosymbiosis. To obtain insight into how endosymbiotically transferred genes acquire expression competence in the host nucleus, here we analyzed the 5' end sequences of the mRNAs of P. micropora MYN1 strain with the aid of a cap-trapper cDNA library. As a result, we found that mRNAs of 27 genes, including endosymbiotically transferred genes, possessed the common 5' end sequence of 28-33 bases that were posttranscriptionally added by spliced leader (SL) trans-splicing. We also found two subtypes of SL RNA genes encoded by the P. micropora MYN1 genome. Differing from the other SL trans-splicing organisms that usually possess poly(A)-less SL RNAs, this amoeba has polyadenylated SL RNAs. In this study, we characterize the SL trans-splicing of this unique organism and discuss the putative merits of SL trans-splicing in functional gene transfer and genome evolution., Competing Interests: The authors have declared that no competing interests exist.

Spliced leader dependent trans-splicing (SLTS) has been described as an important RNA regulatory process that occurs in different organisms, including the trematode Schistosoma mansoni. We identified more than seven thousand putative SLTS sites in the parasite, comprising genes with a wide spectrum of functional classes, which underlines the SLTS as a ubiquitous mechanism in the parasite. Also, SLTS gene expression levels span several orders of magnitude, showing that SLTS frequency is not determined by the expression level of the target gene, but by the presence of particular gene features facilitating or hindering the trans-splicing mechanism. Our in-depth investigation of SLTS events demonstrates widespread alternative trans-splicing (ATS) acceptor sites occurring in different regions along the entire gene body, highlighting another important role of SLTS generating alternative RNA isoforms in the parasite, besides the polycistron resolution. Particularly for introns where SLTS directly competes for the same acceptor substrate with cis-splicing, we identified for the first time additional and important features that might determine the type of splicing. Our study substantially extends the current knowledge of RNA processing by SLTS in S. mansoni, and provide basis for future studies on the trans-splicing mechanism in other eukaryotes.

Trypanosomes are protistan parasites that diverged early in evolution from most eukaryotes. Their streamlined genomes are packed with arrays of tandemly linked genes that are transcribed polycistronically by RNA polymerase (pol) II. Individual mRNAs are processed from pre-mRNA by spliced leader (SL) trans splicing and polyadenylation. While there is no strong evidence that general transcription factors are needed for transcription initiation at these gene arrays, a RNA pol II transcription pre-initiation complex (PIC) is formed on promoters of SLRNA genes, which encode the small nuclear SL RNA, the SL donor in trans splicing. The factors that form the PIC are extremely divergent orthologues of the small nuclear RNA-activating complex, TBP, TFIIA, TFIIB, TFIIH, TFIIE and Mediator. Here, we functionally characterized a heterodimeric complex of unannotated, nuclear proteins that interacts with RNA pol II and is essential for PIC formation, SL RNA synthesis in vivo, SLRNA transcription in vitro, and parasite viability. These functional attributes suggest that the factor represents TFIIF although the amino acid sequences are too divergent to firmly make this conclusion. This work strongly indicates that early-diverged trypanosomes have orthologues of each and every general transcription factor, requiring them for the synthesis of SL RNA.

Spliced leader (SL) trans-splicing is a critical element of gene expression in a number of eukaryotic groups. This process is arguably best understood in nematodes, where biochemical and molecular studies in Caenorhabditis elegans and Ascaris suum have identified key steps and factors involved. Despite this, the precise details of SL trans-splicing have yet to be elucidated. In part, this is because the systematic identification of the molecules involved has not previously been possible due to the lack of a specific phenotype associated with defects in this process. We present here a novel GFP-based reporter assay that can monitor SL1 trans-splicing in living C. elegans. Using this assay, we have identified mutants in sna-1 that are defective in SL trans-splicing, and demonstrate that reducing function of SNA-1, SNA-2 and SUT-1, proteins that associate with SL1 RNA and related SmY RNAs, impairs SL trans-splicing. We further demonstrate that the Sm proteins and pICln, SMN and Gemin5, which are involved in small nuclear ribonucleoprotein assembly, have an important role in SL trans-splicing. Taken together these results provide the first in vivo evidence for proteins involved in SL trans-splicing, and indicate that continuous replacement of SL ribonucleoproteins consumed during trans-splicing reactions is essential for effective trans-splicing., (© The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Trans-splicing is a process by which 5'- and 3'-ends of two pre-RNA molecules transcribed from different sites of the genome can be joined together to form a single RNA molecule. The spliced leader (SL) trans-splicing is mediated by the spliceosome and it allows the replacement of 5'-end of pre-mRNA by 5'(SL)-end of SL-RNA. This form of splicing has been observed in many phylogenetically unrelated eukaryotes. Either the SL trans-splicing (SLTS) originated in the last eukaryotic common ancestor (LECA) (or even earlier) and it was lost in most eukaryotic lineages, or this mechanism of RNA processing evolved several times independently in various unrelated eukaryotic taxa. The bioinformatic comparisons of SL-RNAs from various eukaryotic taxonomic groups have revealed the similarities of secondary structures of most SL-RNAs and a relative conservation of their splice sites (SSs) and Sm-binding sites (SmBSs). We propose that such structural and functional similarities of SL-RNAs are unlikely to have evolved repeatedly many times. Hence, we favor the scenario of an early evolutionary origin for the SLTS and multiple losses of SL-RNAs in various eukaryotic lineages.

