Search

Abstract Few aerobic hyperthermophilic microorganisms degrade polysaccharides. Here, we describe the genome-enabled enrichment and optical tweezer-based isolation of an aerobic polysaccharide-degrading hyperthermophile, Fervidibacter sacchari, previously ascribed to candidate phylum Fervidibacteria. F. sacchari uses polysaccharides and monosaccharides for growth at 65–87.5 °C and expresses 191 carbohydrate-active enzymes (CAZymes) according to RNA-Seq and proteomics, including 31 with unusual glycoside hydrolase domains (GH109, GH177, GH179). Fluorescence in-situ hybridization and nanoscale secondary ion mass spectrometry confirmed rapid assimilation of 13C-starch in spring sediments. Purified GHs were optimally active at 80–100 °C on ten different polysaccharides. Finally, we propose reassigning Fervidibacteria as a class within phylum Armatimonadota, along with 18 other species, and show that a high number and diversity of CAZymes is a hallmark of the phylum, in both aerobic and anaerobic lineages. Our study establishes Fervidibacteria as hyperthermophilic polysaccharide degraders in terrestrial geothermal springs and suggests a broad role for Armatimonadota in polysaccharide catabolism.

Abstract Ovarian cancer is the 8th most common cancer among women and has a 5-year survival of only 30–50%. While the survival is close to 90% for stage I tumours it is only 20% for stage IV. Current biomarkers are not sensitive nor specific enough, and novel biomarkers are urgently needed. We used the Explore PEA technology for large-scale analysis of 2943 plasma proteins to search for new biomarkers using two independent clinical cohorts. The discovery analysis using the first cohort identified 296 proteins that had significantly different levels in malign tumours as compared to benign and for 269 (91%) of these, the association was replicated in the second cohort. Multivariate modelling, including all proteins independent of their association in the univariate analysis, identified a model for separating benign conditions from malign tumours (stage I–IV) consisting of three proteins; WFDC2, KRT19 and RBFOX3. This model achieved an AUC of 0.92 in the replication cohort and a sensitivity and specificity of 0.93 and 0.77 at a cut-off developed in the discovery cohort. There was no statistical difference of the performance in the replication cohort compared to the discovery cohort. WFDC2 and KRT19 have previously been associated with ovarian cancer but RBFOX3 has not previously been identified as a potential biomarker. Our results demonstrate the ability of using high-throughput precision proteomics for identification of novel plasma protein biomarker for ovarian cancer detection.

Abstract Terrestrial geothermal springs are physicochemically diverse and host abundant populations of Archaea. However, the diversity, functionality, and geological influences of these Archaea are not well understood. Here we explore the genomic diversity of Archaea in 152 metagenomes from 48 geothermal springs in Tengchong, China, collected from 2016 to 2021. Our dataset is comprised of 2949 archaeal metagenome-assembled genomes spanning 12 phyla and 392 newly identified species, which increases the known species diversity of Archaea by ~48.6%. The structures and potential functions of the archaeal communities are strongly influenced by temperature and pH, with high-temperature acidic and alkaline springs favoring archaeal abundance over Bacteria. Genome-resolved metagenomics and metatranscriptomics provide insights into the potential ecological niches of these Archaea and their potential roles in carbon, sulfur, nitrogen, and hydrogen metabolism. Furthermore, our findings illustrate the interplay of competition and cooperation among Archaea in biogeochemical cycles, possibly arising from overlapping functional niches and metabolic handoffs. Taken together, our study expands the genomic diversity of Archaea inhabiting geothermal springs and provides a foundation for more incisive study of biogeochemical processes mediated by Archaea in geothermal ecosystems.

Summary: Early detection is key for increased survival in ovarian cancer, but no general screening program exists today due to lack of biomarkers and overall cost versus benefit over traditional clinical methods. Here, we used dried cervico-vaginal fluid (CVF) as sampling matrix coupled with mass spectrometry for detection of protein biomarkers. We find that self-collected CVF on paper cards yields robust results and is suitable for high-throughput proteomics. Artificial intelligence–based methods were used to identify an 11-protein panel that separates cases from controls. In validation data, the panel achieved a sensitivity of 0.97 (95% CI 0.91–1.00) at a specificity of 0.67 (0.40–0.87). Analyses of samples collected prior to development of symptoms indicate that the panel is informative also of future risk of disease. Dried CVF is used in cervical cancer screening, and our results opens the possibility for a screening program also for ovarian cancer, based on self-collected CVF samples.

Endosomal escape and subsequent cytosolic delivery of siRNA therapeutics is inefficient, and quantification is difficult. Here the authors report a confocal microscopy-based method to quantify cytosolic delivery of fluorescently labelled siRNA during lipid-mediated delivery.

We present genome assemblies from two male Aricia agestis specimens (the Brown Argus; Arthropoda; Insecta; Lepidoptera; Lycaenidae). The genome sequences are 435.3 and 437.4 megabases in span. Each assembly is scaffolded into 23 chromosomal pseudomolecules, including the Z sex chromosome. The mitochondrial genomes were assembled and are 15.47 and 15.45 kilobases in length. Gene annotation of these assemblies on Ensembl identified 12,688 and 12,654 protein coding genes.

Abstract Play is common in young homeotherm animals and has an important role as a tentative indicator of positive states of welfare. Furthermore, during domestication play is believed to have increased in frequency in several species as part of the domestication syndrome. Here, we studied the ontogeny of play in chickens in two experiments. The first compared the behavioural development between domesticated White Leghorn (WL) laying hen chicks and ancestral Red Junglefowl (RJF) and the second compared the same between WL chicks that had experienced the stress of commercial hatchery routines and a control group, hatched under calm conditions. In both experiments, 10 groups of four chicks each from each of the groups were moved twice per week to an enriched and fully enclosed play arena, starting at day 8 and finishing day 39 or 53 after hatch. In the arena, the frequency of play behaviours was recorded during 30 min and divided into object, locomotory and social play. In experiment one, total play as well as object play was significantly more common in WL whereas locomotor and social play was more common in RJF. In experiment two, total play was significantly more frequent in commercially hatched chicks, despite that none of the sub-categories differed significantly between the groups. In conclusion, domestication as well as early stress does affect the occurrence of play in chickens, but the effects are complex and require further research.

