Search

Trans-splicing of a spliced leader (SL) to the 5' ends of mRNAs is used to produce mature mRNAs in several phyla of great importance to human health and the marine ecosystem. One of the consequences of the addition of SL sequences is the change or disruption of the open reading frames (ORFs) in the recipient transcripts. Given that most SL sequences have one or more of the trinucleotide NUG, including AUG in flatworms, trans-splicing of SL sequences can potentially supply a start codon to create new ORFs, which we refer to as slORFs, in the recipient mRNAs. Due to the lack of a tool to precisely detect them, slORFs were usually neglected in previous studies. In this work, we present the tool slORFfinder, which automatically links the SL sequences to the recipient mRNAs at the trans-splicing sites identified from SL-containing reads of RNA-Seq and predicts slORFs according to the distribution of ribosome-protected footprints (RPFs) on the trans-spliced transcripts. By applying this tool to the analyses of nematodes, ascidians and euglena, whose RPFs are publicly available, we find wide existence of slORFs in these taxa. Furthermore, we find that slORFs are generally translated at higher levels than the annotated ORFs in the genomes, suggesting they might have important functions. Overall, this study provides a tool, slORFfinder (https://github.com/songbo446/slORFfinder), to identify slORFs, which can enhance our understanding of ORFs in taxa with SL machinery., (© The Author(s) 2023. Published by Oxford University Press.)

Dietary restriction usually suppresses biosynthesis but activates catabolic pathways in animals. However, the short-term starvation enhances biosynthetic activities and promotes ribosomal biogenesis in adult Caenorhabditis elegans. The mechanism underlying the processes remains largely unknown. Here, we find that the short-term starvation enhances the SL1 trans-splicing of translation-related genes in adult C. elegans by transcriptome analysis. The small nuclear RNA-activating protein complex (SNAPc) promotes SL RNA production and mediates starvation-induced trans-splicing. TOFU-5, a core factor in the upstream sequence transcription complex (USTC) essential for piRNA production, is also involved in the starvation-induced trans-splicing processes. Knocking down components of the SNAPc complex and tofu-5 extends worm survival under starvation conditions. Taken together, our study highlights the importance of SL trans-splicing in the nutrition response and reveals a mechanism of the survival regulation by food deprivation via SNAPc and TOFU-5., (Copyright © 2022 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.)

Spliced leader trans-splicing is essential for gene expression in many eukaryotes. To elucidate the molecular mechanism of this process, we characterise the molecules associated with the Caenorhabditis elegans major spliced leader snRNP (SL1 snRNP), which donates the spliced leader that replaces the 5' untranslated region of most pre-mRNAs. Using a GFP-tagged version of the SL1 snRNP protein SNA-1 created by CRISPR-mediated genome engineering, we immunoprecipitate and identify RNAs and protein components by RIP-Seq and mass spectrometry. This reveals the composition of the SL1 snRNP and identifies associations with spliceosome components PRP-8 and PRP-19. Significantly, we identify a novel, nematode-specific protein required for SL1 trans-splicing, which we designate SNA-3. SNA-3 is an essential, nuclear protein with three NADAR domains whose function is unknown. Mutation of key residues in NADAR domains inactivates the protein, indicating that domain function is required for activity. SNA-3 interacts with the CBC-ARS2 complex and other factors involved in RNA metabolism, including SUT-1 protein, through RNA or protein-mediated contacts revealed by yeast two-hybrid assays, localisation studies and immunoprecipitations. Our data are compatible with a role for SNA-3 in coordinating trans-splicing with target pre-mRNA transcription or in the processing of the Y-branch product of the trans-splicing reaction., (© The Author(s) 2022. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Background: Spliced leader (SL) trans-splicing replaces the 5' end of pre-mRNAs with the spliced leader, an exon derived from a specialised non-coding RNA originating from elsewhere in the genome. This process is essential for resolving polycistronic pre-mRNAs produced by eukaryotic operons into monocistronic transcripts. SL trans-splicing and operons may have independently evolved multiple times throughout Eukarya, yet our understanding of these phenomena is limited to only a few well-characterised organisms, most notably C. elegans and trypanosomes. The primary barrier to systematic discovery and characterisation of SL trans-splicing and operons is the lack of computational tools for exploiting the surge of transcriptomic and genomic resources for a wide range of eukaryotes., Results: Here we present two novel pipelines that automate the discovery of SLs and the prediction of operons in eukaryotic genomes from RNA-Seq data. SLIDR assembles putative SLs from 5' read tails present after read alignment to a reference genome or transcriptome, which are then verified by interrogating corresponding SL RNA genes for sequence motifs expected in bona fide SL RNA molecules. SLOPPR identifies RNA-Seq reads that contain a given 5' SL sequence, quantifies genome-wide SL trans-splicing events and predicts operons via distinct patterns of SL trans-splicing events across adjacent genes. We tested both pipelines with organisms known to carry out SL trans-splicing and organise their genes into operons, and demonstrate that (1) SLIDR correctly detects expected SLs and often discovers novel SL variants; (2) SLOPPR correctly identifies functionally specialised SLs, correctly predicts known operons and detects plausible novel operons., Conclusions: SLIDR and SLOPPR are flexible tools that will accelerate research into the evolutionary dynamics of SL trans-splicing and operons throughout Eukarya and improve gene discovery and annotation for a wide range of eukaryotic genomes. Both pipelines are implemented in Bash and R and are built upon readily available software commonly installed on most bioinformatics servers. Biological insight can be gleaned even from sparse, low-coverage datasets, implying that an untapped wealth of information can be retrieved from existing RNA-Seq datasets as well as from novel full-isoform sequencing protocols as they become more widely available.

