Search

Tin sulfide (SnS) thin films were deposited at room temperature (RT) by thermal evaporation method and subsequently annealed at 150–350 °C in N2 atmosphere. The influence of annealing temperature on composition, structural, morphological and optical properties of the thin films has been investigated. X-ray diffraction (XRD) analysis and Raman studies confirmed the formation of single phase SnS films at RT and annealed up to 300 °C. The crystallite size increased from 24 nm for as-deposited film to 37 nm for the 300 °C annealed film and further reduced to 18 nm for the 350 °C annealed film. The film annealed at 200 °C was found to have better morphological features with (111) preferred oriented crystallites. The absorption coefficient, optical band gap (Eg) of the deposited films were estimated from the optical transmittance measurements. Photodetectors are fabricated by depositing Ag contacts on SnS thin films using a metal mask and photo response was tested under dark and illumination conditions using 532 nm laser of varying power intensities. The photodetectors performance is evaluated using responsivity (R), external quantum efficiency (EQE), and specific detectivity (D*). The specific detectivity of 6.8 × 1010 Jones obtained in the present study is nearly two orders of magnitude greater than that reported earlier. [ABSTRACT FROM AUTHOR]

ZnO nanoparticles at different temperatures were synthesized by using the combustion method. The effect of synthesis temperature on the properties of the nanoparticles was studied by using XRD, FESEM, EDS, TEM, photoluminescence (PL), Raman, diffuse reflectance spectra (DRS), and VSM characterization techniques. The XRD results reveal that the grown nanoparticles have a hexagonal wurtzite structure without any impurities and agreed with EDS results. FESEM and TEM micrographs show that the ZnO nanoparticles possess a spherical shape with agglomeration free, and the size increases with increase of synthesis temperature. From DRS studies, it was noticed that the band gap decreases with increase of synthesis temperature. In PL studies, blue peak at 465 nm may be due to defect-related transitions. A sharp intense peak in Raman spectra at 485 cm−1 represents E2H mode is a characteristic of a hexagonal wurtzite structure. The magnetic studies show that the magnetization decreases from 0.0172 to 0.0042 emu/g as the synthesis temperature increases from 400 to 550 °C. ZnO synthesized at 500 °C has a large squareness ratio. These materials are potential candidates for memory devices. [ABSTRACT FROM AUTHOR]

A PVT compensated sub-µA current reference is proposed in this paper. It is based on the summation of a proportional to absolute temperature (PTAT) current with a complementary to absolute temperature current. The current generators are realized using the subthreshold beta multipliers. The PTAT current generator of the proposed current reference behaves always as PTAT independent of transistor sizing. The process compensation technique is based on the concept of an inverse process dependency between β=μCOXW/L and the threshold voltage VTH of the MOS transistor at any process corner. A current reference of 100 nA is implemented in CMOS 0.18 µm technology and studied through simulation. The proposed circuit has a temperature coefficient of 335 ppm/°C in the temperature range of 0-100 °C. It provides a low process variation of ± 2.1% and a lower line sensitivity of 0.093%/V in the supply voltage range of 1.35-3 V. It achieves a better figure of merit of 5.487% compared to the current references reported in the literature. [ABSTRACT FROM AUTHOR]

The main objective of the present analysis is to study an enhancement of heat transfer in an unsteady rotating flow for the aqueous suspensions of single wall nanotubes under nonlinear thermal radiation. Appropriate transformations are implemented for the conversion of partial differential systems into a set of ordinary differential equations. The transformed expressions have been scrutinized through RKF-45 order method along with shooting technique. The impact of various pertinent parameters for the velocity and temperature fields are analyzed through graphs in detail. Also, the role of substantial parameters on the fiction factor and mass transportation rates is determined and conferred in depth through graphs. Our simulations established that the higher value of rotation rate parameter reduces the thickness of the momentum boundary layer thickness. Further, an unsteadiness parameter increases velocity and temperature profile decreases. [ABSTRACT FROM AUTHOR]

This study is mainly focused on dielectric properties of lead arsenate glasses crystallized with different concentrations of CuO over continuous ranges of frequency (3 Hz −100 kHz) and temperature (300–633 K). The glasses were prepared by melt quenching technique and were heat treated for prolonged time for ceramization. Prepared samples were characterized by XRD, SEM and DSC techniques. SEM studies indicated that the samples are composed of small crystal grains of the size varying from 0.2 to 1.0 µm cemented with the residual glass phase. XRD studies indicated CuAs 2 O 4 , Pb 2 Cu 7 (AsO 4 ) 6 and Cu 2 O are the main crystal phases developed during the crystallization. Optical absorption studies confirmed the presence of copper ions in Cu + valence state in addition to Cu 2+ state and the fraction of Cu + ions is found to increase with the content of CuO. The optical band gap exhibited increasing trend with CuO content. IR spectral studies indicated an increase of degree of polymerization of the glass network with the CuO content. The observed variations of dielectric parameters with frequency, temperature and CuO content are discussed using different polarization mechanisms. The dielectric relaxation effects exhibited by the loss tangent and the electric moduli are analyzed using graphical method and observed relaxation effects are attributed to the complexes of divalent copper ions with oxygens. The impedance diagrams indicated increase of bulk resistance of the samples with increase of CuO content. The ac conductivity exhibited a decreasing trend with increase of CuO content. The conduction phenomenon is explained using polaron hopping between Cu + and Cu 2+ ions. The temperature independent part of the conductivity is explained using quantum mechanical tunneling (QMT) model. Finally, it is concluded that the insulating strength of the material increased with CuO content and such materials may be useful as electrical insulators in the low temperature region [ABSTRACT FROM AUTHOR]