BackgroundCovid-19 is one of the worst crises in modern working life with a direct negative impact on many enterprises and organizations. The aim of this study is to explore what managers in Small Scale Enterprises (SSEs) changed in their business during the Covid-19 pandemic, particularly addressing health issues.MethodsA longitudinal qualitative research methodology was used, interviewing 16 managers of SSEs in the Norwegian and Swedish manufacturing and service sector both before (round 1) and during the pandemic (round 2). In this approach, time is designed into the research process, making change a key focus for analysis.ResultsThe analysis resulted in two main themes, resilience and demanding occupational health and safety conditions, and five sub-themes. Results show how managers in SSEs changed their business during the Covid-19 pandemic and the impact of these changes. Although, the enterprises were heavily affected in the beginning of the pandemic, several managers found new solutions for their businesses to maintain and reach new customers. They applied a socially responsible management which addressed different health issues.ConclusionCrises like the Covid-19 pandemic will have future impact on SSEs making it important to understand how managers in such enterprises address business and health issues. This knowledge may have practical implications for supporting managers in SSEs in how to perform a socially responsible management and maintain occupational health and safety measures. The managerial implications from this research are that they need to be flexible, reorientable and, at the same time, be loyal to the core business. This study shows the importance of doing longitudinal studies about business and health issues among mangers in SSEs.

Background The response of small business managers to an external event such as the pandemic can have a profound effect on the work environment, health and well-being for themselves and their employees. Previous research on small business managers during the pandemic has mainly focused on traditional pathogenic effects, and there is a lack of studies looking at the issue from a salutogenic health promotion perspective. The aim of this study is to explore whether a sense of coherence and general resistance resources were experienced by small business managers in Sweden and Norway during the Covid-19 pandemic. Methods A qualitative design was applied through exploratory interviews with 16 managers of small businesses in Sweden and Norway. A content analysis of the interviews was conducted using the sense of coherence concept by Aaron Antonovsky, with the three main components of comprehensibility, meaningfulness and manageability acting as a conceptual framework for the analysis process. Results Within the three main sense-of-coherence categories, six general resistance resources were identified as being important for the managers to handle uncertainty during the pandemic. These were understanding rules and regulations, social support, optimism, proactivity, problem-solving and flexibility and cooperation. Conclusions The small business managers handled the pandemic in a way that worked well in their contexts, and the pandemic generally did not have a negative effect on their businesses or themselves. A salutogenic approach, through which the managers focused on identifying and using resources, was an important factor for managing stressors and adversity during the pandemic. Hence, the concept of salutogenesis may be used as an intervention to foster better health in small businesses, both at a personal and organisational level in order to handle future challenges effectively.

BackgroundThe response of small business managers to an external event such as the pandemic can have a profound effect on the work environment, health and well-being for themselves and their employees. Previous research on small business managers during the pandemic has mainly focused on traditional pathogenic effects, and there is a lack of studies looking at the issue from a salutogenic health promotion perspective. The aim of this study is to explore whether a sense of coherence and general resistance resources were experienced by small business managers in Sweden and Norway during the Covid-19 pandemic.MethodsA qualitative design was applied through exploratory interviews with 16 managers of small businesses in Sweden and Norway. A content analysis of the interviews was conducted using the sense of coherence concept by Aaron Antonovsky, with the three main components of comprehensibility, meaningfulness and manageability acting as a conceptual framework for the analysis process.ResultsWithin the three main sense-of-coherence categories, six general resistance resources were identified as being important for the managers to handle uncertainty during the pandemic. These were understanding rules and regulations, social support, optimism, proactivity, problem-solving and flexibility and cooperation.ConclusionsThe small business managers handled the pandemic in a way that worked well in their contexts, and the pandemic generally did not have a negative effect on their businesses or themselves. A salutogenic approach, through which the managers focused on identifying and using resources, was an important factor for managing stressors and adversity during the pandemic. Hence, the concept of salutogenesis may be used as an intervention to foster better health in small businesses, both at a personal and organisational level in order to handle future challenges effectively.

Background: Hypoxia and consequent production of vascular endothelial growth factor A (VEGFA) promote blood vessel leakiness and edema in ocular diseases. Anti-VEGFA therapeutics may aggravate hypoxia; therefore, therapy development is needed. Methods: Oxygen-induced retinopathy was used as a model to test the role of nitric oxide (NO) in pathological neovascularization and vessel permeability. Suppression of NO formation was achieved chemically using L-NMMA, or genetically, in endothelial NO synthase serine to alanine (S1176A) mutant mice. Results: Suppression of NO formation resulted in reduced retinal neoangiogenesis. Remaining vascular tufts exhibited reduced vascular leakage through stabilized endothelial adherens junctions, manifested as reduced phosphorylation of vascular endothelial (VE)-cadherin Y685 in a c-Src-dependent manner. Treatment with a single dose of L-NMMA in established retinopathy restored the vascular barrier and prevented leakage. Conclusions: We conclude that NO destabilizes adheren junctions, resulting in vascular hyperpermeability, by converging with the VEGFA/VEGFR2/c-Src/VE-cadherin pathway. Funding: This study was supported by the Swedish Cancer foundation (19 0119 Pj ), the Swedish Research Council (2020-01349), the Knut and Alice Wallenberg foundation (KAW 2020.0057) and a Fondation Leducq Transatlantic Network of Excellence Grant in Neurovascular Disease (17 CVD 03). KAW also supported LCW with a Wallenberg Scholar grant (2015.0275). WCS was supported by Grants R35 HL139945, P01 HL1070205, AHA MERIT Award. DV was supported by grants from the Deutsche Forschungsgemeinschaft, SFB1450, B03, and CRU342, P2.