RNA recognition motif (RRM) containing proteins are important regulators of gene expression in trypanosomes. Here we expand our current knowledge on the exclusively nuclear localized RRM domain containing protein RBP33 of Trypanosoma brucei. Overexpression of RBP33 leads to a quick growth arrest in G2/M in bloodstream form cells likely due to an overall mRNA- and spliced leader abundance decrease while the ribosomal RNAs remain unaffected. The recombinant RBP33 binds to poly(A) and random sequence RNA in vitro confirming its role as a RNA binding protein. Finally super-resolution microscopy detects RBP33 in small punctae throughout the nucleus and surrounding the nucleolus, however the signal is depleted inside the nucleolus., (Copyright © 2017 Elsevier B.V. All rights reserved.)

Spliced leader trans-splicing (SLTS) is a poorly understood mechanism that is found in a diversity of eukaryotic lineages. In SLTS, a short RNA sequence is added near the 5' ends of the transcripts of protein-coding genes by a modified spliceosomal reaction. Available data suggest that SLTS has evolved many times, and might be more likely to evolve in animals. That SLTS might be more likely to evolve in the context of the generally complex transcriptomes characteristic of animals suggests the possibility that SLTS functions in gene regulation or transcriptome diversification, however no general novel function for SLTS is known. Here, I report SLTS in a lineage of cellularly complex unicellular eukaryotes. Cryptomonads are a group of eukaryotic algae that acquired photosynthetic capacity by secondary endosymbiosis of a red alga, and that retain a reduced copy of the nucleus of the engulfed alga. I estimate that at least one-fifth of genes in the model cryptomonad Guillardia theta and its relative Hanusia phi undergo SLTS. I show that hundreds of genes in G. theta generate alternative transcripts by SLTS at alternative sites, however I find little evidence for alternative protein production by alternative SLTS splicing. Interestingly, I find no evidence for substantial operon structure in the G. theta genome, in contrast to previous findings in other lineages with SLTS. These results extend SLTS to another major group of eukaryotes, and heighten the mystery of the evolution of SLTS and its association with cellular and transcriptomic complexity., (© The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.)

The form of RNA processing known as SL trans-splicing involves the transfer of a short conserved sequence, the spliced leader (SL), from a noncoding SL RNA to the 5' ends of mRNA molecules. SL trans-splicing occurs in several animal taxa, including bdelloid rotifers (Rotifera, Bdelloidea). One striking feature of these aquatic microinvertebrates is the large proportion of foreign genes, i.e. those acquired by horizontal gene transfer from other organisms, in their genomes. However, whether such foreign genes behave similarly to native genes has not been tested in bdelloids or any other animal. We therefore used a combination of experimental and computational methods to examine whether transcripts of foreign genes in bdelloids were SL trans-spliced, like their native counterparts. We found that many foreign transcripts contain SLs, use similar splice acceptor sequences to native genes, and are able to undergo alternative trans-splicing. However, a significantly lower proportion of foreign mRNAs contains SL sequences than native transcripts. This demonstrates a novel functional difference between foreign and native genes in bdelloids and suggests that SL trans-splicing is not essential for the expression of foreign genes, but is acquired during their domestication., (Copyright © 2016 Elsevier B.V. All rights reserved.)

RNA splicing is a critical step in the human immunodeficiency virus type 1 (HIV-1) replication cycle because it controls the expression of the complex viral proteome. The major 5' splice site (5'ss) that is positioned in the untranslated leader of the HIV-1 RNA transcript is of particular interest because it is used for the production of the more than 40 differentially spliced subgenomic mRNAs. HIV-1 splicing needs to be balanced tightly to ensure the proper levels of all viral proteins, including the Gag-Pol proteins that are translated from the unspliced RNA. We previously presented evidence that the major 5'ss is regulated by a repressive local RNA structure, the splice donor (SD) hairpin, that masks the 11 nucleotides (nts) of the 5'ss signal for recognition by U1 small nuclear RNA (snRNA) of the spliceosome machinery. A strikingly different multiple-hairpin RNA conformation was recently proposed for this part of the HIV-1 leader RNA. We therefore inspected the sequence of natural HIV-1 isolates in search for support, in the form of base pair (bp) co-variations, for the different RNA conformations.

In eukaryotes, cyclin-dependent kinases (CDKs) control the cell cycle and critical steps in gene expression. The lethal parasite Trypanosoma brucei, member of the phylogenetic order Kinetoplastida, possesses eleven CDKs which, due to high sequence divergence, were generically termed CDC2-related kinases (CRKs). While several CRKs have been implied in the cell cycle, CRK9 was the first trypanosome CDK shown to control the unusual mode of gene expression found in kinetoplastids. In these organisms, protein-coding genes are arranged in tandem arrays which are transcribed polycistronically. Individual mRNAs are processed from precursor RNA by spliced leader (SL) trans splicing and polyadenylation. CRK9 ablation was lethal in cultured trypanosomes, causing a block of trans splicing before the first transesterification step. Additionally, CRK9 silencing led to dephosphorylation of RNA polymerase II and to hypomethylation of the SL cap structure. Here, we tandem affinity-purified CRK9 and, among potential CRK9 substrates and modifying enzymes, discovered an unusual tripartite complex comprising CRK9, a new L-type cyclin (CYC12) and a protein, termed CRK9-associated protein (CRK9AP), that is only conserved among kinetoplastids. Silencing of either CYC12 or CRK9AP reproduced the effects of depleting CRK9, identifying these proteins as functional partners of CRK9 in vivo. While mammalian cyclin L binds to CDK11, the CRK9 complex deviates substantially from that of CDK11, requiring CRK9AP for efficient CRK9 complex formation and autophosphorylation in vitro. Interference with this unusual CDK rescued mice from lethal trypanosome infections, validating CRK9 as a potential chemotherapeutic target.