Spliced leader trans -splicing is essential for the processing and translation of polycistronic RNAs generated by eukaryotic operons. In C. elegans , a specialized spliced leader, SL2, provides the 5' end for uncapped pre-mRNAs derived from polycistronic RNAs. Studies of other nematodes suggested that SL2-type trans -splicing is a relatively recent innovation, confined to Rhabditina, the clade containing C. elegans and its close relatives. Here we conduct a survey of transcriptome-wide spliced leader trans -splicing in Trichinella spiralis , a distant relative of C. elegans with a particularly diverse repertoire of 15 spliced leaders. By systematically comparing the genomic context of trans -splicing events for each spliced leader, we identified a subset of T. spiralis spliced leaders that are specifically used to process polycistronic RNAs-the first examples of SL2-type spliced leaders outside of Rhabditina. These T. spiralis spliced leader RNAs possess a perfectly conserved stem-loop motif previously shown to be essential for SL2-type trans -splicing in C. elegans We show that genes trans -spliced to these SL2-type spliced leaders are organized in operonic fashion, with short intercistronic distances. A subset of T. spiralis operons show conservation of synteny with C. elegans operons. Our work substantially revises our understanding of nematode spliced leader trans -splicing, showing that SL2 trans -splicing is a major mechanism for nematode polycistronic RNA processing, which may have evolved prior to the radiation of the Nematoda. This work has important implications for the improvement of genome annotation pipelines in nematodes and other eukaryotes with operonic gene organization., (© 2020 Wenzel et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.)

Infections with parasitic nematodes are among the most significant of the neglected tropical diseases affecting about a billion people living mainly in tropical regions with low economic activity. The most effective current strategy to control nematode infections involves large scale treatment programs with anthelmintic drugs. This strategy is at risk from the emergence of drug resistant parasites. Parasitic nematodes also affect livestock, which are treated with the same limited group of anthelmintic drugs. Livestock parasites resistant to single drugs, and even multi-drug resistant parasites, are appearing in many areas. There is therefore a pressing need for new anthelmintic drugs. Here we use the nematode Caenorhabditis elegans as a model for parasitic nematodes and demonstrate that sinefungin, a competitive inhibitor of methyltransferases, causes a delay in development and reduced fecundity, and inhibits spliced leader trans-splicing. Spliced leader trans-splicing is an essential step in gene expression that does not occur in the hosts of parasitic nematodes, and is therefore a potential target for new anthelmintic drugs. We have exploited the ability of sinefungin to inhibit spliced leader trans-splicing to adapt a green fluorescent protein based reporter gene assay that monitors spliced leader trans-splicing for high-throughput screening for new anthelmintic compounds. We have established a protocol for robust high-throughput screening, combining mechanical dispensing of living C. elegans into 384- or 1536- well plates with addition of compounds using an acoustic liquid dispenser, and the detection of the inhibition of SL trans-splicing using a microplate reader. We have tested this protocol in a first pilot screen and envisage that this assay will be a valuable tool in the search for new anthelmintic drugs., (Copyright © 2019 The Authors. Published by Elsevier Ltd.. All rights reserved.)

We analyzed the compositional changes and the stable base pairs in the predicted secondary structure of the 5' UTR calmodulin mRNA in T. cruzi. The three copies of calmodulin in T. cruzi genome display variable position of the trans splicing sites and give rise to several mRNA that differs slightly on 5' UTR composition in the epimastigote stage. We show that the pattern of high probability base pairs in the minimum free energy predicted secondary structures of the calmodulin 5' UTR remains unchanged despite the nucleotide composition variation. However, the 39 nt spliced leader (mini-exon, the 5' exon sequence transferred to trypanosome mRNAs by the mechanism of trans splicing) shows a variable pattern of high and low probability base pairing as consequence of the altered composition of the 5' UTR.

Paulinella micropora is a rhizarian thecate amoeba, belonging to a photosynthetic Paulinella species group that has a unique organelle termed chromatophore, whose cyanobacterial origin is distinct from that of plant and algal chloroplasts. Because acquisition of the chromatophore was quite a recent event compared with that of the chloroplast ancestor, the Paulinella species are thought to be model organisms for studying the early process of primary endosymbiosis. To obtain insight into how endosymbiotically transferred genes acquire expression competence in the host nucleus, here we analyzed the 5' end sequences of the mRNAs of P. micropora MYN1 strain with the aid of a cap-trapper cDNA library. As a result, we found that mRNAs of 27 genes, including endosymbiotically transferred genes, possessed the common 5' end sequence of 28-33 bases that were posttranscriptionally added by spliced leader (SL) trans-splicing. We also found two subtypes of SL RNA genes encoded by the P. micropora MYN1 genome. Differing from the other SL trans-splicing organisms that usually possess poly(A)-less SL RNAs, this amoeba has polyadenylated SL RNAs. In this study, we characterize the SL trans-splicing of this unique organism and discuss the putative merits of SL trans-splicing in functional gene transfer and genome evolution., Competing Interests: The authors have declared that no competing interests exist.