Study on the properties of nanofluids is important since it can be used as thermal fluid in heat transfer equipment. Nanofluids possess enhanced thermo physical properties compared to the host base fluids. In the present study, stable copper oxide nanoparticles were prepared using water and water–ethylene glycol mixture as base fluids. Stability time was calculated for two different base fluids. Thermo physical properties such as viscosity and thermal conductivity with respect to temperature were measured for copper oxide in water and copper oxide in water–ethylene glycol suspension and the values were compared. It has been found that copper oxide in water suspension produces better properties than copper oxide in water–ethylene glycol suspension. The particle size and shape of nanofluids were determined by XRD (X-Ray Diffraction) and TEM (Transmission Electron Microscopy) analysis. [ABSTRACT FROM AUTHOR]

Abstract: A rapid, economic, and high yielding methodology has been developed for hydroacylation/reduction of activated ketones by using 1,3-bis(2,4,6-trimethylphenyl)imidazolium chloride as a catalyst in combination with triethylamine. The reaction proceeded at an ambient temperature via generating N-heterocyclic carbene in situ that interacted with the (hetero)aryl aldehyde employed. While the reduction of ketones takes place in MeOH, the hydroacylation process was found to be effective in THF for both electron rich and deficient aldehydes. [ABSTRACT FROM AUTHOR]

LiNbO 3 , prepared by ball milling assisted ceramic method, exhibits weak ferromagnetism and ferroelectricity at room temperature. X-ray diffraction pattern reveals the rhombohedral phase of LiNbO 3 with hexagonal unit cell symmetry. The weak ferromagnetic behavior, obtained using VSM, has been explained using Dzyaloshinskii–Moriya interaction caused by the ferroelectric distortion in its magnetic order. The P – E loop measurement shows lossy natured ferroelectric loop. Electrical and dielectric properties analyzed using impedance spectroscopy show two thermally activated conduction processes, derived from the Arrhenius plot. A gradual increase in the dielectric constant below 493 K and a rapid increase above 493 K reveals the contribution of polarization components and Lithium ion hopping. [ABSTRACT FROM AUTHOR]

Radiant temperature images from thermal remote sensing sensors are used to delineate surface coal fires, by deriving a cut-off temperature to separate coal-fire from non-fire pixels. Temperature contrast of coal fire and background elements (rocks and vegetation etc.) controls this cut-off temperature . This contrast varies across the coal field, as it is influenced by variability of associated rock types, proportion of vegetation cover and intensity of coal fires etc. We have delineated coal fires from background, based on separation in data clusters in maximum v/s mean radiant temperature (13th band of ASTER and 10th band of Landsat-8) scatter-plot, derived using randomly distributed homogeneous pixel-blocks (9 × 9 pixels for ASTER and 27 × 27 pixels for Landsat-8), covering the entire coal bearing geological formation. It is seen that, for both the datasets, overall temperature variability of background and fires can be addressed using this regional cut-off. However, the summer time ASTER data could not delineate fire pixels for one specific mine (Bhulanbararee) as opposed to the winter time Landsat-8 data. The contrast of radiant temperature of fire and background terrain elements, specific to this mine, is different from the regional contrast of fire and background, during summer. This is due to the higher solar heating of background rocky outcrops, thus, reducing their temperature contrast with fire. The specific cut-off temperature determined for this mine, to extract this fire, differs from the regional cut-off. This is derived by reducing the pixel-block size of the temperature data . It is seen that, summer-time ASTER image is useful for fire detection but required additional processing to determine a local threshold, along with the regional threshold to capture all the fires. However, the winter Landsat-8 data was better for fire detection with a regional threshold. [ABSTRACT FROM AUTHOR]

Molecular simulations were used to study the single component adsorption of H 2 and CH 4 in the iso-structural MOFs UiO-66, UiO-67 and UiO-68. The energetic landscape and the adsorption sites for the two gases are analyzed in detail while the pure component adsorption results are discussed in terms of excess adsorption capacities and isosteric heats, highlighting the limitations of the UiO pore topology for the adsorptive storage of H 2 and CH 4 . It is shown that adsorption occurs primarily due to the interactions between the linker and the guest molecules. We furthermore analyze the performance of the UiO series for H 2 and CH 4 storage either at 77 K or at 298 K. At 77 K the unique topology of the UiO structures enhances the fluid–solid interactions and it is shown that the excess H 2 adsorption capacity of UiO-66, at 1 bar as well as the maximum adsorption excess of UiO-68 surpass most of the known MOF structures (including MOF-7, MOF-177 and HKUST1). On the other hand at room temperature the theoretical adsorption limit of these MOFs for both H 2 and CH 4 is rather moderate. [ABSTRACT FROM AUTHOR]

The viral dynamics have rarely been investigated in estuarine environments of India. The present study brings out a first hand information on the distribution of virus and bacteria in an eutrophic estuary (Cochin, India). Thirteen stations were selected for monthly monitoring of bacterial abundance (BA), total viable bacterial count (TVC), viral abundance (VA), chlorophyll a (Chl a) and other water quality parameters (temperature, salinity, pH, dissolved oxygen and inorganic nutrients such as NO-N, NH-N, PO-P and SiO-Si) for 1 year. There was significant variations in the VA [0.59-4.48 × 10viral like particles (VLPs) mL] and BA (0.49-8.12 × 10 cells mL) in the estuary. The variation in the viral to bacterial ratio (3-22) indicated marked seasonality. Statistical analysis showed bacteria as a major factor controlling the distribution of viruses (60 % variability) in Cochin estuary (CE). The viruses also showed positive correlations with Chl a, pH and salinity. The distribution of virus followed a distinct pattern of three different zones in the estuary controlled by salinity in zone I, Chl a in zone II and salinity, Chl a in zone III. The zonal distribution suggests that the factors that control the viral-host systems vary in different areas due to the complex hydrography of the estuary and environmental changes are very sensitive to the viral population in CE. [ABSTRACT FROM AUTHOR]

