Search

Your search keyword '"La Torre L"' showing total 6 results

Search Constraints

Start Over You searched for: Author "La Torre L" Remove constraint Author: "La Torre L" Region mexico Remove constraint Region: mexico
6 results on '"La Torre L"'

Search Results

1. Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

2. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

3. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2.

4. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2.

5. Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

6. 5' and 3' β-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

Catalog

Books, media, physical & digital resources