Spliced leader dependent trans-splicing (SLTS) has been described as an important RNA regulatory process that occurs in different organisms, including the trematode Schistosoma mansoni. We identified more than seven thousand putative SLTS sites in the parasite, comprising genes with a wide spectrum of functional classes, which underlines the SLTS as a ubiquitous mechanism in the parasite. Also, SLTS gene expression levels span several orders of magnitude, showing that SLTS frequency is not determined by the expression level of the target gene, but by the presence of particular gene features facilitating or hindering the trans-splicing mechanism. Our in-depth investigation of SLTS events demonstrates widespread alternative trans-splicing (ATS) acceptor sites occurring in different regions along the entire gene body, highlighting another important role of SLTS generating alternative RNA isoforms in the parasite, besides the polycistron resolution. Particularly for introns where SLTS directly competes for the same acceptor substrate with cis-splicing, we identified for the first time additional and important features that might determine the type of splicing. Our study substantially extends the current knowledge of RNA processing by SLTS in S. mansoni, and provide basis for future studies on the trans-splicing mechanism in other eukaryotes.

Spliced leader (SL) trans-splicing is a critical element of gene expression in a number of eukaryotic groups. This process is arguably best understood in nematodes, where biochemical and molecular studies in Caenorhabditis elegans and Ascaris suum have identified key steps and factors involved. Despite this, the precise details of SL trans-splicing have yet to be elucidated. In part, this is because the systematic identification of the molecules involved has not previously been possible due to the lack of a specific phenotype associated with defects in this process. We present here a novel GFP-based reporter assay that can monitor SL1 trans-splicing in living C. elegans. Using this assay, we have identified mutants in sna-1 that are defective in SL trans-splicing, and demonstrate that reducing function of SNA-1, SNA-2 and SUT-1, proteins that associate with SL1 RNA and related SmY RNAs, impairs SL trans-splicing. We further demonstrate that the Sm proteins and pICln, SMN and Gemin5, which are involved in small nuclear ribonucleoprotein assembly, have an important role in SL trans-splicing. Taken together these results provide the first in vivo evidence for proteins involved in SL trans-splicing, and indicate that continuous replacement of SL ribonucleoproteins consumed during trans-splicing reactions is essential for effective trans-splicing., (© The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Trans-splicing is a process by which 5'- and 3'-ends of two pre-RNA molecules transcribed from different sites of the genome can be joined together to form a single RNA molecule. The spliced leader (SL) trans-splicing is mediated by the spliceosome and it allows the replacement of 5'-end of pre-mRNA by 5'(SL)-end of SL-RNA. This form of splicing has been observed in many phylogenetically unrelated eukaryotes. Either the SL trans-splicing (SLTS) originated in the last eukaryotic common ancestor (LECA) (or even earlier) and it was lost in most eukaryotic lineages, or this mechanism of RNA processing evolved several times independently in various unrelated eukaryotic taxa. The bioinformatic comparisons of SL-RNAs from various eukaryotic taxonomic groups have revealed the similarities of secondary structures of most SL-RNAs and a relative conservation of their splice sites (SSs) and Sm-binding sites (SmBSs). We propose that such structural and functional similarities of SL-RNAs are unlikely to have evolved repeatedly many times. Hence, we favor the scenario of an early evolutionary origin for the SLTS and multiple losses of SL-RNAs in various eukaryotic lineages.

Spliced leader trans-splicing (SLTS) is a poorly understood mechanism that is found in a diversity of eukaryotic lineages. In SLTS, a short RNA sequence is added near the 5' ends of the transcripts of protein-coding genes by a modified spliceosomal reaction. Available data suggest that SLTS has evolved many times, and might be more likely to evolve in animals. That SLTS might be more likely to evolve in the context of the generally complex transcriptomes characteristic of animals suggests the possibility that SLTS functions in gene regulation or transcriptome diversification, however no general novel function for SLTS is known. Here, I report SLTS in a lineage of cellularly complex unicellular eukaryotes. Cryptomonads are a group of eukaryotic algae that acquired photosynthetic capacity by secondary endosymbiosis of a red alga, and that retain a reduced copy of the nucleus of the engulfed alga. I estimate that at least one-fifth of genes in the model cryptomonad Guillardia theta and its relative Hanusia phi undergo SLTS. I show that hundreds of genes in G. theta generate alternative transcripts by SLTS at alternative sites, however I find little evidence for alternative protein production by alternative SLTS splicing. Interestingly, I find no evidence for substantial operon structure in the G. theta genome, in contrast to previous findings in other lineages with SLTS. These results extend SLTS to another major group of eukaryotes, and heighten the mystery of the evolution of SLTS and its association with cellular and transcriptomic complexity., (© The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.)