In the present work, results of upconversion emission in various powder samples have been discussed. The powder upconversion phosphors such as LaO:Er/Yb, LaF:Er/Yb, CeO:Er/Yb, CeF:Er/Yb were prepared and their upconversion emission, using 976 nm wavelength excitation, was investigated in depth. These phosphors have shown good upconversion emission in the visible region except for the CeF:Er/Yb phosphor. Two intense bands around 525 and 550 nm due to the H → I and S → I transitions, respectively, are found to be in a thermally coupled state in these samples. The intensity ratio of these two bands permitted us to estimate the temperature of the environment. The pump power studies of the emission bands of these samples are also made to understand the dynamics of the upconversion emission. [ABSTRACT FROM AUTHOR]

Measurement of densities ρ, viscosities η, and ultrasonic speeds u has been carried out for binary mixtures of N, N-diethylaniline ( N, N-DEA) with acetophenone, cyclopentanone, cyclohexanone (CH), and 2-methylcyclohexanone (Me-CH) and their pure liquids at (303.15 and 308.15) K. These experimental data have been used to calculate the excess molar volume V, deviation in ultrasonic velocity ∆ u, deviation in isentropic compressibility ∆ κ, and deviation in viscosity ∆ η. The variation of these properties with composition of the mixtures suggests dipole-dipole interactions and charge-transfer complex formation between N, N-diethylaniline and dipolar ketones. The magnitude of the property is found to depend on the chain length of the ketones' molecule. The viscosity data have been correlated using three equations: Grunberg and Nissan (Nature 164:799-800, ), Katti and Chaudhri (J Chem Eng Data 9:442-443, ), and Hind et al. (Trans Faraday Soc 56:328-330, ). These results have been fitted to the Redlich-Kister polynomial using multiparametric nonlinear regression analysis to estimate the binary coefficients and standard errors. [ABSTRACT FROM AUTHOR]

Abstract: LaF3:Er3+ phosphor is synthesized through chemical precipitation method and its upconversion (UC) emission studies have carried out using 532-nm excitation. Phosphor has shown two-photon absorption UV bands at the 325nm, 342nm, 383nm, 403nm and 411nm wavelengths. At relatively higher excitation powers multi-phonon assisted energy migration from 2H11/2 (4S3/2) level to the upper 4F3/2, 4F5/2 and 4F7/2 levels has observed and this energy migration opened new channel of emission at 440nm, 453nm and 488nm due to the 4F3/2 → 4I15/2, 4F5/2 → 4I15/2 and 4F7/2 → 4I15/2 transitions, respectively. Temperature dependent UC measurement is also done and observed emission pattern is correlated with the power dependence studies. Upconversion bands at 411 and 488nm wavelengths have shown reversal in intensity as either excitation power or sample temperature is increased and hence these two bands are found to act as optical switch. Planck blackbody like continuum emission has also observed at higher excitation powers. [Copyright &y& Elsevier]

Abstract: Pulse plating was employed to obtain Ni–W alloy nanodeposits from ammonical citrate bath. Effects of peak current density, pH, tungstate ion concentration and temperature on the cathodic current efficiency were studied. Ni-32.8 weight (wt)% of W alloy coating was obtained using optimized bath composition. Ni–W solid solution was found in the alloy deposit. Surface morphology studies revealed that the alloy surface was covered by long needle like crystals. XRD patterns of the electrodeposits showed only fcc (nickel) peaks. The hardness of the deposits obeyed Hall–Petch relation. Electrochemical polarization studies revealed that the corrosion potentials of nickel became nobler with W addition and corrosion current density values decreased. Electrochemical impedance studies found that, the increased charge transfer resistances suggesting decreased corrosion current density values. The capacitance values of the double layer decreased with W additions. [Copyright &y& Elsevier]

A green and efficient method for the preparation of α-hydroxyphosphonates (3a-n) in minutes of time with high yields is accomplished by grinding the mixture of various aldehydes (1a-n) and diethylphosphite (2) at room temperature under solvent free conditions in presence of piperazine as catalyst. [ABSTRACT FROM AUTHOR]

Abstract: Densities (ρ) and ultrasonic sound velocities (u) have been measured over the whole composition range for the binary mixtures of tetrahydrofuran (THF) with 1,2-dichlorobenzene (1,2-DCB), 1,3-dichlorobenzene (1,3-DCB), 1,2,4-trichlorobenzene (1,2,4-TCB), o-chlorotoluene (o-CT), m-chlorotoluene (m-CT), p-chlorotoluene (p-CT), o-nitrotoluene (o-NT) and m-nitrotoluene (m-NT) at 298.15K and atmospheric pressure. To gain some insight into the several aggregations of molecular interactions present in these mixed solvents, we determined the excess molar volume (V E) and the deviation in isentropic compressibilities (Δκ s) as a function of the concentration of THF from the measured ρ and u, respectively. The V E values have been correlated using Redlich–Kister and Hwang et al. equations. The V E data is completely positive over the entire mole fraction range in all the binary mixtures of THF with chlorobenzenes, chlorotoluenes and nitrotoluenes. The sound velocity data have been obtained in terms of free length theory (FLT) and collision factor theory (CFT). The Δκ s values have been correlated using Redlich–Kister equation. The values of Δκ s were negative over the entire composition range in all the binary mixtures under the same experimental conditions. The measured data were discussed on the basis of intermolecular interactions and structural effects between unlike molecules. Based on our V E data of THF+DCBs or TCB and THF+chlorotoluenes are compared with existing V E data of THF+chlorobenzene (CB) and THF+toluene (TE), respectively. [Copyright &y& Elsevier]