To assess the efficacy of treatment for human African trypanosomiasis, accurate tests that can discriminate relapse from cure are needed. We report the first data that the spliced leader (SL) RNA is a more specific marker for cure of human African trypanosomiasis than parasite DNA. In blood samples obtained from 61 patients in whom human African trypanosomiasis was cured, SL RNA detection had specificities of 98.4%-100%, while DNA detection had a specificity of only 77%. Data from our proof-of-concept study show that SL RNA detection has high potential as a test of cure., (© The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.)

Since the initial publication of the trypanosomatid genomes, curation has been ongoing. Here we make use of existing Trypanosoma brucei ribosome profiling data to provide evidence of ribosome occupancy (and likely translation) of mRNAs from 225 currently unannotated coding sequences (CDSs). A small number of these putative genes correspond to extra copies of previously annotated genes, but 85% are novel. The median size of these novels CDSs is small (81 aa), indicating that past annotation work has excelled at detecting large CDSs. Of the unique CDSs confirmed here, over half have candidate orthologues in other trypanosomatid genomes, most of which were not yet annotated as protein-coding genes. Nonetheless, approximately one-third of the new CDSs were found only in T. brucei subspecies. Using ribosome footprints, RNA-Seq and spliced leader mapping data, we updated previous work to definitively revise the start sites for 414 CDSs as compared to the current gene models. The data pointed to several regions of the genome that had sequence errors that altered coding region boundaries. Finally, we consolidated this data with our previous work to propose elimination of 683 putative genes as protein-coding and arrive at a view of the translatome of slender bloodstream and procyclic culture form T. brucei., (Copyright © 2015 Elsevier B.V. All rights reserved.)

Background: Most microbial eukaryotes are uncultivated and thus poorly suited to standard genomic techniques. This is the case for Polykrikos lebouriae, a dinoflagellate with ultrastructurally aberrant plastids. It has been suggested that these plastids stem from a novel symbiosis with either a diatom or haptophyte, but this hypothesis has been difficult to test as P. lebouriae dwells in marine sand rife with potential genetic contaminants., Results: We applied spliced-leader targeted PCR (SLPCR) to obtain dinoflagellate-specific transcriptomes on single-cell isolates of P. lebouriae from marine sediments. Polykrikos lebouriae expressed nuclear-encoded photosynthetic genes that were characteristic of the peridinin-plastids of dinoflagellates, rather than those from a diatom of haptophyte. We confirmed these findings at the genomic level using multiple displacement amplification (MDA) to obtain a partial plastome of P. lebouriae., Conclusion: From these data, we infer that P. lebouriae has retained the peridinin plastids ancestral for dinoflagellates as a whole, while its closest relatives have lost photosynthesis multiple times independently. We discuss these losses with reference to mixotrophy in polykrikoid dinoflagellates. Our findings demonstrate new levels of variation associated with the peridinin plastids of dinoflagellates and the usefulness of SLPCR approaches on single cell isolates. Unlike other transcriptomic methods, SLPCR has taxonomic specificity, and can in principle be adapted to different splice-leader bearing groups.

The Kinetoplastida are a diverse and globally distributed class of free-living and parasitic single-celled eukaryotes that collectively cause a significant burden on human health and welfare. In kinetoplastids individual genes do not have promoters, but rather all genes are arranged downstream of a small number of RNA polymerase II transcription initiation sites and are thus transcribed in polycistronic gene clusters. Production of individual mRNAs from this continuous transcript occurs co-transcriptionally by trans-splicing of a ∼39 nucleotide capped RNA and subsequent polyadenylation of the upstream mRNA. SLaP mapper (Spliced-Leader and Polyadenylation mapper) is a fully automated web-service for identification, quantitation and gene-assignment of both spliced-leader and polyadenylation addition sites in Kinetoplastid genomes. SLaP mapper only requires raw read data from paired-end Illumina RNAseq and performs all read processing, mapping, quality control, quantification, and analysis in a fully automated pipeline. To provide usage examples and estimates of the quantity of sequence data required we use RNAseq obtained from two different library preparations from both Trypanosoma brucei and Leishmania mexicana to show the number of expected reads that are obtained from each preparation type. SLaP mapper is an easy to use, platform independent webserver that is freely available for use at http://www.stevekellylab.com/software/slap. Example files are provided on the website., (Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.)