Countries’ reliance on global food trade networks implies that regionally different climate change impacts on crop yields will be transmitted across borders. This redistribution constitutes a significant challenge for climate adaptation planning and may affect how countries engage in cooperative action. This paper investigates the long-term (2070–2099) potential impacts of climate change on global food trade networks of three key crops: wheat, rice and maize. We propose a simple network model to project how climate change impacts on crop yields may be translated into changes in trade. Combining trade and climate impact data, our analysis proceeds in three steps. First, we use network community detection to analyse how the concentration of global production in present-day trade communities may become disrupted with climate change impacts. Second, we study how countries may change their network position following climate change impacts. Third, we study the total climate-induced change in production plus import within trade communities. Results indicate that the stability of food trade network structures compared to today differs between crops, and that countries’ maize trade is least stable under climate change impacts. Results also project that threats to global food security may depend on production change in a few major global producers, and whether trade communities can balance production and import loss in some vulnerable countries. Overall, our model contributes a baseline analysis of cross-border climate impacts on food trade networks.

Visible-light irradiation of phthalimide esters in the presence of the photosensitizer [Ru(bpy)3]2+ and the stoichiometric reducing agent benzyl nicotinamide results in the formation of alkyl radicals under mild conditions. This approach to radical generation has proven useful for the synthesis of small organic molecules. Herein, we demonstrate for the first time the visible-light photosensitized deposition of robust alkyl thin films on Au surfaces using phthalimide esters as the alkyl radical precursors. In particular, we combine visible-light photosensitization with particle lithography to produce nanostructured thin films, the thickness of which can be measured easily using AFM cursor profiles. Analysis with AFM demonstrated that the films are robust and resistant to mechanical force while contact angle goniometry suggests a multilayered and disordered film structure. Analysis with IRRAS, XPS, and TOF SIMS provides further insights.

Intensification of arable crop production degrades soil health and production potential through loss of soil organic carbon. This, potentially, reduces agriculture’s resilience to climate change and thus food security. Furthermore, the expected increase in frequency of adverse and extreme weather events due to climate change are likely to affect crop yields differently, depending on when in the growing season they occur. We show that soil carbon provides farmers with a natural insurance against climate change through a gain in yield stability and more resilient production. To do this, we combined yield observations from 12 sites and 54 years of Swedish long-term agricultural experiments with historical weather data. To account for heterogenous climate effects, we partitioned the growing season into four representative phases for two major cereal crops. Thereby, we provide evidence that higher soil carbon increases yield gains from favourable conditions and reduces yield losses due to adverse weather events and how this occurs over different stages of the growing season. However, agricultural management practices that restore the soil carbon stock, thus contributing to climate change mitigation and adaptation, usually come at the cost of foregone yield for the farmer in the short term. To halt soil degradation and make arable crop production more resilient to climate change, we need agricultural policies that address the public benefits of soil conservation and restoration.

Transcription is regulated through binding factors to gene promoters to activate or repress expression, however, the mechanisms by which factors find targets remain unclear. Using single-molecule fluorescence microscopy, we determined in vivo stoichiometry and spatiotemporal dynamics of a GFP tagged repressor, Mig1, from a paradigm signaling pathway of Saccharomyces cerevisiae. We find the repressor operates in clusters, which upon extracellular signal detection, translocate from the cytoplasm, bind to nuclear targets and turnover. Simulations of Mig1 configuration within a 3D yeast genome model combined with a promoter-specific, fluorescent translation reporter confirmed clusters are the functional unit of gene regulation. In vitro and structural analysis on reconstituted Mig1 suggests that clusters are stabilized by depletion forces between intrinsically disordered sequences. We observed similar clusters of a co-regulatory activator from a different pathway, supporting a generalized cluster model for transcription factors that reduces promoter search times through intersegment transfer while stabilizing gene expression.

We studied the diagnostic performance of the IRIDICA PCR/electrospray ionization-mass spectrometry (PCR/ESI-MS) assay applied on bronchoalveolar lavage (BAL) samples, from 51 mechanically ventilated patients with suspected pneumonia, in a prospective study. In 32 patients with X-ray verified pneumonia, PCR/ESI-MS was positive in 66% and BAL culture was positive in 38% (p = 0.045), and either of the methods was positive in 69%. The following BAL result combinations were noted: PCR/ESI-MS+/culture+, 34%; PCR/ESI-MS+/culture-, 31%; PCR/ESI-MS-/culture+, 3.1%; PCR/ESI-MS-/culture-, 31%; kappa 0.36 (95% confidence interval (CI), 0.10-0.63). In pneumonia patients without prior antibiotic treatment, optimal agreement was noted with 88% PCR/ESI-MS+/culture+ and 12% PCR/ESI-MS-/culture- (kappa 1.0). However, in patients with prior antibiotic treatment, the test agreement was poor (kappa 0.16; 95% CI, -0.10-0.44), as 10 patients were PCR/ESI-MS+/culture-. In 8/10 patients the pathogens detected by PCR/ESI-MS could be detected by other conventional tests or PCR tests on BAL. Compared with BAL culture, PCR/ESI-MS showed specificities and negative predictive values of ≥87% for all individual pathogens, an overall sensitivity of 77% and positive predictive value (PPV) of 42%. When other conventional tests and PCR tests were added to the reference standard, the overall PPV increased to 87%. The PCR/ESI-MS semi-quantitative level tended to be higher for PCR/ESI-MS positive cases with pneumonia compared with cases without pneumonia (p = 0.074). In conclusion, PCR/ESI-MS applied on BAL showed a promising performance and has potential to be clinically useful in mechanically ventilated patients with suspected pneumonia. The usefulness of the method for establishment of pneumonia etiology and selection of antibiotic therapy should be further studied.

In order to improve biological control of agricultural pests, it is fundamental to understand which factors influence the composition of natural enemies in agricultural landscapes. In this study, we aimed to understand how agricultural land use affects a number of different traits in ground beetle communities to better predict potential consequences of land-use change for ecosystem functioning. We studied ground beetles in fields with different agricultural land use ranging from frequently managed sugar beet fields, winter wheat fields to less intensively managed grasslands. The ground beetles were collected in emergence tents that catch individuals overwintering locally in different life stages and with pitfall traps that catch individuals that could have a local origin or may have dispersed into the field. Community weighted mean values for ground beetle traits such as body size, flight ability and feeding preference were estimated for each land-use type and sampling method. In fields with high land-use intensity the average body length of emerging ground beetle communities was lower than in the grasslands while the average body length of actively moving communities did not differ between the land-use types. The proportion of ground beetles with good flight ability or a carnivorous diet was higher in the crop fields as compared to the grasslands. Our study highlights that increasing management intensity reduces the average body size of emerging ground beetles and the proportion of mixed feeders. Our results also suggest that the dispersal ability of ground beetles enables them to compensate for local management intensities.