High-strength bulk ultrafine-grained magnesium alloy AZ31 bars were successfully developed in this study using multi-pass warm rolling. AZ31 bars of 12 mm diameter and several meters length were produced by multi-pass warm rolling of 45 ×45 mm forged blocks at 250°C and 300°C. The yield strength of warm-rolled rods doubled without any apparent loss of elongation. X-ray diffraction analysis revealed that the fractions of the basal planes oriented along and perpendicular to the rolling directions are nearly similar in intensity levels, indicating no strong texture along the rolling direction. The drastic improvement in mechanical properties is attributed to the ultrafine-grained microstructure in the warm-rolled specimens, whereas the absence of the loss of elongation is attributed to the fewer number of twins. [ABSTRACT FROM AUTHOR]

Abstract: Friction stir welding was carried out under different heat input and cooling rates to produce lap joints between high strength martensitic steel sheets. The microstructure of the welds was characterized, and microhardness was evaluated. Joint efficiency was determined by lap shear test. Variation in processing conditions governed total heat input, peak temperature and cooling rate during friction stir welding. Weld nugget microstructure depended principally on cooling rate. The slowest cooling rate promoted ferrite–pearlite and the fastest cooling rate resulted in martensite formation in the weld nugget. The weakest region of all the joints was the heat affected zone, which consists of ferrite with small quantities of pearlite. Fracture during shear testing occurred along the heat affected zone of welded joints. The width and grain size of ferrite in heat affected zone controlled the joint efficiency. [Copyright &y& Elsevier]

Abstract: Optical absorption and photoluminescent properties of Ho3+/Yb3+ co-doped tellurite and zinc tellurite glasses are investigated. The effect of zinc oxide as a modifier on the luminescence properties of above mentioned samples has been explored. Two intense upconversion emission bands centered at 546 (5F4 + 5S2 → 5I8) and 660nm (5F5 → 5I8) are observed on excitation with 976nm diode laser. Zinc oxide acts as a quencher for 976nm excited upconversion emission. The up and downconversion emission spectra are recorded with 532nm excitation source also. In this case zinc oxide improves the up and downconversion emissions. A large enhancement in upconversion intensity has been observed when Ho3+ ion is co-doped with Yb3+ ion. The dependence of upconversion intensities on excitation power and on temperature has also been studied. The power dependence study shows a quadratic dependence of the fluorescence intensity on the excitation power while a decrement in emission intensity of all the transitions at different rates with increase in temperature is observed in temperature dependence study. The possible mechanisms are also discussed in order to understand the upconversion and energy transfer processes. [Copyright &y& Elsevier]

Abstract: In the present study, collocated and simultaneous data on spectral aerosol optical depth (AOD), mass concentration and size distribution of near-surface composite aerosols and black carbon aerosol mass concentrations were obtained from Microtops-II Sunphotometer, Quartz Crystal Microbalance (QCM) and Aethalometer, respectively, over an urban location, Tirupati (India) in the month of May 2009. The mean AOD at 500nm and Ångström parameters (α, β) during this period were obtained as 0.64±0.13 and 0.89±0.24, 0.36±0.10, respectively. The total surface aerosol mass concentration varied from 13 to 60μgm−3 out of which coarse mode dominated by 39%. The mean value of total mass concentration of aerosols was 23.80±0.25μgm−3. The Ångström wavelength exponent (α) showed a positive correlation of 0.60 with the near-surface fine-mode fraction. The total mass concentration showed positive and negative correlations of 0.72 and 0.68 with air temperature and relative humidity, respectively. Along with this, the diurnal variation of black carbon aerosol concentration varied from 2 to 14μgm−3 and observed prominently a sharp fumigation peak at around 07:00–09:00h and the nocturnal peak between 20:00 and 22:00h with a low value in afternoon hours (15:00h) with a mean BC mass concentration of 3.76±0.23μgm−3. A scatter plot between BC mass concentration (M b ) and total surface mass concentration (M t ) showed significant positive correlation of 0.73 and was used to estimate mean mass fraction (F BC ) for the study period, which was found to be 8.1±0.5%. [Copyright &y& Elsevier]

The effect of pore morphology on the hydrogen-storage capacity of carbon materials at room temperature (298 K) has been studied using Grand Canonical Monte Carlo (GCMC) molecular simulation. Prototypical pore geometries such as slit pores and nanotubes were considered along with carbon foams and a random disordered carbon structure. Both physisorption and chemisorption models were considered in order to take into account the most favourable adsorption scenarios. Fluid-fluid and fluid-solid interactions were assumed to follow a Lennard-Jones-type potential.It was seen that physisorption alone cannot account for the adsorption of more than a few weight percentages, regardless of the pore morphology. Under physisorption conditions, the simulation results show that carbons with a slitshaped pore geometry are more efficient than other geometries at storing hydrogen, particularly at pore distances which allow the formation of fluid layers commensurate with the pore geometry. Slit pores appear to store a maximum of 1.77 wt% hydrogen by physisorption as opposed to carbon foams (1.48 wt%), carbons with a random structure (1.04 wt%) and carbon nanotubes (0.31 wt%). Simulation with hypothetical chemisorption models where the solid-fluid interaction is artificially enhanced showed that the storage capacity is higher in pore geometries with a larger accessible volume. Strong chemisorption gave loadings of up to 17 g/ℓ (1.5 wt%), 91 g/ℓ (13.8 wt%), 57.33 g/ℓ (9.6 wt%) and 42.94 g/ℓ (8.29 wt%) in nanotubes, foams, random structures and slit pores, respectively. Desorption is a problem in this scenario, as only ca. 1-3 wt% hydrogen can be delivered from these structures. Ultimately, the comparison of the different fluid-solid potentials revealed that if solid-fluid interactions could be enhanced beyond the classical dispersion, the more open structures could be ideal candidates for hydrogen-storage materials. [ABSTRACT FROM AUTHOR]