The form of RNA processing known as SL trans-splicing involves the transfer of a short conserved sequence, the spliced leader (SL), from a noncoding SL RNA to the 5' ends of mRNA molecules. SL trans-splicing occurs in several animal taxa, including bdelloid rotifers (Rotifera, Bdelloidea). One striking feature of these aquatic microinvertebrates is the large proportion of foreign genes, i.e. those acquired by horizontal gene transfer from other organisms, in their genomes. However, whether such foreign genes behave similarly to native genes has not been tested in bdelloids or any other animal. We therefore used a combination of experimental and computational methods to examine whether transcripts of foreign genes in bdelloids were SL trans-spliced, like their native counterparts. We found that many foreign transcripts contain SLs, use similar splice acceptor sequences to native genes, and are able to undergo alternative trans-splicing. However, a significantly lower proportion of foreign mRNAs contains SL sequences than native transcripts. This demonstrates a novel functional difference between foreign and native genes in bdelloids and suggests that SL trans-splicing is not essential for the expression of foreign genes, but is acquired during their domestication., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Schistosomiasis is a major neglected tropical disease caused by trematodes from the genus Schistosoma. Because schistosomes exhibit a complex life cycle and numerous mechanisms for regulating gene expression, it is believed that spliced leader (SL) trans-splicing could play an important role in the biology of these parasites. The purpose of this study was to investigate the function of trans-splicing in Schistosoma mansoni through analysis of genes that may be regulated by this mechanism and via silencing SL-containing transcripts through RNA interference. Here, we report our analysis of SL transcript-enriched cDNA libraries from different S. mansoni life stages. Our results show that the trans-splicing mechanism is apparently not associated with specific genes, subcellular localisations or life stages. In cross-species comparisons, even though the sets of genes that are subject to SL trans-splicing regulation appear to differ between organisms, several commonly shared orthologues were observed. Knockdown of trans-spliced transcripts in sporocysts resulted in a systemic reduction of the expression levels of all tested trans-spliced transcripts; however, the only phenotypic effect observed was diminished larval size. Further studies involving the findings from this work will provide new insights into the role of trans-splicing in the biology of S. mansoni and other organisms. All Expressed Sequence Tags generated in this study were submitted to dbEST as five different libraries. The accessions for each library and for the individual sequences are as follows: (i) adult worms of mixed sexes (LIBEST_027999: JZ139310 - JZ139779), (ii) female adult worms (LIBEST_028000: JZ139780 - JZ140379), (iii) male adult worms (LIBEST_028001: JZ140380 - JZ141002), (iv) eggs (LIBEST_028002: JZ141003 - JZ141497) and (v) schistosomula (LIBEST_028003: JZ141498 - JZ141974).

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Cytochrome oxidase subunit 3 (Cox3) is a mitochondrion-encoded core membrane protein of complex IV of the mitochondrial respiratory chain, and consists of seven trans-membrane helices. Here we show that in diverse later-branching dinoflagellates, cox3 is consistently split into two exons in the mitochondrial genome between helices six and seven. Gene exons are transcribed as two discrete oligoadenylated precursor RNAs, and these are subsequently trans-spliced to form a complete coding mRNA. This trans-splicing is highly unusual in that some of the oligoadenylated tail is incorporated at the splice site, such that a short string of adenosines links the two coding exons. This feature is consistently represented in diverse dinoflagellates, however the number of adenosines added varies according to the size of the coding gap between the two exons. Thus we observed between zero (Amphidinium carterae) and 10 (Symbiodinium sp.) adenosines added in different taxa, but the final coding sequence length is identical with the reading frame maintained. Northern analyses show that precursor cox3 transcripts are approximately equally abundant as mature cox3 mRNAs, suggesting a slow or regulated maturation process. These data indicate that the splicing mechanism in dinoflagellate mitochondria is tolerant of variations in the length of the precursor coding sequence, and implicates the use of a splicing template, or guide molecule, during splicing that controls mature mRNA length.

The parasitic unicellular trypanosomatids are responsible for several fatal diseases in humans and livestock. Regarding their biochemistry and molecular biology, they possess a multitude of special features such as polycistronic transcription of protein-coding genes. The resulting long primary transcripts need to be processed by coupled trans-splicing and polyadenylation reactions, thereby generating mature mRNAs. Catalyzed by a large ribonucleoprotein complex termed the spliceosome, trans-splicing attaches a 39-nucleotide leader sequence, which is derived from the Spliced Leader (SL) RNA, to each protein-coding gene. Recent genome-wide studies demonstrated that alternative trans-splicing increases mRNA and protein diversity in these organisms. In this mini-review we give an overview of the current state of research on trans-splicing., (Copyright © 2012 Elsevier GmbH. All rights reserved.)

The addition of a capped mini-exon [spliced leader (SL)] through trans-splicing is essential for the maturation of RNA polymerase (pol) II-transcribed polycistronic pre-mRNAs in all members of the Trypanosomatidae family. This process is an inter-molecular splicing reaction that follows the same basic rules of cis-splicing reactions. In this study, we demonstrated that mini-exons were added to precursor ribosomal RNA (pre-rRNA) are transcribed by RNA pol I, including the 5' external transcribed spacer (ETS) region. Additionally, we detected the SL-5'ETS molecule using three distinct methods and located the acceptor site between two known 5'ETS rRNA processing sites (A' and A1) in four different trypanosomatids. Moreover, we detected a polyadenylated 5'ETS upstream of the trans-splicing acceptor site, which also occurs in pre-mRNA trans-splicing. After treatment with an indirect trans-splicing inhibitor (sinefungin), we observed SL-5'ETS decay. However, treatment with 5-fluorouracil (a precursor of RNA synthesis that inhibits the degradation of pre-rRNA) led to the accumulation of SL-5'ETS, suggesting that the molecule may play a role in rRNA degradation. The detection of trans-splicing in these molecules may indicate broad RNA-joining properties, regardless of the polymerase used for transcription.