We aimed to study if certain clinical and/or microbiological factors are associated with a high nasopharyngeal (NP) density of Streptococcus pneumoniae in pneumococcal pneumonia. In addition, we aimed to study if a high NP pneumococcal density could be useful to detect severe pneumococcal pneumonia.Adult patients hospitalized for radiologically confirmed community-acquired pneumonia were included in a prospective study. NP aspirates were collected at admission and were subjected to quantitative PCR for pneumococcal DNA (Spn9802 DNA). Patients were considered to have pneumococcal etiology if S. pneumoniae was detected in blood culture and/or culture of respiratory secretions and/or urinary antigen test.Of 166 included patients, 68 patients had pneumococcal DNA detected in NP aspirate. Pneumococcal etiology was noted in 57 patients (84%) with positive and 8 patients (8.2%) with negative test for pneumococcal DNA (p

Midkine (MDK) and Pleiotrophin (PTN) are small heparin-binding cytokines with closely related structures. The Drosophila genome harbours two genes encoding members of the MDK/PTN family of proteins, known as miple1 and miple2. We have investigated the role of Miple proteins in vivo, in particular with regard to their proposed role as ligands for the Alk receptor tyrosine kinase (RTK). Here we show that Miple proteins are neither required to drive Alk signaling during Drosophila embryogenesis, nor are they essential for development in the fruit fly. Additionally we show that neither MDK nor PTN can activate hALK in vivo when ectopically co-expressed in the fly. In conclusion, our data suggest that Alk is not activated by MDK/PTN related growth factors Miple1 and Miple 2 in vivo.

The T lymphocytes are the most important effector cells in immunotherapy of cancer. The conceptual objective for developing the tumor targeted superantigen (TTS) ABR-217620 (naptumomab estafenatox, 5T4Fab-SEA/E-120), now in phase 3 studies for advanced renal cell cancer, was to selectively coat tumor cells with cytotoxic T lymphocytes (CTL) target structures functionally similar to natural CTL pMHC target molecules. Here we present data showing that the molecular basis for the anti-tumor activity by ABR-217620 resides in the distinct interaction between the T cell receptor β variable (TRBV) 7-9 and the engineered superantigen (Sag) SEA/E-120 in the fusion protein bound to the 5T4 antigen on tumor cells. Multimeric but not monomeric ABR-217620 selectively stains TRBV7-9 expressing T lymphocytes from human peripheral blood similar to antigen specific staining of T cells with pMHC tetramers. SEA/E-120 selectively activates TRBV7-9 expressing T lymphocytes resulting in expansion of the subset. ABR-217620 selectively triggers TRBV7-9 expressing cytotoxic T lymphocytes to kill 5T4 positive tumor cells. Furthermore, ABR-217620 activates TRBV7-9 expressing T cell line cells in the presence of cell- and bead-bound 5T4 tumor antigen. Surface plasmon resonance analysis revealed that ABR-217620 binds to 5T4 with high affinity, to TRBV7-9 with low affinity and to MHC class II with very low affinity. The T lymphocyte engagement by ABR-217620 is constituted by displaying high affinity binding to the tumor cells (KD approximately 1 nM) and with the mimicry of natural productive immune TCR-pMHC contact using affinities of around 1 µM. This difference in kinetics between the two components of the ABR-217620 fusion protein will bias the binding towards the 5T4 target antigen, efficiently activating T-cells via SEA/E-120 only when presented by the tumor cells.

To characterize high-temperature cellulolytic microbial communities, two lignocellulosic substrates, ammonia fiber-explosion-treated corn stover and aspen shavings, were incubated at average temperatures of 77 and 85°C in the sediment and water column of Great Boiling Spring, Nevada. Comparison of 109,941 quality-filtered 16S rRNA gene pyrosequences (pyrotags) from eight enrichments to 37,057 quality-filtered pyrotags from corresponding natural samples revealed distinct enriched communities dominated by phylotypes related to cellulolytic and hemicellulolytic Thermotoga and Dictyoglomus, cellulolytic and sugar-fermenting Desulfurococcales, and sugar-fermenting and hydrogenotrophic Archaeoglobales. Minor enriched populations included close relatives of hydrogenotrophic Thermodesulfobacteria, the candidate bacterial phylum OP9, and candidate archaeal groups C2 and DHVE3. Enrichment temperature was the major factor influencing community composition, with a negative correlation between temperature and richness, followed by lignocellulosic substrate composition. This study establishes the importance of these groups in the natural degradation of lignocellulose at high temperatures and suggests that a substantial portion of the diversity of thermophiles contributing to consortial cellulolysis may be contained within lineages that have representatives in pure culture.

The Rehai and Ruidian geothermal fields, located in Tengchong County, Yunnan Province, China, host a variety of geochemically distinct hot springs. In this study, we report a comprehensive, cultivation-independent census of microbial communities in 37 samples collected from these geothermal fields, encompassing sites ranging in temperature from 55.1 to 93.6°C, in pH from 2.5 to 9.4, and in mineralogy from silicates in Rehai to carbonates in Ruidian. Richness was low in all samples, with 21-123 species-level OTUs detected. The bacterial phylum Aquificae or archaeal phylum Crenarchaeota were dominant in Rehai samples, yet the dominant taxa within those phyla depended on temperature, pH, and geochemistry. Rehai springs with low pH (2.5-2.6), high temperature (85.1-89.1°C), and high sulfur contents favored the crenarchaeal order Sulfolobales, whereas those with low pH (2.6-4.8) and cooler temperature (55.1-64.5°C) favored the Aquificae genus Hydrogenobaculum. Rehai springs with neutral-alkaline pH (7.2-9.4) and high temperature (>80°C) with high concentrations of silica and salt ions (Na, K, and Cl) favored the Aquificae genus Hydrogenobacter and crenarchaeal orders Desulfurococcales and Thermoproteales. Desulfurococcales and Thermoproteales became predominant in springs with pH much higher than the optimum and even the maximum pH known for these orders. Ruidian water samples harbored a single Aquificae genus Hydrogenobacter, whereas microbial communities in Ruidian sediment samples were more diverse at the phylum level and distinctly different from those in Rehai and Ruidian water samples, with a higher abundance of uncultivated lineages, close relatives of the ammonia-oxidizing archaeon "Candidatus Nitrosocaldus yellowstonii", and candidate division O1aA90 and OP1. These differences between Ruidian sediments and Rehai samples were likely caused by temperature, pH, and sediment mineralogy. The results of this study significantly expand the current understanding of the microbiology in Tengchong hot springs and provide a basis for comparison with other geothermal systems around the world.