Barley genotypes with known field reactions to fusarium head blight (FHB) were evaluated for partial disease resistance (PDR) components using an in vitro detached leaf assay. The detached leaves were inoculated with Fusarium graminearum or F. culmorum and incubated at room (21 ± 2 °C) or low temperature (10 ± 1 °C). Both species were pathogenic and had a shorter incubation period and produced larger lesions at room temperature. Inoculation with F. culmorum produced less well-delineated necrotic lesions compared with those from inoculation using F. graminearum under both temperature regimes. On susceptible genotypes, inoculation with F. graminearum at room temperature resulted in significantly shorter latent and incubation periods, larger lesions and more macroconidial production compared with resistant genotypes. Inoculation with F. culmorum resulted in no significant differences in any PDR components measured. Several PDR components for F. graminearum, including latent period, lesion size and macroconidial production, were found to be significantly correlated. There was a negative correlation between incubation period and field ratings in one of three tests, latent period and field ratings in two of three tests, and a positive correlation between lesion size and field disease severity ratings for FHB only in one of three tests. Few PDR components for F. culmorum were found to be significantly correlated with each other. Overall, the best differentiation between resistant and susceptible barley genotypes resulted from inoculation with F. graminearum at room temperature, including a significant correlation between incubation and latent periods with field ratings. In general, given the variability observed, especially in relation to field ratings for FHB, measurement of PDR components cannot be routinely used to complement field-based ratings. However, the measurement of latent period did show promise as it was correlated to field ratings in two of three tests and as such measurement of latent period may be useful in identifying genotypes highly susceptible or resistant to FHB. Further research is required to evaluate the potential of using a detached leaf assay to complement field screening for FHB resistance. [ABSTRACT FROM AUTHOR]

Ni-Cu-Zn ferrite materials have been extensively used in multilayer chip inductors because of their remarkable properties at higher frequencies. In the present work, single phase Ni0.35Cu0.05Zn0.60Fe1.98O4-δ ferrite, has been prepared by microwave sintered (MS) method. In comparison with the conventional sintering method (CS), the sintering temperature and time for this MS method were significantly reduced to 30 min and 950°C from 5 h and 1250°C for the CS process. The frequency dependence of the dielectric properties such as dielectric constant (ε'), dielectric loss (tan δ) were studied. The temperature dependence of magnetic initial permeability (μi) was studied. The saturation magnetization was also studied as a function of magnetic field. These microwave sintered ferrites results were compared with the properties of ferrites prepared by conventional sintering method in normal heating. Microwave sintering improves structural as well as electromagnetic parameters measured and thus makes the ferrite more suitable in microwave applications and electromagnetic devices. [ABSTRACT FROM AUTHOR]

Abstract: Transparent and conducting indium tin oxide (ITO) thin films were deposited on glass substrates by reactive DC magnetron sputtering at room temperature. The effect of thickness (165–1175nm) on the physical (structural, optical, electrical) and photo catalytic properties of ITO thin films were investigated systematically. It is observed that with increasing thickness (i) the films turn from amorphous to polycrystalline with a preferential orientation along (440) direction, (ii) the average grain size and RMS roughness increases from 35nm to 100nm and 2.3nm to 8.6nm respectively, (iii) the optical band gap decreases from 3.65eV to 3.45eV and (iv) the relative density (calculated from the refractive index data) decreases. Four probe and Hall effect measurements show a low resistivity (4.5×10−4 Ωcm), mobility (26cm2/Vs) and high carrier concentration (5.3×1020 cm−3) values for film with a thickness 545nm. The work function of ITO films measured by Kelvin probe method varies with thickness. The photocatalytic activity (PCA) of ITO thin films was studied by the degradation of Rhodamine B in water; highest PCA is shown for the films of 545nm thickness. Present work shows that the ITO is a promising photocatalytic material for the degradation of organic compounds. [ABSTRACT FROM AUTHOR]

Abstract: Batch experiments were carried out to study the effect of Hodag CB6, a non-ionic surfactant, on the growth kinetics of sucrose crystals as a function of supersaturation, impurity concentration and temperature. The growth promoting effect of the added impurity, studied using a recently introduced spiral nucleation model (SNM), was due to the decrease in the surface free energy induced by the added surfactant. The growth process was influenced by both kinetic and thermodynamic effect, the latter being predominant. The coverage of impurity molecules on the sucrose surface followed a Henry type expression according to Langmuir isotherm at studied temperatures. In the case of a pure system, the total active kink density was found to be around 1016 kinks/m2. The active growth sites on the crystal surface were found to be two orders of magnitude lower than the total number of sucrose molecules. [Copyright &y& Elsevier]

Abstract: Single crystals of glycinium phosphite (GPI) were grown by isothermal evaporation and conventional temperature-lowering techniques. Single crystal and powder X-ray diffraction analysis confirm the monoclinic structure of the as grown crystals. The structural perfection of the as grown crystal was determined through HRXRD analysis. FTIR and Raman analysis revealed the functional groups present in the grown crystals. The optical absorption of the grown crystal was analyzed and the refractive index values for different wavelengths were measured by prism coupling technique. Thermal stability, melting temperature and phase transition temperature of the as grown crystals were identified from TGA/DSC analysis. The dielectric impedance analysis indicates the continuous phase transition nature of the grown crystals. The mechanical strength and hardening co-efficient were determined from Vicker''s microhardness measurements for different loads with constant dwell time. The growth mechanism and the defects were analyzed through chemical etching analysis from various crystallographic planes and etching periods. [Copyright &y& Elsevier]

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to ∼2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion + 2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context. [ABSTRACT FROM AUTHOR]