Trans-splicing is the joining together of portions of two separate pre-mRNA molecules. The two distinct categories of spliceosomal trans-splicing are genic trans-splicing, which joins exons of different pre-mRNA transcripts, and spliced leader (SL) trans-splicing, which involves an exon donated from a specialized SL RNA. Both depend primarily on the same signals and components as cis-splicing. Genic trans-splicing events producing protein-coding mRNAs have been described in a variety of organisms, including Caenorhabditis elegans and Drosophila. In mammalian cells, genic trans-splicing can be associated with cancers and translocations. SL trans-splicing has mainly been studied in nematodes and trypanosomes, but there are now numerous and diverse phyla (including primitive chordates) where this type of trans-splicing has been detected. Such diversity raises questions as to the evolutionary origin of the process. Another intriguing question concerns the function of trans-splicing, as operon resolution can only account for a small proportion of the total amount of SL trans-splicing., (Copyright © 2011 John Wiley & Sons, Ltd.)

In trypanosomes, all RNAs are processed by the concerted action of trans-splicing and polyadenylation. In trans-splicing, a common spliced leader (SL) is donated to all mRNAs from a small RNA molecule, the SL RNA. This article summarizes recent findings in the field focusing on SL RNA transcription, cap modifications and pseudouridylation. The role(s) of these modifications for splicing and gene expression are discussed. The recruitment of SL RNA to the spliceosome depends on splicing factors and recent progress in identifying such factors is described. A recent major advance in understanding the role of trans-splicing in the trypanosome transcriptome was obtained by whole-genome mapping of the SL and polyadenylation sites, revealing surprising heterogeneity and suggesting that gene regulation, especially during cycling between the two hosts of the parasite, involves alternative trans-splicing. Finally, the SL silencing mechanism, which is harnessed by the parasite to control gene expression under stress, is discussed.

In Caenorhabditis elegans, the transcripts of many genes are trans-spliced to an SL1 spliced leader, a process that removes the RNA extending from the transcription start site to the trans-splice site, thereby making it difficult to determine the position of the promoter. Here we use RT-PCR to identify promoters of trans-spliced genes. Many genes in C. elegans are organized in operons where genes are closely clustered, typically separated by only ~100 nucleotides, and transcribed by an upstream promoter. The transcripts of downstream genes are trans-spliced to an SL2 spliced leader. The polycistronic precursor RNA is processed into individual transcripts by 3' end formation and trans-splicing. Although the SL2 spliced leader does not appear to be used for other gene arrangements, there is a relatively small number of genes whose transcripts are processed by SL2 but are not close to another gene in the same orientation. Although these genes do not appear to be members of classical C. elegans operons, we investigated whether these might represent unusual operons with long spacing or a different, nonoperon mechanism for specifying SL2 trans-splicing. We show transcription of the entire region between the SL2 trans-spliced gene and the next upstream gene, sometimes several kilobases distant, suggesting that these represent exceptional operons. We also report a second type of atypical "alternative" operon, in which 3' end formation and trans-splicing by SL2 occur within an intron. In this case, the processing sometimes results in a single transcript, and sometimes in two separate mRNAs.

Trans-splicing of one of two short leader RNAs, SL1 or SL2, occurs at the 5' ends of pre-mRNAs of many C. elegans genes. We have exploited RNA-sequencing data from the modENCODE project to analyze the transcriptome of C. elegans for patterns of trans-splicing. Transcripts of ∼70% of genes are trans-spliced, similar to earlier estimates based on analysis of far fewer genes. The mRNAs of most trans-spliced genes are spliced to either SL1 or SL2, but most genes are not trans-spliced to both, indicating that SL1 and SL2 trans-splicing use different underlying mechanisms. SL2 trans-splicing occurs in order to separate the products of genes in operons genome wide. Shorter intercistronic distance is associated with greater use of SL2. Finally, increased use of SL1 trans-splicing to downstream operon genes can indicate the presence of an extra promoter in the intercistronic region, creating what has been termed a "hybrid" operon. Within hybrid operons the presence of the two promoters results in the use of the two SL classes: Transcription that originates at the promoter upstream of another gene creates a polycistronic pre-mRNA that receives SL2, whereas transcription that originates at the internal promoter creates transcripts that receive SL1. Overall, our data demonstrate that >17% of all C. elegans genes are in operons.

Spliced leader trans-splicing occurs in many primitive eukaryotes including nematodes. Most of our knowledge of trans-splicing in nematodes stems from the model organism Caenorhabditis elegans and relatives, and from work with Ascaris. Our investigation of spliced leader trans-splicing in distantly related Dorylaimia nematodes indicates that spliced-leader trans-splicing arose before the nematode phylum and suggests that the spliced leader RNA gene complements in extant nematodes have evolved from a common ancestor with a diverse set of spliced leader RNA genes.