Hyperpolarized (HP) (129)Xe magnetic resonance imaging (MRI) permits high resolution, regional visualization of pulmonary ventilation. Additionally, its reasonably high solubility (>10%) and large chemical shift range (>200 ppm) in tissues allow HP (129)Xe to serve as a regional probe of pulmonary perfusion and gas transport, when introduced directly into the vasculature. In earlier work, vascular delivery was accomplished in rats by first dissolving HP (129)Xe in a biologically compatible carrier solution, injecting the solution into the vasculature, and then detecting HP (129)Xe as it emerged into the alveolar airspaces. Although easily implemented, this approach was constrained by the tolerable injection volume and the duration of the HP (129)Xe signal.Here, we overcome the volume and temporal constraints imposed by injection, by using hydrophobic, microporous, gas-exchange membranes to directly and continuously infuse (129)Xe into the arterial blood of live rats with an extracorporeal (EC) circuit. The resulting gas-phase (129)Xe signal is sufficient to generate diffusive gas exchange- and pulmonary perfusion-dependent, 3D MR images with a nominal resolution of 2×2×2 mm(3). We also show that the (129)Xe signal dynamics during EC infusion are well described by an analytical model that incorporates both mass transport into the blood and longitudinal relaxation.Extracorporeal infusion of HP (129)Xe enables rapid, 3D MR imaging of rat lungs and, when combined with ventilation imaging, will permit spatially resolved studies of the ventilation-perfusion ratio in small animals. Moreover, EC infusion should allow (129)Xe to be delivered elsewhere in the body and make possible functional and molecular imaging approaches that are currently not feasible using inhaled HP (129)Xe.

BACKGROUND: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. OBJECTIVE: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. METHODS: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). RESULTS: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. CONCLUSIONS: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

The recent emergence of a novel pandemic influenza A(H1N1) strain in humans exemplifies the rapid and unpredictable nature of influenza virus evolution and the need for effective therapeutics and vaccines to control such outbreaks. However, resistance to antivirals can be a formidable problem as evidenced by the currently widespread oseltamivir- and adamantane-resistant seasonal influenza A viruses (IFV). Additional antiviral approaches with novel mechanisms of action are needed to combat novel and resistant influenza strains. DAS181 (Fludase) is a sialidase fusion protein in early clinical development with in vitro and in vivo preclinical activity against a variety of seasonal influenza strains and highly pathogenic avian influenza strains (A/H5N1). Here, we use in vitro, ex vivo, and in vivo models to evaluate the activity of DAS181 against several pandemic influenza A(H1N1) viruses.The activity of DAS181 against several pandemic influenza A(H1N1) virus isolates was examined in MDCK cells, differentiated primary human respiratory tract culture, ex-vivo human bronchi tissue and mice. DAS181 efficiently inhibited viral replication in each of these models and against all tested pandemic influenza A(H1N1) strains. DAS181 treatment also protected mice from pandemic influenza A(H1N1)-induced pathogenesis. Furthermore, DAS181 antiviral activity against pandemic influenza A(H1N1) strains was comparable to that observed against seasonal influenza virus including the H274Y oseltamivir-resistant influenza virus.The sialidase fusion protein DAS181 exhibits potent inhibitory activity against pandemic influenza A(H1N1) viruses. As inhibition was also observed with oseltamivir-resistant IFV (H274Y), DAS181 may be active against the antigenically novel pandemic influenza A(H1N1) virus should it acquire the H274Y mutation. Based on these and previous results demonstrating DAS181 broad-spectrum anti-IFV activity, DAS181 represents a potential therapeutic agent for prevention and treatment of infections by both emerging and seasonal strains of IFV.

Antiviral drug resistance for influenza therapies remains a concern due to the high prevalence of H1N1 2009 seasonal influenza isolates which display H274Y associated oseltamivir-resistance. Furthermore, the emergence of novel H1N1 raises the potential that additional reassortments can occur, resulting in drug resistant virus. Thus, additional antiviral approaches are urgently needed. DAS181 (Fludase), a sialidase fusion protein, has been shown to have inhibitory activity against a large number of seasonal influenza strains and a highly pathogenic avian influenza (HPAI) strain (H5N1). Here, we examine the in vitro activity of DAS181 against a panel of 2009 oseltamivir-resistant seasonal H1N1 clinical isolates. The activity of DAS181 against nine 2009, two 2007, and two 2004 clinical isolates of seasonal IFV H1N1 was examined using plaque number reduction assay on MDCK cells. DAS181 strongly inhibited all tested isolates. EC50 values remained constant against isolates from 2004, 2007, and 2009, suggesting that there was no change in DAS181 sensitivity over time. As expected, all 2007 and 2009 isolates were resistant to oseltamivir, consistent with the identification of the H274Y mutation in the NA gene of all these isolates. Interestingly, several of the 2007 and 2009 isolates also exhibited reduced sensitivity to zanamivir, and accompanying HA mutations near the sialic acid binding site were observed. DAS181 inhibits IFV that is resistant to NAIs. Thus, DAS181 may offer an alternative therapeutic option for seasonal or pandemic IFVs that become resistant to currently available antiviral drugs.