Abstract: Nafion N117 is a kind of polymer electrolyte membrane widely used as the ion exchange material in Ionic Polymer–Metal Composite (IPMC) actuators. The mechanical properties of N117 have a great effect on the performance of IPMC actuators. During the manufacturing of IPMC, the procedure includes heating/annealing, and soaking/drying. The membrane is very sensitive to temperature and humidity conditions, so we believe that returning to the initial conditions, irreversible variation of the mechanical properties has occurred during these treatments. This paper focuses on the effect of thermal and hygroscopic treatments on the mechanical responses of the Nafion N117 membrane. The results obtained from this study showed that no matter the thermal or hygroscopic treatments applied, it would decrease the elastic modulus and yielding stress. Furthermore, this decreasing was mainly showed in the intermolecular response. We also found the treated specimens regardless of thermal and hygroscopic treatments showed a sharp transition from elastic to plastic behavior. [Copyright &y& Elsevier]

Polyvinyl alcohol (PVA)-stabilised silver nanoparticles have been synthesised by the simple reduction process at different temperatures ranging from 60 to 90°C. The as-synthesised silver nanoparticles were analysed by X-ray diffraction (XRD), energy-dispersive analysis of X-rays, transmission electron microscope, UV-vis absorption spectroscopy and Fourier transform infrared (FTIR) spectroscopy. XRD studies showed that the samples exhibited cubic structure. The average particle size was found to be ∼50 nm. FTIR spectra revealed that the synthesised nanoparticles were successively capped by PVA. Optical absorption spectra confirmed the uniformity of as-prepared silver nanoparticles and the absorption peak was observed in the range 390-421 nm. [ABSTRACT FROM AUTHOR]

We report a novel observation pertaining to scaling behavior and near constant loss response in ion conducting polymer blends. This type of response evidenced by linear plot of conductivity spectrum at high frequency has rarely been reported for polymer blends. It is noted that at a fixed cation concentration in the polymer blends high frequency dielectric loss remains constant irrespective of temperature confirming near constant loss (NCL). However the onset of such response is prominent in sub-ambient temperature limit vis-à-vis ambient condition. It is also noted that low temperature NCL response depends on cation loading in the polymer blend matrix. These results, reported for the first time for an ion conducting polymer blend has been explained using Kramer–Kröinig (KK) and Haveriliak Negami (HN) equation. [ABSTRACT FROM AUTHOR]

Increasing demand and considerable attention to the non-conventional sources of starches leads to explore new sources. Starches of Dioscorea (Da 1 and Da 2 ) from Jharkhand, North Eastern region of India have been studied for its physicochemical properties. An attempt has been made to study the carboxymethylated derivatives of starches from two varieties of Dioscorea of this region. Different concentration of monochloroacetate was used to study the effect of degree of substitution (DS) on the physicochemical properties of starches. A considerable effect of DS was noticed on the ash content, amylose content, water-holding capacity, swelling and solubility power of carboxymethylated derivatives. Morphological studies showed the increase in the deformation of structure of the starch granule with an increase in the degree of substitution. FTIR confirmed the carboxymethylation reaction. TGA data of carboxymethylated starches revealed the stability to the temperature. Micromeritics of starch powder and granules showed the value which makes these starches to be utilized as an excipient. With the increase in DS, the % release of drug was found to be decreased. This further makes the carboxymethyl derivatives of Dioscorea a good source to be used as an excipient for sustained release formulations. [ABSTRACT FROM AUTHOR]

Abstract: Nanocrystalline ferrites of compositions Ni0.5+1.5x Cu0.3Zn0.2Fe2−x O4 (0≤ x ≤0.5) have been synthesized by using oxalate based precursor method at very low temperature. The Ni–Cu–Zn ferrite powder particles were obtained at 450°C and they exhibit a crystallite size of 16–24nm. The lattice constants were found nearly equal in all these samples due to minute difference in the ionic radius between Ni2+ and Fe3+ ions. The thermal analysis has showed the ferrite phase formation at very low temperature 377°C. The two main spectroscopic bands corresponding to lattice vibrations were observed in the wavelength range from 300 to 1000cm−1. The IR bands at 570cm−1 (v 1) and 390cm−1 (v 2) were assigned to tetrahedral (A) and octahedral [B] groups. The spectroscopic bands shift with the increase of doping concentration. The magnetization was found to decrease with increasing doping concentration. The dielectric constant (ɛ′) and dielectric loss tangent (tan δ) decreased with increase of frequency. The dielectric constant and dielectric loss obtained for the nanocrystalline ferrite samples appeared to be lower than that of the ferrites prepared by other synthesis techniques. [Copyright &y& Elsevier]

Abstract: The investigation describes and analyses the ballistic impact behavior of a high strength armour steel and Al-7017 alloy under 7.62mm deformable projectiles at a velocity of 830±10m/s at normal angle of attack. The high strength armour steel is subjected to two different heat treatments to see the effect of different mechanical properties on the ballistic behavior. The ballistic result of the Al-7017 alloy is compared with that of the steel. Some observations relating to the adiabatic shear bands formation have also been presented. Experimental results showed that among the investigated materials, the best ballistic performance was attained with the armour steel at 910°C austenitisation followed by 200°C tempering condition. [Copyright &y& Elsevier]