Trypanosomatids transcribe their genes in large polycistronic clusters that are further processed into mature mRNA molecules by trans-splicing. During this maturation process, a conserved spliced leader RNA (SL-RNA) sequence of 39 bp is physically linked to the 5' end of the pre-mRNA molecules. Trypanosomatid infections cause a series of devastating diseases in man (sleeping sickness, leishmaniasis, Chagas disease) and animals (nagana, surra, dourine). Here, we investigated the SL-RNA molecule for its diagnostic potential using reverse transcription followed by real-time PCR. As a model, we used Trypanosoma brucei gambiense, which causes sleeping sickness in west and central Africa. We showed that the copy number of the SL-RNA molecule in one single parasitic cell is at least 8600. We observed a lower detection limit of the SL-RNA assay in spiked blood samples of 100 trypanosomes per milliliter of blood. We also proved that we can detect the trypanosome's SL-RNA in the blood of sleeping sickness patients with a sensitivity of 92% (95% CI, 78%-97%) and a specificity of 96% (95% CI, 86%-99%). The SL-RNA is thus an attractive new molecular target for next-generation diagnostics in diseases caused by trypanosomatids., (Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.)

A single polymerase chain reaction (PCR) reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM) strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

Schistosomiasis is a major neglected tropical disease caused by trematodes from the genus Schistosoma. Because schistosomes exhibit a complex life cycle and numerous mechanisms for regulating gene expression, it is believed that spliced leader (SL) trans-splicing could play an important role in the biology of these parasites. The purpose of this study was to investigate the function of trans-splicing in Schistosoma mansoni through analysis of genes that may be regulated by this mechanism and via silencing SL-containing transcripts through RNA interference. Here, we report our analysis of SL transcript-enriched cDNA libraries from different S. mansoni life stages. Our results show that the trans-splicing mechanism is apparently not associated with specific genes, subcellular localisations or life stages. In cross-species comparisons, even though the sets of genes that are subject to SL trans-splicing regulation appear to differ between organisms, several commonly shared orthologues were observed. Knockdown of trans-spliced transcripts in sporocysts resulted in a systemic reduction of the expression levels of all tested trans-spliced transcripts; however, the only phenotypic effect observed was diminished larval size. Further studies involving the findings from this work will provide new insights into the role of trans-splicing in the biology of S. mansoni and other organisms. All Expressed Sequence Tags generated in this study were submitted to dbEST as five different libraries. The accessions for each library and for the individual sequences are as follows: (i) adult worms of mixed sexes (LIBEST_027999: JZ139310 - JZ139779), (ii) female adult worms (LIBEST_028000: JZ139780 - JZ140379), (iii) male adult worms (LIBEST_028001: JZ140380 - JZ141002), (iv) eggs (LIBEST_028002: JZ141003 - JZ141497) and (v) schistosomula (LIBEST_028003: JZ141498 - JZ141974).

The ability to analyze dinoflagellate lineage-specific transcriptomes in the natural environment would be powerful for gaining understanding on how these organisms thrive in diverse environments and how they form harmful algal blooms and produce biotoxins. This can be made possible by lineage-specific mRNA markers such as the dinoflagellate-specific trans-spliced leader (DinoSL). By constructing and sequencing a 5'-cap selective full-length cDNA library for a monoculture of the coral reef endosymbiotic dinoflagellate Symbiodinium kawagutii and a DinoSL-based cDNA library for a mixture of S. kawagutii and other phytoplankton, we found DinoSL in essentially all full-length cDNAs in the 5'-cap selective library. We also discovered that the DinoSL-based library contained functionally diverse transcripts all belonging to dinoflagellates with no evidence of biases toward certain groups of functional genes. The results verified that DinoSL is specific to dinoflagellate mRNAs and is ubiquitous in the dinoflagellate transcriptomes. Annotation of the unigene dataset generated from the two libraries combined indicated high functional diversity of the transcriptome and revealed some biochemical pathways previously undocumented in Symbiodinium such as an mRNA splicing machinery potentially serving both cis- and trans-splicing. The protocol will be useful for transcriptomic studies of Symbiodinium in hospite and other dinoflagellates in natural environments., (Copyright © 2013 Elsevier GmbH. All rights reserved.)

Affinity purification of RNA using the ARiBo tag technology currently provides an ideal approach to quickly prepare RNA with 3' homogeneity. Here, we explored strategies to also ensure 5' homogeneity of affinity-purified RNAs. First, we systematically investigated the effect of starting nucleotides on the 5' heterogeneity of a small SLI RNA substrate from the Neurospora VS ribozyme purified from an SLI-ARiBo precursor. A series of 32 SLI RNA sequences with variations in the +1 to +3 region was produced from two T7 promoters (class III consensus and class II 2.5) using either the wild-type T7 RNA polymerase or the P266L mutant. Although the P266L mutant helps decrease the levels of 5'-sequence heterogeneity in several cases, significant levels of 5' heterogeneity (≥1.5%) remain for transcripts starting with GGG, GAG, GCG, GGC, AGG, AGA, AAA, ACA, AUA, AAC, ACC, AUC, and AAU. To provide a more general approach to purifying RNA with 5' homogeneity, we tested the suitability of using a small CRISPR RNA stem-loop at the 5' end of the SLI-ARiBo RNA. Interestingly, we found that complete cleavage of the 5'-CRISPR tag with the Cse3 endoribonuclease can be achieved quickly from CRISPR-SLI-ARiBo transcripts. With this procedure, it is possible to generate SLI-ARiBo RNAs starting with any of the four standard nucleotides (G, C, A, or U) involved in either a single- or a double-stranded structure. Moreover, the 5'-CRISPR-based strategy can be combined with affinity purification using the 3'-ARiBo tag for quick purification of RNA with both 5' and 3' homogeneity.