Spliced leader (SL) trans-splicing in Caenorhabditis elegans attaches a 22-nucleotide (nt) exon onto the 5' end of many mRNAs. A particular class of SL, SL2, splices mRNAs of downstream operon genes. Here we use an embryonic extract-based in vitro splicing system to show that SL2 specificity information is encoded within the polycistronic pre-mRNA, and that trans-splicing specificity is recapitulated in vitro. We define an RNA sequence required for SL2 trans-splicing, the U-rich (Ur) element, through mutational analysis and bioinformatics as a short stem-loop followed by a sequence motif, UAYYUU, located approximately 50 nt upstream of the trans-splice site. Furthermore, this element is predicted in intercistronic regions of numerous operons of C. elegans and other species that use SL2 trans-splicing. We propose that the UAYYUU motif hybridizes with the 5' splice site on the SL2 RNA to recruit the SL to the pre-mRNA. In this way, the UAYYUU motif in the pre-mRNA would serve an analogous function to the similar sequence in the U1 snRNA, which binds to the 5' splice site of introns, effectively reversing the roles of snRNP and pre-mRNA in trans-splicing.

Pre-mRNA 5' spliced-leader (SL) trans-splicing occurs in some metazoan groups but not in others. Genome-wide characterization of the trans-spliced mRNA subpopulation has not yet been reported for any metazoan. We carried out a high-throughput analysis of the SL trans-spliced mRNA population of the ascidian tunicate Ciona intestinalis by 454 Life Sciences (Roche) pyrosequencing of SL-PCR-amplified random-primed reverse transcripts of tailbud embryo RNA. We obtained approximately 250,000 high-quality reads corresponding to 8790 genes, approximately 58% of the Ciona total gene number. The great depth of this data revealed new aspects of trans-splicing, including the existence of a significant class of "infrequently trans-spliced" genes, accounting for approximately 28% of represented genes, that generate largely non-trans-spliced mRNAs, but also produce trans-spliced mRNAs, in part through alternative promoter use. Thus, the conventional qualitative dichotomy of trans-spliced versus non-trans-spliced genes should be supplanted by a more accurate quantitative view recognizing frequently and infrequently trans-spliced gene categories. Our data include reads representing approximately 80% of Ciona frequently trans-spliced genes. Our analysis also revealed significant use of closely spaced alternative trans-splice acceptor sites which further underscores the mechanistic similarity of cis- and trans-splicing and indicates that the prevalence of +/-3-nt alternative splicing events at tandem acceptor sites, NAGNAG, is driven by spliceosomal mechanisms, and not nonsense-mediated decay, or selection at the protein level. The breadth of gene representation data enabled us to find new correlations between trans-splicing status and gene function, namely the overrepresentation in the frequently trans-spliced gene class of genes associated with plasma/endomembrane system, Ca(2+) homeostasis, and actin cytoskeleton.

Replacement of mRNA 5' UTR sequences by short sequences trans-spliced from specialized, noncoding, spliced leader (SL) RNAs is an enigmatic phenomenon, occurring in a set of distantly related animal groups including urochordates, nematodes, flatworms, and hydra, as well as in Euglenozoa and dinoflagellates. Whether SL trans-splicing has a common evolutionary origin and biological function among different organisms remains unclear. We have undertaken a systematic identification of SL exons in cDNA sequence data sets from non-bilaterian metazoan species and their closest unicellular relatives. SL exons were identified in ctenophores and in hydrozoan cnidarians, but not in other cnidarians, placozoans, or sponges, or in animal unicellular relatives. Mapping of SL absence/presence obtained from this and previous studies onto current phylogenetic trees favors an evolutionary scenario involving multiple origins for SLs during eumetazoan evolution rather than loss from a common ancestor. In both ctenophore and hydrozoan species, multiple SL sequences were identified, showing high sequence diversity. Detailed analysis of a large data set generated for the hydrozoan Clytia hemisphaerica revealed trans-splicing of given mRNAs by multiple alternative SLs. No evidence was found for a common identity of trans-spliced mRNAs between different hydrozoans. One feature found specifically to characterize SL-spliced mRNAs in hydrozoans, however, was a marked adenosine enrichment immediately 3' of the SL acceptor splice site. Our findings of high sequence divergence and apparently indiscriminate use of SLs in hydrozoans, along with recent findings in other taxa, indicate that SL genes have evolved rapidly in parallel in diverse animal groups, with constraint on SL exon sequence evolution being apparently rare.