Abstract: The ytterbium ions doped MO-Al2O3 (M=Ca, Sr and Ba) phosphors have been synthesized through combustion technique and their up and down conversion fluorescence properties have been studied and compared. The samples were calcinated at different temperatures and their FTIR and XRD spectra have shown a close relationship. With 976nm excitation all these phosphors show cooperative upconversion emission at 488nm from the pairs of two Yb3+ ions along with an unexpected broad upconversion band in the blue green region and has been assigned to arise from the defect centers. Contrary to this upconversion emission, calcium aluminate phosphor exhibits bright and very broad down-conversion fluorescence (FWHM≈160nm) upon UV (266nm) excitation due to Yb2+ ions. The inter-conversion between the 3+ and 2+ valence states of Yb ion has been observed on calcinations of samples in open atmosphere and has been correlated to the emission properties. The Yb2+ ions containing calcium aluminate phosphor has been found suitable for producing broad band light in the visible region (white light). Lifetime of the emitting states of Yb3+ and Yb2+ ions have also been measured and discussed. [Copyright &y& Elsevier]

This report reveals the room temperature magnetodielectric effect of polycrystalline BiFe 0.8 Mn 0.2 O 3 ceramics. Structural analysis shows that the additional phases of BiFe 0.8 Mn 0.2 O 3 are suppressed and compared with bare BiFeO 3. The difference in dissociation energies between Mn–O and Bi–O bonds traps the motion of oxygen ions and reduces the grain size of BiFe 0.8 Mn 0.2 O 3. Mn-doped BiFeO 3 samples exhibit a weak ferromagnetic response because of the effect of Mn in the Fe site which uncurls the spiral spin ordering by altering the canting angle. Additionally, Bi vacancies give rise to charge compensating oxidation of Mn3+/ Mn4+ which causes the ferromagnetic weaker. BiFe 0.8 Mn 0.2 O 3 shows an improved dielectric permittivity compared to BiFe 0.9 Mn 0.1 O 3 and BiFeO 3 respectively. The magnetodielectric coupling coefficient of BiFe 0.8 Mn 0.2 O 3 ceramic at 6 kOe and 1 MHz is determined to be 4.64%. ∙ We report on the room temperature magnetodielectric effect of polycrystalline BiFe0.8Mn0.2FeO3 ceramics. ∙ The variation in tilt angle affects the spiral spin ordering and alter the canting angle as revealed from magnetization studies. ∙ The magnetization, dielectric polarization and hence magnetodielectric effect are significantly improved in BiFe0.8Mn0.2FeO3 than in BiFe0.9Mn0.1FeO3 and host BiFeO3. [ABSTRACT FROM AUTHOR]

Abstract: We report the study of nonequilibrium magnetic behavior of air stable zero valent iron nanoparticles synthesized in presence of N-cetyl-N,N,N-trimethyl ammonium bromide chelating agent. X-ray photoelectron spectroscopy study has suggested the presence of iron oxides on nZVI surfaces. Zero-field-cooled and field-cooled magnetization measurements have been carried out at 20–300K and 100Oe. For field-cooled measurements with 1h stops at 200, 100 and 50K when compared with the warming cycle, we found the signature of magnetic memory effect. A study of magnetic relaxation at the same temperatures shows the existence of two relaxation times. [Copyright &y& Elsevier]

Pure magnesium sheet with a grain size of 45 μm was produced by hot rolling and annealing at 350 °C for 1 h. The effect of strain rate (10−2 s−1, 10−1 s−1 and 103 s−1) and test temperature (25 °C, 100 °C and 300 °C) on work hardening behavior of annealed magnesium was investigated. With increase in strain rate, work hardening rate increases significantly at all temperatures. With increase in test temperature, work hardening rate showed a transition from twin to dislocation controlled plasticity. Under high strain rate test conditions an increase in flow stress was noticed with an increase in test temperature during initial strain regime up to the onset of flow softening. This is attributed to strain rate and temperature dependent contribution of twin induced texture change and subsequent dislocation activity. A physics based model to describe strain rate and temperature dependent flow behavior is discussed. [ABSTRACT FROM AUTHOR]

The present study examines the effect of annealing temperature on the structural, electronic and magnetic properties of Co-doped TiO 2 (TCO) nanoparticles (NPs) synthesized by the sol-gel method. X-ray powder diffractograms of TCO NPs annealed at 400, 600 and 800 °C exhibited the monophasic anatase, diphase (anatase and rutile) and monophasic rutile structures respectively. A morphological investigation using high-resolution scanning electron microscopy (HR-SEM) reveals the presence of nanoparticles with diameters ranging from ∼11 to ∼51 nm. The widening and shifting of the most intense E g peak in Raman studies and SEM images of TCO NPs suggest Co incorporation in the TiO 2 matrix and the formation of oxygen vacancies. Magnetic measurements of TCO at room temperature demonstrate ferromagnetic behaviour which is caused by the existence of oxygen vacancies and the doped Co content. Element specific technique, soft X-ray magnetic circular dichroism (XMCD) was used to study the magnetism in Co doped TiO 2 samples. The estimated total magnetic moment by XMCD was in the range of ∼1.3 ± 0.1–2.3 ± 0.2 μ B /Co. This huge magnetization was first time observed by the surface-sensitive Total Electron Yield (TEY) mode. The estimated saturation magnetic moment is in the range of 1.0–1.5 μ B /Co, also consistent with XMCD analysis and cluster model calculation. The results obtained by XMCD recommend an intrinsic behaviour of ferromagnetism. The X-ray absorption spectra (XAS) of Co-doped TiO 2 nanoparticles at Ti L 2,3 and Co L 2,3 -edge in TEY mode concludes that the valence states of Co and Ti ions are in 2 + and 4 + respectively. Cluster model calculation also confirmed that Co ions are in a 2 + valence state with D 2 h high spin crystal-field symmetry at the surface while a random crystal field symmetry in bulk has been observed which is well consistent with experimental data. [Display omitted] • XRD of TCO NPs annealed at 400, 600 and 800°C exhibited the anatase, mix and rutile structures respectively. • The widening and shifting of the E g peak in Raman studies of TCO NPs suggest the formation of oxygen vacancies. • Magnetization of TCO at RT demonstrate FM behaviour, caused by the existence of oxygen vacancies and the doped Co content. • The estimated Ms is in the range of 1.0–1.5 μ B /Co, also consistent with the XMCD and cluster model calculation. • The results obtained by XMCD recommend an intrinsic behaviour of ferromagnetism. • The XAS of TCO NPs at Ti and Co L 2,3 -edge in TEY concludes that Co and Ti ions are in 2 + and 4 + valence states. [ABSTRACT FROM AUTHOR]