The highly conserved nucleocapsid protein domain in HIV-1 recognizes and binds SL3 in genomic RNA. In this work, we used the structure of the NCp7-SL3 RNA complex to guide the construction of 16 NCp7 mutants to probe the RNA binding surface of the protein [De Guzman, R. N., et al. (1998) Science 279, 384-388]. Thirteen residues with functional or structural significance were mutated individually to Ala (Asn(5), Phe(6), Val(13), Phe(16), Asn(17), Gly(19), Glu(21), Ile(24), Gln(45), Met(46), Gly(22), Pro(31), and Gly(40)), and three salt bridge switch mutants exchanged Lys and Glu (Lys(14)-Glu(21), Lys(33)-Glu(42), and Lys(38)-Glu(51)). Dissociation constants (Kd) determined by fluorescence titration and isothermal titration calorimetry were used to compare affinities of SL3 for the variant proteins to that for the wild type. The F16A (Phe(16) to Ala) variant showed a 25-fold reduction in affinity, consistent with a loss of organized structure in f1, the protein's first zinc finger. I24A, Q45A, and M46A reduced affinity by 2-5-fold; these residues occupy nearly equivalent positions in f1 and f2. E21A increased affinity by 3-fold, perhaps because of the mutant's increased net positive charge. Among the salt bridge switch mutants, only K14E/E21K in f1 caused a substantial change in affinity (5-fold reduction), binding SL3 with a biphasic binding isotherm. Aside from these six variants, most of the mutations studied have relatively minor effects on the stability of the complex. We conclude that many side chain interactions in the wild-type complex contribute little to stability or can be compensated by new contacts in the mutants.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

The addition of a capped mini-exon [spliced leader (SL)] through trans-splicing is essential for the maturation of RNA polymerase (pol) II-transcribed polycistronic pre-mRNAs in all members of the Trypanosomatidae family. This process is an inter-molecular splicing reaction that follows the same basic rules of cis-splicing reactions. In this study, we demonstrated that mini-exons were added to precursor ribosomal RNA (pre-rRNA) are transcribed by RNA pol I, including the 5' external transcribed spacer (ETS) region. Additionally, we detected the SL-5'ETS molecule using three distinct methods and located the acceptor site between two known 5'ETS rRNA processing sites (A' and A1) in four different trypanosomatids. Moreover, we detected a polyadenylated 5'ETS upstream of the trans-splicing acceptor site, which also occurs in pre-mRNA trans-splicing. After treatment with an indirect trans-splicing inhibitor (sinefungin), we observed SL-5'ETS decay. However, treatment with 5-fluorouracil (a precursor of RNA synthesis that inhibits the degradation of pre-rRNA) led to the accumulation of SL-5'ETS, suggesting that the molecule may play a role in rRNA degradation. The detection of trans-splicing in these molecules may indicate broad RNA-joining properties, regardless of the polymerase used for transcription.

Potato virus X (PVX) contains five viral proteins as well as cis-acting elements like stem-loop 1 (SL1) RNAs at the 5' region. SL1 RNAs are involved in PVX RNA replication, encapsidation, translation, and cell-to-cell movement. In this study, we performed two-dimensional electrophoresis Northwestern blot analysis and matrix-assisted laser desorption ionization time of flight mass spectrometry and identified 24 tobacco proteins that interact with SL1 RNAs. Interestingly, one-third of the identified host proteins have been shown to interact with many plant viral proteins. In addition, we demonstrated that PVX capsid protein can bind to both SL1(+/-) RNAs. We further selected three Nicotiana benthamiana proteins including NbMPB2Cb, NbMBF1, and NbCPIP2a, to confirm results of Northwestern blot analysis. Electrophoretic mobility shift assay showed that NbMPB2Cb and NbMBF1 bind to both SL1(+/-) RNAs in vitro. In contrast, NbCPIP2a interacts only SL1(+) RNA. Taken together, we provide a list of host proteins interacting with PVX SL1 RNAs, which would be good candidates for the study of viral RNA-host protein interaction.

The HIV-1 5' untranslated region (UTR) contains conserved sequences and unique structural motifs associated with many steps in virus replication. Because unspliced HIV mRNA containing the full-length UTR serves as a template for replication and transcription as well as packaging genomic RNA into virion, it has been postulated that the UTR may play a role in translational regulation. However, the effect and the region(s) responsible for translation control remain controversial. We used deletion mutations of the 5' UTR region in both cell-based and in vitro assays to determine if secondary structural elements within the 5' UTR confer translation inhibition, and to identify which of these elements are involved. The results indicate clearly that the entire HIV-1 5' UTR confers translation inhibition in vitro and in cells; the Psi (Ψ) region specifically has the most translation inhibitory activity among the highly-structured elements in the HIV-1 5' UTR. Moreover, it was found that the SL4 structure in the Psi (Ψ) region is the major determinant of translation inhibition, and that elimination of the SL4 RNA sequence led to increased translation. The results suggest a functional role for the Psi element and the SL4 structure in the translational control of HIV-1 full-length mRNA., (Copyright © 2011 Elsevier Inc. All rights reserved.)