Abstract Patients with cancer have many psychosocial needs, some of which may be addressed by implementation of a screening tool. However, it is unknown what ultimately happens (i.e., the “care cascade”) to patients following these interventions. The objective of this study was to evaluate the care cascade for patients following the implementation of a psychosocial needs screening tool. This was a prospective cohort study conducted at a university hospital radiation oncology clinic. Participants who were 18 years or older and presenting for their initial radiation oncology appointment were asked to complete a screening survey. From December 2019 to January 2021, 242 patients completed the survey. 70% of patients were seen for consideration of definitive therapy. 62% of patients checked “yes” to at least one item, most commonly supportive/palliative care (33%), exercise/PT (26%) and advance care planning (26%). Among definitive patients, the most common were supportive/palliative care (33%) and exercise/PT (26%). Among palliative patients, the most common were supportive/palliative care (42%) and advance care planning (32%). Participants were followed for 6 months after taking the survey. 74% of patients with a positive screening survey were contacted by a social worker and/or had a new referral placed with 47% of those patients ultimately attending a new appointment. Screening tools are commonly implemented to quickly identify needs in oncology patients. This study tracked patients following this type of intervention to determine what proportion of patients ultimately received care related to the identified need. Despite the majority of patients being referred to a relevant provider, fewer than half ultimately attended appointments. The combination of a screening tool with social work triage may be an effective way to distribute resources and properly route patients to supportive care providers.

Trace metals have been an important ingredient for life throughout Earth’s history. Here, the authors show that a member of an elusive archaeal lineage (Caldarchaeales or Aigarchaeota) requires tungsten for growth, and provide evidence that tungsten-dependent metabolism played a role in the origin and evolution of this lineage.

Abstract Soil biodiversity constitutes the biological pillars of ecosystem services provided by soils worldwide. Soil life is threatened by intense agricultural management and shifts in climatic conditions as two important global change drivers which are not often jointly studied under field conditions. We addressed the effects of experimental short-term drought over the wheat growing season on soil organisms and ecosystem functions under organic and conventional farming in a Swiss long term trial. Our results suggest that activity and community metrics are suitable indicators for drought stress while microbial communities primarily responded to agricultural practices. Importantly, we found a significant loss of multiple pairwise positive and negative relationships between soil biota and process-related variables in response to conventional farming, but not in response to experimental drought. These results suggest a considerable weakening of the contribution of soil biota to ecosystem functions under long-term conventional agriculture. Independent of the farming system, experimental and seasonal (ambient) drought conditions directly affected soil biota and activity. A higher soil water content during early and intermediate stages of the growing season and a high number of significant relationships between soil biota to ecosystem functions suggest that organic farming provides a buffer against drought effects.

Abstract Alloys of Mn55Al45C2 with additions of VC nano-particles have been synthesized and their properties evaluated. The Mn55Al45C2(VC) x (x = 0.25, 0.5 and 1) alloys have been prepared by induction melting resulting in a high content of the ferromagnetic τ-phase (> 94 wt.%). Powder X-ray diffraction indicates that nano-VC can be dissolved in the alloy matrix up to 1 at.%. On the other side, metallography investigations by scanning electron microscopy and scanning transmission electron microscope show inclusions of the nanosized additives in the microstructure. The effect of nano-VC on the grain and twin boundaries has been studied by electron backscattering diffraction. The magnetization has been measured by magnetometry up to 9 T while the domain structure has been studied using both magnetic force microscopy as well as Kerr-microscopy. For nano-VC contents above 0.25 at.%, a clear increase of the coercive force is observed, from 57 to 71 kA/m. The optimum appears to be for 0.5 at.% nano-VC which shows a 25% increase in coercive force without losing any saturation magnetization. This independent increase in coercivity is believed to originate from the nano-VC reducing the overall magnetic domain size. Overall, we observe that addition of nano-VC could be an interesting route to increase the coercive force of MnAl, without sacrificing saturation magnetization.

Predation is a major evolutionary driver of animal adaptation. However, understanding of anti-predator evolution is biased toward vertebrate taxa. Cephalopoda, a class in the invertebrate phylum Mollusca, are known for their diverse anti-predator strategies, characterised by their behavioural flexibility. While ancestral cephalopods were protected by a hard outer shell, extant cephalopods have greatly reduced their reliance on physical defences. Instead, cephalopods have evolved highly developed senses to identify potential threats, cryptic skin patterns to avoid detection, startle responses to deter attack, and elaborate means of escape. While cephalopod anti-predator repertoires are relatively well described, their evolution, and the selective pressures that shaped them, have received much less attention. This is despite their potential relevance, in turn, to elucidate evolution of the remarkable cognitive abilities of cephalopods. Here, we review cephalopod anti-predator evolution, considering four key aspects: (i) shell reduction and loss; (ii) the skin patterning system; (iii) the ecological context accompanying the evolution of advanced cognit.ive abilities; (iv) why the evolutionary trajectory taken by cephalopods is so unique among invertebrates. In doing so, we consider the unique physiology of cephalopods and discuss how this may have constrained or aided the development of their anti-predator repertoire. In particular, cephalopods are poorly equipped to defend themselves physically and escape predation by fish, due to a lack of comparable weaponry or musculature. We argue that this may have selected for alternative forms of defence, driving an evolutionary trajectory favouring crypsis and complex behaviours, and the promotion of sensory and cognitive adaptations. Unravelling the complexities of cephalopod anti-predator evolution remains challenging. However, recent technological developments available for cephalopod field and laboratory studies, coupled with new genomic data and analysis approaches, offer great scope to generate novel insights.

Mutations in the RNA binding protein FUS cause amyotrophic lateral sclerosis (ALS). Here the authors characterize FUS-binding to U1 snRNP and show that ALS-associated FUS aberrantly contacts U1 snRNA which interferes with its biogenesis pathway.

Therapeutic siRNA becomes trapped in endosomes, limiting its efficacy. Here the authors use fluorescently-tagged galectin-9 as a biosensor for membrane damage to monitor endosomal escape of cholesterol-conjugated siRNA following treatment of small molecule membrane-destabilising drugs.