The trans-splicing of short spliced leader (SL) RNAs onto the 5' ends of mRNAs occurs in a diverse range of taxa. In nematodes, all species so far characterized utilize a characteristic, conserved spliced leader, SL1, as well as variants that are employed in the resolution of operons. Here we report the identification of spliced leader trans-splicing in the basal nematode Trichinella spiralis, and show that this nematode does not possess a canonical SL1, but rather has at least 15 distinct spliced leaders, encoded by at least 19 SL RNA genes. The individual spliced leaders vary in both size and primary sequence, showing a much higher degree of diversity compared to other known trans-spliced leaders. In a survey of T. spiralis mRNAs, individual mRNAs were found to be trans-spliced to a number of different spliced leader sequences. These data provide the first indication that the last common ancestor of the phylum Nematoda utilized spliced leader trans-splicing and that the canonical spliced leader, SL1, found in Caenorhabditis elegans, evolved after the divergence of the major nematode clades. This discovery sheds important light on the nature and evolution of mRNA processing in the Nematoda.

mRNA cap 1 2'-O-ribose methylation is a widespread modification that is implicated in processing, trafficking, and translational control in eukaryotic systems. The eukaryotic enzyme has yet to be identified. In kinetoplastid flagellates trans-splicing of spliced leader (SL) to polycistronic precursors conveys a hypermethylated cap 4, including a cap 0 m7G and seven additional methylations on the first 4 nucleotides, to all nuclear mRNAs. We report the first eukaryotic cap 1 2'-O-ribose methyltransferase, TbMTr1, a member of a conserved family of viral and eukaryotic enzymes. Recombinant TbMTr1 methylates the ribose of the first nucleotide of an m7G-capped substrate. Knockdowns and null mutants of TbMTr1 in Trypanosoma brucei grow normally, with loss of 2'-O-ribose methylation at cap 1 on substrate SL RNA and U1 small nuclear RNA. TbMTr1-null cells have an accumulation of cap 0 substrate without further methylation, while spliced mRNA is modified efficiently at position 4 in the absence of 2'-O-ribose methylation at position 1; downstream cap 4 methylations are independent of cap 1. Based on TbMTr1-green fluorescent protein localization, 2'-O-ribose methylation at position 1 occurs in the nucleus. Accumulation of 3'-extended SL RNA substrate indicates a delay in processing and suggests a synergistic role for cap 1 in maturation.

Spliced leader (SL) trans-splicing is a form of mRNA processing originally described in parasitic kinetoplastids. During this reaction, a short RNA sequence is transferred from the 5'-end of an SL transcript to a splice acceptor site on pre-mRNA molecules. Here we report numerous mRNAs from a dinoflagellate, Karenia brevis, which contain an identical leader sequence at their 5'-terminal end. Furthermore, we have isolated a gene from K. brevis encoding a putative SL RNA containing the conserved splice donor site immediately following the leader sequence. A 1,742-bp DNA fragment encoding a K. brevis 5S gene repeat was found to encode the SL RNA gene, as well as a U6 small nuclear RNA (snRNA) gene, and binding sites for the core components of the splicesome (Sm proteins) involved in RNA splicing. Therefore the K. brevis SL RNA appears to be in a genomic arrangement typical of SL genes in a number of species known to mature their mRNAs by trans-splicing. Additionally, we show that the SL gene exists as a stable snRNA and has a predicted secondary structure typical of SL RNAs. The data presented here support the hypothesis that an SL RNA is present in K. brevis and that maturation of a percentage of mRNAs in K. brevis occurs via a trans-splicing process in which a common SL sequence is added to the 5'-end of mature mRNAs. The occurrence of SL trans-splicing in a dinoflagellate extends the known phylogenetic range of this process.

Many mRNAs in Caenorhabditis elegans are generated through a trans-splicing reaction that adds one of two classes of spliced leader RNA to an independently transcribed pre-mRNA. SL1 leaders are spliced mostly to pre-mRNAs from genes with outrons, intron-like sequences at the 5'-ends of the pre-mRNAs. In contrast, SL2 leaders are nearly exclusively trans-spliced to genes that occur downstream in polycistronic pre-mRNAs produced from operons. Operon pre-mRNA processing requires separation into individual transcripts, which is accomplished by 3'-processing of upstream genes and spliced leader trans-splicing to the downstream genes. We used a novel computational analysis, based on nonnegative matrix factorization, to identify and characterize significant differences in the cis-acting sequence elements that differentiate various types of functional site, including internal versus terminal 3'-processing sites, and SL1 versus SL2 trans-splicing sites. We describe several key elements, including the U-rich (Ur) element that couples 3'-processing with SL2 trans-splicing, and a novel outron (Ou) element that occurs upstream of SL1 trans-splicing sites. Finally, we present models of the distinct classes of trans-splicing reaction, including SL1 trans-splicing at the outron, SL2 trans-splicing in standard operons, competitive SL1-SL2 trans-splicing in operons with large intergenic separation, and SL1 trans-splicing in SL1-type operons, which have no intergenic separation.