A new trypanosomatid species, Blastocrithidia cyrtomeni, is herein described using morphological and molecular data. It was found parasitising the alimentary tract of the insect host Cyrtomenus bergi, a polyphagous pest. The morphology of B. cyrtomeni was investigated using light and transmission microscopy and molecular phylogeny was inferred from the sequences of spliced leader RNA (SL rRNA) - 5S rRNA gene repeats and the 18S small subunit (SSU) rRNA gene. Epimastigotes of variable size with straphanger cysts adhering to the middle of the flagellum were observed in the intestinal tract, hemolymph and Malpighian tubules. Kinetoplasts were always observed anterior to the nucleus. The ultrastructure of longitudinal sections of epimastigotes showed the flagellum arising laterally from a relatively shallow flagellar pocket near the kinetoplast. SL RNA and 5S rRNA gene repeats were positive in all cases, producing a 0.8-kb band. The amplicons were 797-803 bp long with > 98.5% identity, indicating that they originated from the same organism. According to the sequence analysis of the SL-5S rRNA gene repeats and the 18S SSU rRNA gene, B. cyrtomeni is different from all other known species or isolates of Trypanosomatidae. Both analyses indicate that among known species, it is most closely related to Blastocrithidia triatomae.

Spliced leader (SL) variants are present in a number of mRNAs from Perkinsus marinus. Three different SLs of 22 nucleotides (nt) in length were previously reported, with a consensus sequence of (DCCGUAGCCAUYUUGGCUCAAG). A truncated 21 nt SL, with an (A) at nt-1 and a (U) deletion at nt-13, has also been reported. Here, we report an additional 21 nt SL variant with (G) at nt-1. Using cDNA analysis, a full-length SL RNA transcript was identified for both 21 nt SLs (SL2[A] and SL2[G]). This transcript is 81 nt in length and contains a conserved transcription termination sequence present in closely related dinoflagellates., (© 2011 The Author(s). Journal of Eukaryotic Microbiology© 2011 International Society of Protistologists.)

In trypanosomes, all RNAs are processed by the concerted action of trans-splicing and polyadenylation. In trans-splicing, a common spliced leader (SL) is donated to all mRNAs from a small RNA molecule, the SL RNA. This article summarizes recent findings in the field focusing on SL RNA transcription, cap modifications and pseudouridylation. The role(s) of these modifications for splicing and gene expression are discussed. The recruitment of SL RNA to the spliceosome depends on splicing factors and recent progress in identifying such factors is described. A recent major advance in understanding the role of trans-splicing in the trypanosome transcriptome was obtained by whole-genome mapping of the SL and polyadenylation sites, revealing surprising heterogeneity and suggesting that gene regulation, especially during cycling between the two hosts of the parasite, involves alternative trans-splicing. Finally, the SL silencing mechanism, which is harnessed by the parasite to control gene expression under stress, is discussed.

Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity., (Copyright © 2010 Elsevier B.V. All rights reserved.)

The genus Perkinsus occupies a precarious phylogenetic position. To gain a better understanding of the relationship between perkinsids, dinoflagellates and other alveolates, we analyzed the nuclear-encoded spliced-leader (SL) RNA and mitochondrial genes, intron prevalence, and multi-protein phylogenies. In contrast to the canonical 22-nt SL found in dinoflagellates (DinoSL), P. marinus has a shorter (21-nt) and a longer (22-nt) SL with slightly different sequences than DinoSL. The major SL RNA transcripts range in size between 80-83 nt in P. marinus, and ∼ 83 nt in P. chesapeaki, significantly larger than the typical ≤ 56-nt dinoflagellate SL RNA. In most of the phylogenetic trees based on 41 predicted protein sequences, P. marinus branched at the base of the dinoflagellate clade that included the ancient taxa Oxyrrhis and Amoebophrya, sister to the clade of apicomplexans, and in some cases clustered with apicomplexans as a sister to the dinoflagellate clade. Of 104 Perkinsus spp. genes examined 69.2% had introns, a higher intron prevalence than in dinoflagellates. Examination of Perkinsus spp. mitochondrial cytochrome B and cytochrome C oxidase subunit I genes and their cDNAs revealed no mRNA editing, but these transcripts can only be translated when frameshifts are introduced at every AGG and CCC codon as if AGGY codes for glycine and CCCCU for proline. These results, along with the presence of the numerous uncharacterized 'marine alveolate group I' and Perkinsus-like lineages separating perkinsids from core dinoflagellates, expand support for the affiliation of the genus Perkinsus with an independent lineage (Perkinsozoa) positioned between the phyla of Apicomplexa and Dinoflagellata.

Genome annotation suggested that early-diverged kinetoplastids possess a reduced set of basal transcription factors. More recent work, however, on the lethal parasite Trypanosoma brucei identified extremely divergent orthologs of TBP, TFIIA, TFIIB, and TFIIH which, together with the small nuclear RNA-activating protein complex, form a transcription preinitiation complex (PIC) at the spliced leader (SL) RNA gene (SLRNA) promoter. The SL RNA is a small nuclear RNA and a trans splicing substrate for the maturation of all pre-mRNAs which is metabolized continuously to sustain gene expression. Here, we identified and biochemically characterized a novel TFIIH-associated protein complex in T. brucei (Med-T) consisting of nine subunits whose amino acid sequences are conserved only among kinetoplastid organisms. Functional analyses in vivo and in vitro demonstrated that the complex is essential for cell viability, SLRNA transcription, and PIC integrity. Molecular structure analysis of purified Med-T and Med-T/TFIIH complexes by electron microscopy revealed that Med-T corresponds to the mediator head module of higher eukaryotes. These data therefore show that mediator is a basal factor for small nuclear SL RNA gene transcription in trypanosomes and that the basal transcription function of mediator head is a characteristic feature of eukaryotes which developed early in their evolution.