Every year, billions of egg layer chicks around the world are hatched under highly stressful, industrial circumstances. Here, it is investigated how the stressful procedure in the commercial hatchery, including incubation, hatching, processing, and transport affects the chicks with regards to traits relevant for the egg production industry. These traits were compared to those of a control group hatched in a small incubator and handled gently och quietly in a quiet room without any processing and transport. The chicks were weighed at hatch and at eight additional time points: 4 days, 1 week (w), 2 w, 3 w, 5 w, 8 w, 20 w and 25 w of age. Feather pecking was studied at 15 w of age and damages to the feathers and injuries on the comb and wattle were assessed at 25 w of age. From 19 w of age, eggs were collected on three days per week, counted and weighed. Chicks from a commercial hatchery had a lower hatch weight than control chicks (p

Every year, billions of egg layer chicks around the world are hatched under highly stressful, industrial circumstances. Here, it is investigated how the stressful procedure in the commercial hatchery, including incubation, hatching, processing, and transport affects the chicks with regards to traits relevant for the egg production industry. These traits were compared to those of a control group hatched in a small incubator and handled gently och quietly in a quiet room without any processing and transport. The chicks were weighed at hatch and at eight additional time points: 4 days, 1 week (w), 2 w, 3 w, 5 w, 8 w, 20 w and 25 w of age. Feather pecking was studied at 15 w of age and damages to the feathers and injuries on the comb and wattle were assessed at 25 w of age. From 19 w of age, eggs were collected on three days per week, counted and weighed. Chicks from a commercial hatchery had a lower hatch weight than control chicks (p

Methane metabolism by some lineages of Archaea contributes to the cycling of carbon on Earth. Here, the authors show high diversity of methyl-coenzyme M reductase (Mcr), a key enzyme associated with archaeal methane/alkane metabolism, in hot spring Archaea, and investigate their ecological roles and evolution.

Diarrhea in mink kits is a major cause of disease and mortality in the mink production. The etiology remains unknown in most outbreaks due to a lack of diagnostic assays. In the current study we present an RT-qPCR method to detect mink astrovirus in fecal samples from mink kits with diarrhea. All sampled animals were classified based on age and patoanatomical evaluation as having pre-weaning diarrhea, diarrhea in the growth period or as having no macroscopic signs of diarrhea. Fecal samples were analyzed for MiAstV with RT-qPCR, next generation sequencing and electron microscopy in parallel. Mink astrovirus was detected with RT-qPCR in 92 out of 203 samples. This detection was confirmed by next generation sequencing in a high proportion of samples (22/27), and by visualization of astrovirus particles with EM in some of the samples. Mink astrovirus was highly prevalent (68%) among kits in the outbreaks of pre-weaning diarrhea, in particular outbreaks from May, while less prevalent in outbreaks in June. Mink astrovirus was detected in outbreaks of diarrhea in the growth period, though in a much lesser extent than in the pre-weaning period. The role of mink astrovirus in the diarrhea disease complex of mink remain to be investigated, and for that purpose this sensitive and robust RT-qPCR can be a valuable tool in the future.

Despite dramatic improvements in outcomes arising from the introduction of targeted therapies and immunotherapies, metastatic melanoma is a highly resistant form of cancer with 5 year survival rates of

Clinical oncology is rapidly adopting next-generation sequencing technology for nucleotide variant and indel detection. Here the authors present a three-platform approach (whole-genome, whole-exome, and whole-transcriptome) in pediatric patients for the detection of diverse types of germline and somatic variants.

The phylum of archaea Aigarchaeota is poorly characterized due to limited genomic sampling. Here, Hua and colleagues use genome-resolved metagenome sequencing to reconstruct six hot spring strains of Aigarchaeota and then infer their metabolism and evolutionary history.

The ability to identify drivers responsible for algal community shifts is an important aspect of environmental issues. The lack of long-term datasets, covering periods prior to these shifts, is often limiting our understanding of drivers responsible. The freshwater alga, Gonyostomum semen (Raphidophyceae), has significantly increased distribution and mass occurrences in Scandinavian lakes during the past few decades, often releasing a skin irritating slime that causes discomfort for swimmers. While the alga has been extensively studied, long-term data from individual lakes are often absent or greatly limited and drivers behind this species' success are still not clear. However, if specific and persistent taxa biomarkers for G. semen could be detected in dated sediment cores, long-term data would be improved and more useful. To test for biomarkers, we examined the pigment composition of several G. semen strains in culture. Further, dated sediment core samples from Lake Lundebyvann, Norway, were used to test the pigments' suitability as biomarkers in paleolimnological studies. Modifications to a common analysis allowed for the successful detection of the polar xanthophyll heteroxanthin and the non-polar chlorophyll a, as well as several other algal pigments by using high performance liquid chromatography-photometric diode arrays (HPLC-PDA). Heteroxanthin was confirmed by liquid chromatography-mass spectrometry (LC-MS) and detected by HPLC-PDA in all examined G. semen strains, along with chlorophyll a. Using HPLC-PDA, we also identified and confirmed the presence of the biomarker, xanthophyll heteroxanthin, in sediment core samples up to 60 years of age. The specificity of this xanthophyll was also tested by examining a wide range of algal strains from common Norwegian phytoplankton species. Heteroxanthin was not detected in any species commonly occurring in significant amounts in Norwegian lakes. We therefore conclude that heteroxanthin is a suitable pigment biomarker for G. semen and that this pigment can be successfully used for paleolimnological studies.

Laser capture microscopy (LCM) coupled with global transcriptome profiling requires relatively large numbers of cells. Here, the authors show that LCM coupled with full-length mRNA-sequencing (LCM-seq) can sequence single cells, and that LCM-seq can provide biological insight on highly similar neuronal populations.

The analysis of existing metagenomic data can lead to discovery of new microorganisms. Here, Eloe-Fadrosh et al. perform a large-scale analysis of global metagenomic data, followed by genome reconstruction and single-cell genomics, to describe a new bacterial phylum that inhabits geothermal springs.

Participation in activities perceived to be meaningful is of importance in recovery processes among people with mental illness. This qualitative study explored experiences of participation in music and theater among people with long-term mental illness. Data were collected through in-depth interviews with 11 participants in a music and theater workshop carried out in a Norwegian mental health hospital context. Through a hermeneutical-phenomenological analysis, three central themes emerged: (a) engaging in the moment, (b) reclaiming everyday life, and (c) dreaming of a future. The findings indicate that participation in music and theater provided an opportunity to focus on enjoyable mundane activities and demonstrate how arts have the potential to bring meaning and more specifically small positive moments into participants' lives. Despite seeming to be small in nature, these moments appeared to be able to add pleasure and meaning to the lives of those experiencing them. Consequently, there is a need to raise professionals' awareness of these small positive moments of meaning, the power these experiences carry, and how to facilitate arenas which can provide such moments for people with long-term mental illness.