Spliced leader trans-splicing adds a short exon, the spliced leader (SL), to pre-mRNAs to generate 5' ends of mRNAs. Addition of the SL in metazoa also adds a new cap to the mRNA, a trimethylguanosine (m(3)(2,2,7)GpppN) (TMG) that replaces the typical eukaryotic monomethylguanosine (m7GpppN)(m7G) cap. Both trans-spliced (m3(2,2,7)GpppN-SL-RNA) and not trans-spliced (m7GpppN-RNA) mRNAs are present in the same cells. Previous studies using cell-free systems to compare the overall translation of trans-spliced versus non-trans-spliced RNAs led to different conclusions. Here, we examine the contribution of m3(2,2,7)GpppG-cap and SL sequence and other RNA elements to in vivo mRNA translation and stability in nematode embryos. Although 70-90% of all nematode mRNAs have a TMG-cap, the TMG cap does not support translation as well as an m7G-cap. However, when the TMG cap and SL are present together, they synergistically interact and translation is enhanced, indicating both trans-spliced elements are necessary to promote efficient translation. The SL by itself does not act as a cap-independent enhancer of translation. The poly(A)-tail synergistically interacts with the mRNA cap enhancing translation and plays a greater role in facilitating translation of TMG-SL mRNAs. In general, recipient mRNA sequences between the SL and AUG and the 3' UTR do not significantly contribute to the translation of trans-spliced mRNAs. Overall, the combination of TMG cap and SL contribute to mRNA translation and stability in a manner typical of a eukaryotic m7G-cap and 5' UTRs, but they do not differentially enhance mRNA translation or stability compared to RNAs without the trans-spliced elements.

The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage., Competing Interests: Competing interests. The authors have declared that no competing interests exist.

In the nematode Caenorhabditis elegans, up to 15% of the genes are organized in operons. Polycistronic precursor RNAs are processed by trans-splicing at the 5' ends of genes by adding a specific trans-spliced leader. Ten different spliced leaders are known in C. elegans that differ in sequence and abundance. The SL1 leader is most abundant and is spliced to the 5' ends of monocistronic genes and to upstream genes in operons. Trans-splicing is common among nematodes and was observed in the genera Panagrellus, Ascaris, Haemonchus, Anisakis, and Brugia. However, little is known about operons in nonrhabditid nematodes. Dolichorhabditis CEW1, another rhabditid nematode that is now called Oscheius CEW1, contains operons and SL2 trans-splicing. We have studied the presence of operons and trans-splicing in Pristionchus pacificus, a species of the Diplogastridae that has recently been developed as a satellite organism in evolutionary developmental biology. We provide evidence that P. pacificus contains operons and that downstream genes are trans-spliced to SL2. Surprisingly, the one operon analyzed so far in P. pacificus is not conserved in C. elegans, suggesting unexpected genomic plasticity.

Pre-messenger-RNA maturation in nematodes and in several other lower eukaryotic phyla involves spliced leader (SL) addition trans-splicing. In this unusual RNA processing reaction, a short common 5' exon, the SL, is affixed to the 5'-most exon of multiple pre-mRNAs. The nematode SL is derived from a trans-splicing-specific approximately 100-nucleotide RNA (SL RNA) that bears striking similarities to the cis-spliceosomal U small nuclear RNAs U1, U2, U4 and U5 (refs 3, 4); for example, the SL RNA functions only if it is assembled into an Sm small nuclear ribonucleoprotein (snRNP). Here we have purified and characterized the SL RNP and show that it contains two proteins (relative molecular masses 175,000 and 30,000 (M(r) 175K and 30K)) in addition to core Sm proteins. Immunodepletion and reconstitution with recombinant proteins demonstrates that both proteins are essential for SL trans-splicing; however, neither protein is required either for conventional cis-splicing or for bimolecular (trans-) splicing of fragmented cis constructs. The M(r) 175K and 30K SL RNP proteins are the first factors identified that are involved uniquely in SL trans-splicing. Several lines of evidence indicate that the SL RNP proteins function by participating in a trans-splicing specific network of protein protein interactions analogous to the U1 snRNP SF1/BBP U2AF complex that comprises the cross-intron bridge in cis-splicing.

Nuclear mRNAs in trypanosomatids are generated by trans-splicing. Although trans-splicing resembles cis-splicing in many ways and most of the U RNA participants have been characterized, relatively few involved proteins have been identified. Herein, we employed a yeast three-hybrid system to identify a protein, XB1, which binds to the Trypanosoma cruzi SL RNA. XB1 is a approximately 45 kDa protein which is homologous to the essential pre-mRNA-splicing factor PRP31p from Saccharomyces cerevisiae. Gel shift assays and UV cross-linking experiments with recombinant XB1 confirmed that this T. cruzi protein binds the SL RNA in vitro. The binding site of XB1 on the SL RNA was mapped to stem-loop II by deletion of the SL RNA 'bait' in the three-hybrid system. Finally, UV cross-linking SL RNA with S100 extract indicated native XB1 protein and SL RNA interaction in T. cruzi extract.

The protozoan parasite Trypanosoma brucei relies on trans-splicing to process its mRNAs. A novel nuclear serine/arginine (SR)-rich trypanosomal protein (TSR1) was characterized which contains two RNA recognition motifs. The TSR1 protein appears to be homologous to RNA-binding SR proteins of the cis-splicing machinery from higher eukaryotes. Moreover, in the yeast two-hybrid system, TSR1 is able to interact with the human splicing factors involved in the recognition of the 3' splicing site (U2AF35/U2AF65). In both procyclic and bloodstream forms of T. brucei, TSR1 was found to localize in the nucleus. In the bloodstream stage TSR1 showed the speckles pattern characteristic of SR proteins involved in cis-splicing. Moreover, TSR1 was able to specifically bind the spliced leader (SL) RNA involved in trans-splicing in trypanosomes by the yeast three-hybrid system. These and other observations suggest that TSR1 may be involved in trans-splicing in T. brucei.