Search

Aims Next generation sequencing (NGS) technology has been widely used in monitoring and identifying microbiomes in sewage. We aimed to evaluate the ability of NGS analysis in directly detecting enterovirus (EV) in sewage and to understand the diversity of EVs circulated in the residents in Weishan Lake region. Methods and results Fourteen sewage samples were collected in Jining, Shandong Province, China from 2018 to 2019 and were parallelly investigated by the P1 amplicon-based NGS method and cell culture method. The results showed that 20 different serotypes belonging to species Enterovirus A (EV-A) (n  = 5), EV-B (n  = 13), and EV-C (n  = 2) were identified by NGS in the sewage concentrates, which exceeded the number of types detected by cell culture method (n  = 9). Echovirus 11 (E11), Coxsackievirus (CV) B5 and CVA9 were the most detected types in those sewage concentrates. Phylogenetic analysis revealed that E11 sequences obtained in this study belonged to genogroup D5 and had close genetic relationship with clinical sequences. Conclusions Various EV serotypes circulated in populations near Weishan Lake. The combination of NGS technology into environmental surveillance will greatly contribute to improving our knowledge about EV circulation patterns in the population. [ABSTRACT FROM AUTHOR]

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were 'TTAAAACAGCCTGTGGGTTGT' and 'ATTCTCCGCATTCGGTGCGG', respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. [ABSTRACT FROM AUTHOR]

Background: Human enteroviruses (HEVs) are common causes of acute meningitis. However, there is limited information about HEV associated with aseptic meningitis in mainland China because it has not been classified as a notifiable disease. Objectives: To characterize the HEVs associated with sporadic aseptic meningitis in China and to analyze their genetic features. Study Design: Cerebrospinal fluid, throat swab and feces specimens were collected from patients with aseptic meningitis in 5 sentinel hospitals in Shandong Province, China between 2006 and 2012. Virological investigation (viral isolation and molecular identification) and phylogenetic analysis were performed. Results: A total of 437 hospitalized patients were reported, and enteroviruses were detected in the specimens from 84 patients (19.2%) and were identified into 17 serotypes. The nine main serotypes were echovirus (E) 30 (27.4%), EV71 (13.1%), coxsackievirus (CV) B1 (9.5%), CVB3 (7.1%), CVB5 (7.1%), E6 (7.1%), E9 (7.1%), CVA9 (6.0%), and CVA10 (3.6%). Monthly distribution of isolated enteroviruses revealed a major peak in summer-fall season and a small second peak in winter constituted totally by EV71. Sequence analysis on VP1 coding region suggested Shandong strains had great genetic divergence with isolates from other countries. Conclusions: Multiple serotypes were responsible for enterovirus meningitis in mainland China. Aseptic meningitis caused by EV71 and coxsackie A viruses–the predominant pathogens for the hand, foot, and mouth disease–is currently an important concern in mainland China. [ABSTRACT FROM AUTHOR]

Environmental surveillance of poliovirus on sewage has been conducted in Shandong Province, China since 2008. A type 2 vaccine-derived poliovirus (VDPV) with 7 mutations in VP1 coding region was isolated from the sewage collected in the city of Jinan in December 2012. The complete genome sequencing analysis of this isolate revealed 25 nucleotide substitutions, 7 of which resulted in amino acid alteration. No evidence of recombination with other poliovirus serotypes was observed. The virus did not lose temperature sensitive phenotype at 40°C. An estimation based on the evolution rate of the P1 coding region suggested that evolution time of this strain might be 160–176 days. VP1 sequence analysis revealed that this VDPV strain is of no close relationship with other local type 2 polioviruses (n = 66) from sewage collected between May 2012 and June 2013, suggesting the lack of its circulation in the local population. The person who excreted the virus was not known and no closely related virus was isolated in local population via acute flaccid paralysis surveillance. By far this is the first report of VDPV isolated from sewage in China, and these results underscore the value of environmental surveillance in the polio surveillance system even in countries with high rates of OPV coverage. [ABSTRACT FROM AUTHOR]

Background: Kadipiro virus (KDV) belongs to the Reoviridae family, which consists of segmented, non-enveloped, double-stranded RNA viruses. It has previously been isolated from Culex, Anopheles, Armigeres and Aedes mosquitoes in Indonesia and China. Here, we describe the isolation and characterization of SDKL1625 from Anopheles sinensis mosquitoes in Shandong province, China. Methods: In this study, we isolated Kadipiro virus in Aedes albopictus C6/36 cell culture and the complete genome sequencing was made by next generation sequencing. Results: We isolated and characterized a Kadipiro virus from Anopheles sinensis mosquitoes in 2016 in Shandong province, China. Nucleotide and amino acid homology analysis of SDKL1625 showed higher levels of sequence identity with QTM27331 (Odonata, China, 2016) than with JKT-7075 (Culex fuscocephalus, Indonesia, 1981). The SDKL1625 has 86–97% amino acid identity with the JKT-7075, 88–99% amino acid identity with the QTM27331. Among the 12 fragments, VP1, VP2, VP4, VP6, VP7, VP9 and VP12 showed high amino acid identity (> 90%) and VP5 showed the lowest identity (86% and 88%). Conclusions: This is the first identification of KDV from mosquito in China. Virus morphology and genome organization were also determined, which will further enrich our understanding of the molecular biological characteristics of KDV and seadornaviruses. [ABSTRACT FROM AUTHOR]