BackgroundAbout 30% of the cervical cancer cases in Sweden occur in women older than 60. The primary aim was to evaluate the acceptability of repeated self-sampling at home for HPV-testing in elderly women. The prevalence of HPV and HPV related dysplasia as well as the sensitivity of cytology was evaluated.MethodsRepeated self-sampling at home for HPV testing was offered 375 women in each of the four age groups 60, 65, 70 and 75 years. Women with two consecutive positive HPV tests were examined with sampling for histology and cytology.FindingsA self-sample was provided by 59.5% (893/1500) of the invited women. The overall prevalence of HPV was 4.4% (95% CI 3.2-6.0, n = 39) in the first test, and 2.5% were persistent positive in the second test (95% C 1.6-3.8, n = 22) collected on average 5.5 months later. Dysplasia, was found in 1.8% (16/893) (95% CI 1.1-3.0) and CIN 2+ in 1.0% (9/893) (95%CI 0.5-2.0) of the women. Of the 16 women with dysplasia in histology, 13 (81.2%) had a normal cytology.InterpretationRepeated self-sampling at home combined with HPV testing was well accepted among elderly women. A high prevalence of CIN was diagnosed by histology. Cytology showed extremely low sensitivity and should not be recommended for this age group.

Background and objectivePoor vitamin D status during pregnancy has been associated with unfavorable outcomes for mother and child. Thus, adequate vitamin D status in women of childbearing age may be important. The aim of this study is to investigate the determinants of 25-hydroxyvitamin D (25(OH)D) serum concentrations in women of childbearing age living in Sweden, at latitude 57-58° north.MethodEighty four non-pregnant, non-lactating, healthy, fair-skinned women aged between 25-40 years were included. All subjects provided blood samples, four day food records and answered questionnaires about sun exposure and lifestyle. Total serum 25(OH)D was analyzed using Roche Cobas® electrochemoluminiescent immunoassay.ResultsMean 25(OH)D was 65.8±19.9 nmol/l and 23% of the subjects had concentrations ConclusionEvery fifth woman had 25(OH)D concentrations

Over 100 hot spring sediment samples were collected from 28 sites in 12 areas/regions, while recording as many coincident geochemical properties as feasible (>60 analytes). PCR was used to screen samples for Korarchaeota 16S rRNA genes. Over 500 Korarchaeota 16S rRNA genes were screened by RFLP analysis and 90 were sequenced, resulting in identification of novel Korarchaeota phylotypes and exclusive geographical variants. Korarchaeota diversity was low, as in other terrestrial geothermal systems, suggesting a marine origin for Korarchaeota with subsequent niche-invasion into terrestrial systems. Korarchaeota endemism is consistent with endemism of other terrestrial thermophiles and supports the existence of dispersal barriers. Korarchaeota were found predominantly in >55°C springs at pH 4.7-8.5 at concentrations up to 6.6×10(6) 16S rRNA gene copies g(-1) wet sediment. In Yellowstone National Park (YNP), Korarchaeota were most abundant in springs with a pH range of 5.7 to 7.0. High sulfate concentrations suggest these fluids are influenced by contributions from hydrothermal vapors that may be neutralized to some extent by mixing with water from deep geothermal sources or meteoric water. In the Great Basin (GB), Korarchaeota were most abundant at spring sources of pH

Open Access (OA) is a model for publishing scholarly peer reviewed journals, made possible by the Internet. The full text of OA journals and articles can be freely read, as the publishing is funded through means other than subscriptions. Empirical research concerning the quantitative development of OA publishing has so far consisted of scattered individual studies providing brief snapshots, using varying methods and data sources. This study adopts a systematic method for studying the development of OA journals from their beginnings in the early 1990s until 2009. Because no comprehensive index of OA articles exists, systematic manual data collection from journal web sites was conducted based on journal-level data extracted from the Directory of Open Access Journals (DOAJ). Due to the high number of journals registered in the DOAJ, almost 5000 at the time of the study, stratified random sampling was used. A separate sample of verified early pioneer OA journals was also studied. The results show a very rapid growth of OA publishing during the period 1993-2009. During the last year an estimated 191 000 articles were published in 4769 journals. Since the year 2000, the average annual growth rate has been 18% for the number of journals and 30% for the number of articles. This can be contrasted to the reported 3,5% yearly volume increase in journal publishing in general. In 2009 the share of articles in OA journals, of all peer reviewed journal articles, reached 7,7%. Overall, the results document a rapid growth in OA journal publishing over the last fifteen years. Based on the sampling results and qualitative data a division into three distinct periods is suggested: The Pioneering years (1993-1999), the Innovation years (2000-2004), and the Consolidation years (2005-2009).

Immune evasion from NK surveillance related to inadequate NK-cell function has been suggested as an explanation of the high incidence of relapse and fatal outcome of many blood malignancies. In this report we have used Jurkat and Raji cell lines as a model for studies of the NKG2D receptor-ligand system in T-and B cell leukemia/lymphoma. Using real-time quantitative RT-PCR and immunoflow cytometry we show that Jurkat and Raji cells constitutively express mRNA and protein for the stress-inducible NKG2D ligands MICA/B and ULBP1 and 2, and up-regulate the expression in a cell-line specific and stress-specific manner. Furthermore, we revealed by electron microscopy, immunoflow cytometry and western blot that these ligands were expressed and secreted on exosomes, nanometer-sized microvesicles of endosomal origin. Acting as a decoy, the NKG2D ligand-bearing exosomes downregulate the in vitro NKG2D receptor-mediated cytotoxicity and thus impair NK-cell function. Interestingly, thermal and oxidative stress enhanced the exosome secretion generating more soluble NKG2D ligands that aggravated the impairment of the cytotoxic response. Taken together, our results might partly explain the clinically observed NK-cell dysfunction in patients suffering from leukemia/lymphoma. The adverse effect of thermal and oxidative stress, enhancing the release of immunosuppressive exosomes, should be considered when cytostatic and hyperthermal anti-cancer therapies are designed.