Environmental transcriptomics (metatranscriptomics) for a specific lineage of eukaryotic microbes (e.g., Dinoflagellata) would be instrumental for unraveling the genetic mechanisms by which these microbes respond to the natural environment, but it has not been exploited because of technical difficulties. Using the recently discovered dinoflagellate mRNA-specific spliced leader as a selective primer, we constructed cDNA libraries (e-cDNAs) from one marine and two freshwater plankton assemblages. Small-scale sequencing of the e-cDNAs revealed functionally diverse transcriptomes proven to be of dinoflagellate origin. A set of dinoflagellate common genes and transcripts of dominant dinoflagellate species were identified. Further analyses of the dataset prompted us to delve into the existing, largely unannotated dinoflagellate EST datasets (DinoEST). Consequently, all four nucleosome core histones, two histone modification proteins, and a nucleosome assembly protein were detected, clearly indicating the presence of nucleosome-like machinery long thought not to exist in dinoflagellates. The isolation of rhodopsin from taxonomically and ecotypically diverse dinoflagellates and its structural similarity and phylogenetic affinity to xanthorhodopsin suggest a common genetic potential in dinoflagellates to use solar energy nonphotosynthetically. Furthermore, we found 55 cytoplasmic ribosomal proteins (RPs) from the e-cDNAs and 24 more from DinoEST, showing that the dinoflagellate phylum possesses all 79 eukaryotic RPs. Our results suggest that a sophisticated eukaryotic molecular machine operates in dinoflagellates that likely encodes many more unsuspected physiological capabilities and, meanwhile, demonstrate that unique spliced leaders are useful for profiling lineage-specific microbial transcriptomes in situ.

Although several stage-specific genes have been identified in Leishmania, the molecular mechanisms governing developmental gene regulation in this organism are still not well understood. We have previously reported an attenuation of virulence in Leishmania major and L. braziliensis carrying extra-copies of the spliced leader RNA gene. Here, we surveyed the major differences in proteome and transcript expression profiles between the spliced leader RNA overexpressor and control lines using two-dimensional gel electrophoresis and differential display reverse transcription PCR, respectively. Thirty-nine genes related to stress response, cytoskeleton, proteolysis, cell cycle control and proliferation, energy generation, gene transcription, RNA processing and post-transcriptional regulation have abnormal patterns of expression in the spliced leader RNA overexpressor line. The evaluation of proteolytic pathways in the mutant revealed a selective increase of cysteine protease activity and an exacerbated ubiquitin-labeled protein population. Polysome profile analysis and measurement of cellular protein aggregates showed that protein translation in the spliced leader RNA overexpressor line is increased when compared to the control line. We found that L. major promastigotes maintain homeostasis in culture when challenged with a metabolic imbalance generated by spliced leader RNA surplus through modulation of intracellular proteolysis. However, this might interfere with a fine-tuned gene expression control necessary for the amastigote multiplication in the mammalian host., (Copyright 2010 Elsevier Ltd. All rights reserved.)

Trans-splicing of leader sequences onto the 5'ends of mRNAs is a widespread phenomenon in protozoa, nematodes and some chordates. Using parallel sequencing we have developed a method to simultaneously map 5'splice sites and analyze the corresponding gene expression profile, that we term spliced leader trapping (SLT). The method can be applied to any organism with a sequenced genome and trans-splicing of a conserved leader sequence. We analyzed the expression profiles and splicing patterns of bloodstream and insect forms of the parasite Trypanosoma brucei. We detected the 5' splice sites of 85% of the annotated protein-coding genes and, contrary to previous reports, found up to 40% of transcripts to be differentially expressed. Furthermore, we discovered more than 2500 alternative splicing events, many of which appear to be stage-regulated. Based on our findings we hypothesize that alternatively spliced transcripts present a new means of regulating gene expression and could potentially contribute to protein diversity in the parasite. The entire dataset can be accessed online at TriTrypDB or through: http://splicer.unibe.ch/.

Spliced leader trans-splicing occurs in many primitive eukaryotes including nematodes. Most of our knowledge of trans-splicing in nematodes stems from the model organism Caenorhabditis elegans and relatives, and from work with Ascaris. Our investigation of spliced leader trans-splicing in distantly related Dorylaimia nematodes indicates that spliced-leader trans-splicing arose before the nematode phylum and suggests that the spliced leader RNA gene complements in extant nematodes have evolved from a common ancestor with a diverse set of spliced leader RNA genes.