Abstract: Excess volumes (VE), isentropic compressibilities (κs) and excess isentropic compressibilities (κs E) for the binary mixtures of {1,2-dichlorobenzene, 1,3-dichlorobenzene and 1,2,4-trichlorobenzene with 1-nonanol} at temperature range from 298.15 to 308.15K and at atmospheric pressure were derived from experimental density (ρ) and ultrasonic speed (u) data. The measured excess properties were correlated with the Redlich–Kister Polynomial equation. The calculated excess properties were discussed in terms of molecular interactions between dichloro/trichlorobenzenes and 1-nonanol molecules. Furthermore, the measured data were also analyzed with Fourier transform infrared (FT-IR) spectroscopy since FT-IR is a powerful tool to get information regarding the existence of molecular interactions between component molecules. [Copyright &y& Elsevier]

Abstract: Single-walled carbon nanotubes (SWCNTs) were covalently functionalized with anthracene in molten urea by a green chemical approach. The anthracene functionalized single-walled carbon nanotubes (Ant-f-SWCNTs) were examined along with SWCNTs, using Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy, powder X-Ray diffraction (XRD), and scanning, and transmission electron microscopy. The observations revealed the functionalization of SWCNTs by anthracene. The temperature dependent magnetization (300–5 K) and electrical resistivity were also measured for both SWCNTs and Ant-f-SWCNTs. The electrical resistivity of Ant-f-SWCNTs at 300 K was found to be 1.27 KΩm, which is much lower than 388.55 KΩm for pristine. This indicated a 300 fold increase in conductivity at room temperature for Ant-f-SWCNTs when compared to SWCNTs. The temperature dependence of the conductivity provided an indication of the semiconducting behaviour. [Copyright &y& Elsevier]

Bismuth doped tin sulfide (SnS:Bi) thin films were deposited onto glass substrates by the spray pyrolysis technique at the substrate temperature of 350°C. The effect of doping concentration [Bi/Sn] on their structural, optical and electrical properties was investigated as a function of bismuth doping between 0 and 8at%. The XRD results showed that the films were polycrystalline SnS with orthorhombic structure and the crystallites in the films were oriented along (111) direction. Atomic force microscopy revealed that the particle size and surface roughness of the films increased due to Bi-doping. Optical analysis exhibited the band gap value of 1.40eV for SnS:Bi (6at%) which was lower than the band gap value for 0at% of Bi (1.60eV). The film has low resistivity of 4.788×10−1 Ω-cm and higher carrier concentration of 3.625×1018 cm−3 was obtained at a doping ratio of 6at%. [ABSTRACT FROM AUTHOR]

Abstract: The present study describes the effect of heat treatment on mechanical properties and ballistic impact resistance of Ti–6Al–4V alloy against 7.62mm deformable lead projectiles. As-received plates were solution treated above and below the β-transus temperature followed by aging. The plates that were solution treated below the β-transus temperature followed by aging exhibited good combination of strength and ductility, and better ballistic impact resistance. Post ballistic microstructural examination showed formation of adiabatic shear bands (ASBs) and adiabatic shear band induced cracks. Both as-received plates and the plates that were solution treated above β-transus temperature followed by aging showed higher number of ASBs and ASB induced cracks compared to plates that were solution treated below β-transus temperature and then aged. Plug formation was observed through the ASB induced shear localization in planes parallel to the direction of projectile impact in all the conditions. [Copyright &y& Elsevier]

Abstract: We report the effects of the thermal annealing and dopant concentration on the optical properties of Se or S-doped hydrogenated amorphous silicon thin films. The Se and S-doped a-Si:H (a-Si,Se:H and a-Si,S:H) thin films were prepared by glow discharge plasma enhanced chemical vapor deposition (GD-PECVD) on 7059 corning glass. The films were subsequently annealed in vacuum in the temperature range from 100 to 500°C. Influence of doping and annealing was examined by means of optical transmission spectroscopy of the films in the wavelength range of 300–1100nm taken at room temperature. The absorption coefficients and refractive indices decreased as the annealing temperature increased from 100 to 300°C and then increased again as the annealing temperature further increased to 500°C, while the highest bandgap was observed at 300°C for all of the samples. For a given dopant concentration bandgap was observed to be higher in a-Si,S:H than a-Si,Se:H thin films. [ABSTRACT FROM AUTHOR]

Abstract: The low temperature microwave sintered NiCuZn and MgCuZn ferrites with compositions Ni0.35Cu0.05Zn0.60Fe2O4 and Mg0.35Cu0.05Zn0.60Fe2O4 were synthesized by conventional mixed oxide method. NiCuZn and MgCuZn ferrite samples obtained showed better sintered densities at 950 and 900°C, respectively. The scanning electron micrographs of both the ferrite samples appear to be very much similar. The magnitude of initial permeability of MgCuZn ferrite samples is found to be obviously higher than those of NiCuZn ferrite samples at all sintering temperatures. This is mainly due to the fact that MgCuZn ferrite has smaller magnetocrystalline anisotropy constant and magnetostrictive constant. NiCuZn ferrites have higher saturation magnetization than MgCuZn ferrites, which is due to the higher magnetic moment of NiCuZn ferrites. Our results indicate that the microwave sintering method seems to be a potential technique in the MLCI technology. [Copyright &y& Elsevier]