Spliced leader (SL) trans-splicing in Caenorhabditis elegans attaches a 22-nucleotide (nt) exon onto the 5' end of many mRNAs. A particular class of SL, SL2, splices mRNAs of downstream operon genes. Here we use an embryonic extract-based in vitro splicing system to show that SL2 specificity information is encoded within the polycistronic pre-mRNA, and that trans-splicing specificity is recapitulated in vitro. We define an RNA sequence required for SL2 trans-splicing, the U-rich (Ur) element, through mutational analysis and bioinformatics as a short stem-loop followed by a sequence motif, UAYYUU, located approximately 50 nt upstream of the trans-splice site. Furthermore, this element is predicted in intercistronic regions of numerous operons of C. elegans and other species that use SL2 trans-splicing. We propose that the UAYYUU motif hybridizes with the 5' splice site on the SL2 RNA to recruit the SL to the pre-mRNA. In this way, the UAYYUU motif in the pre-mRNA would serve an analogous function to the similar sequence in the U1 snRNA, which binds to the 5' splice site of introns, effectively reversing the roles of snRNP and pre-mRNA in trans-splicing.

Spliced-leader (SL) trans-splicing has been found in all molecularly characterized nematode species to date, and it is likely to be a nematode synapomorphy. Most information regarding SL trans-splicing has come from the study of nematodes from a single monophyletic group, the Rhabditida, all of which employ SL RNAs that are identical to, or variants of, the SL1 RNA first characterized in Caenorhabditis elegans. In contrast, the more distantly related Trichinella spiralis, belonging to the subclass Dorylaimia, utilizes a distinct set of SL RNAs that display considerable sequence diversity. To investigate whether this is true of other members of the Dorylaimia, we have characterized SL RNAs from Prionchulus punctatus. Surprisingly, this revealed the presence of a set of SLs that show clear sequence similarity to the SL2 family of spliced leaders, which have previously only been found within the rhabditine group (which includes C. elegans). Expression of one of the P. punctatus SL RNAs in C. elegans reveals that it can compete specifically with the endogenous C. elegans SL2 spliced leaders, being spliced to the pre-mRNAs derived from downstream genes in operons, but does not compete with the SL1 spliced leaders. This discovery raises the possibility that SL2-like spliced leaders were present in the last common ancestor of the nematode phylum.

Pre-mRNA 5' spliced-leader (SL) trans-splicing occurs in some metazoan groups but not in others. Genome-wide characterization of the trans-spliced mRNA subpopulation has not yet been reported for any metazoan. We carried out a high-throughput analysis of the SL trans-spliced mRNA population of the ascidian tunicate Ciona intestinalis by 454 Life Sciences (Roche) pyrosequencing of SL-PCR-amplified random-primed reverse transcripts of tailbud embryo RNA. We obtained approximately 250,000 high-quality reads corresponding to 8790 genes, approximately 58% of the Ciona total gene number. The great depth of this data revealed new aspects of trans-splicing, including the existence of a significant class of "infrequently trans-spliced" genes, accounting for approximately 28% of represented genes, that generate largely non-trans-spliced mRNAs, but also produce trans-spliced mRNAs, in part through alternative promoter use. Thus, the conventional qualitative dichotomy of trans-spliced versus non-trans-spliced genes should be supplanted by a more accurate quantitative view recognizing frequently and infrequently trans-spliced gene categories. Our data include reads representing approximately 80% of Ciona frequently trans-spliced genes. Our analysis also revealed significant use of closely spaced alternative trans-splice acceptor sites which further underscores the mechanistic similarity of cis- and trans-splicing and indicates that the prevalence of +/-3-nt alternative splicing events at tandem acceptor sites, NAGNAG, is driven by spliceosomal mechanisms, and not nonsense-mediated decay, or selection at the protein level. The breadth of gene representation data enabled us to find new correlations between trans-splicing status and gene function, namely the overrepresentation in the frequently trans-spliced gene class of genes associated with plasma/endomembrane system, Ca(2+) homeostasis, and actin cytoskeleton.

Replacement of mRNA 5' UTR sequences by short sequences trans-spliced from specialized, noncoding, spliced leader (SL) RNAs is an enigmatic phenomenon, occurring in a set of distantly related animal groups including urochordates, nematodes, flatworms, and hydra, as well as in Euglenozoa and dinoflagellates. Whether SL trans-splicing has a common evolutionary origin and biological function among different organisms remains unclear. We have undertaken a systematic identification of SL exons in cDNA sequence data sets from non-bilaterian metazoan species and their closest unicellular relatives. SL exons were identified in ctenophores and in hydrozoan cnidarians, but not in other cnidarians, placozoans, or sponges, or in animal unicellular relatives. Mapping of SL absence/presence obtained from this and previous studies onto current phylogenetic trees favors an evolutionary scenario involving multiple origins for SLs during eumetazoan evolution rather than loss from a common ancestor. In both ctenophore and hydrozoan species, multiple SL sequences were identified, showing high sequence diversity. Detailed analysis of a large data set generated for the hydrozoan Clytia hemisphaerica revealed trans-splicing of given mRNAs by multiple alternative SLs. No evidence was found for a common identity of trans-spliced mRNAs between different hydrozoans. One feature found specifically to characterize SL-spliced mRNAs in hydrozoans, however, was a marked adenosine enrichment immediately 3' of the SL acceptor splice site. Our findings of high sequence divergence and apparently indiscriminate use of SLs in hydrozoans, along with recent findings in other taxa, indicate that SL genes have evolved rapidly in parallel in diverse animal groups, with constraint on SL exon sequence evolution being apparently rare.