399 results on '"Dong-Kyu Jin"'
Search Results
352. Impaired generation of reactive oxygen species in leprechaunism through downregulation of Nox4.
- Author
-
Park, Hye Sun, Dong Kyu Jin, Sang Min Shin, Mi Kyung Jang, Longo, Nicholas, Ji Won Park, Duk Soo Bae, Yun Soo Bae, Jin, Dong Kyu, Shin, Sang Min, Jang, Mi Kyung, Park, Ji Won, Bae, Duk Soo, and Bae, Yun Soo
- Subjects
- *
INSULIN resistance , *DWARFISM , *PLATELET-derived growth factor , *TYROSINE , *PROTEIN-tyrosine phosphatase , *REACTIVE oxygen species - Abstract
Leprechaunism features a clinical constellation characterized by extreme insulin resistance, growth retardation, and several distinct developmental abnormalities. One puzzling observation about leprechaunism is that mutations in the insulin receptor gene frequently associated with this syndrome cannot account for the aberrant responses of cultured cells to other growth factors. Here we report that the generation of reactive oxygen species (ROS) is impaired in cells from leprechaunism patients, thus shedding new light on this issue. Stimulation of patients' skin fibroblast cells with platelet-derived growth factor (PDGF) resulted in a lower-level tyrosine phosphorylation of cytosolic proteins compared with that seen in normal cells. In addition, consistent with the hypothesis that ROS mediate the level of tyrosine phosphorylation of cytosolic proteins through inactivation of protein tyrosine phosphatases (PTPases), patient fibroblast cells showed a significantly higher phosphatase activity than normal cells. We further showed that the lower-level tyrosine phosphorylation in response to growth factors results from the downregulation of an NADPH oxidase, Nox4, which in turn results in the reduction of ROS generation. Ectopic expression of Nox4 in the patient fibroblast cells consistently restored PDGF-induced ROS production and regulation of PTPase activities. Taken together, these data provide insight into the mechanisms through which growth retardation is associated with leprechaunism syndrome. [ABSTRACT FROM AUTHOR]
- Published
- 2005
- Full Text
- View/download PDF
353. Expression of Expanded Polyglutamine Protein Induces Behavioral Changes in Drosophila (Polyglutamine-Induced Changes in Drosophila).
- Author
-
Yun-Taik Kim, Sang Min Shin, Won Yong Lee, Gyeong-Moon Kim, and Dong Kyu Jin
- Subjects
FRIEDREICH'S ataxia ,DROSOPHILA ,NEURODEGENERATION ,AMINO acids - Abstract
Spinocerebellar ataxia type-3 or MachadoJoseph disease (SCA3/MJD) is an autosomal dominant neurodegenerative disease caused by triplet nucleotide expansion. The expansion of the polyglutamine tract near the C terminus of the MJD1 gene product, ataxin-3, above a threshold of 40 glutamine repeats causes neuronal loss and degeneration. The expanded ataxin-3 forms aggregates, and nuclear inclusions, within neurons, possibly due to the misfolding of mutant proteins. Here we report upon the behavioral test changes related to truncated and expanded forms of MJD protein (MJDtr) in Drosophila, and show that expanded MJDtr, when expressed in the nervous system, causes characteristic locomotor dysfunction and anosmia. This phenomenon has not been previously reported in humans or in transgenic Drosophila models. In addition, the in vivo expression of the antiapoptotic gene bcl-2 showed no evidence of ameliorating the deleterious effect of MJDtr-Q78s, either in the eye or in the nervous system. The study shows that such Drosophila transgenic models express olfactory dysfunction and ataxic behavior as observed in human patients. [ABSTRACT FROM AUTHOR]
- Published
- 2004
354. Molecular cloning and characterization of thermostable DNA ligase from Aquifex pyrophilus, a hyperthermophilic bacterium.
- Author
-
Jae-Hwan Lim, Juhyun Choi, Soo-Jin Han, Sung Kim, Hye-Zin Hwang, Dong-Kyu Jin, Byung-Yoon Ahn, and Ye Han
- Subjects
MOLECULAR cloning ,DNA ,GENES ,ENZYMES ,HYDROGEN-ion concentration ,ESCHERICHIA coli - Abstract
A DNA ligase gene from the hyperthermophilic bacterium Aquifex pyrophilus (Ap) was cloned and sequenced. An open reading frame of 2,157 bp that codes for a 82-kDa protein showed 40%–60% homology with a series of NAD
+ -dependent DNA ligases from different organisms. The recombinant enzyme Ap DNA ligase expressed in Escherichia coli was purified to homogeneity and characterized. The activity of Ap DNA ligase gradually increased in proportion to the concentration of monovalent salt up to 200 mM NaCl, 150 mM KCl, 200 mM NH4 Cl, and 350 mM potassium glutamate. The optimum temperature and pH of Ap DNA ligase were greater than 65°C and 8.0–8.6, respectively, for nick-closing activity. More than 75% of the ligation activity was retained after incubation at 95°C for 60 min, whereas the half-lives of Thermus aquaticus and Escherichia coli DNA ligases at 95°C were ≤15 min and 5 min, respectively. Thermostable Ap DNA ligase was applied to repeat expansion detection (RED) and could be a useful enzyme in DNA diagnostics. [ABSTRACT FROM AUTHOR]- Published
- 2001
- Full Text
- View/download PDF
355. Assessment of collateral flow and myocardial perfusion by myocardial contrast echocardiography after coronary vasodiator during acute coronary occlusion
- Author
-
Chang Gyu Park, Hong Seog Seo, Younghoon Kim, Hye Hyung Kim, Dong Joo Oh, Young Moo Ro, Wan Joo Shim, and Dong Kyu Jin
- Subjects
Myocardial contrast echocardiography ,medicine.medical_specialty ,Collateral flow ,business.industry ,Coronary occlusion ,Internal medicine ,Cardiology ,Medicine ,business ,Perfusion - Published
- 1993
356. A review on the clinical effectiveness and in vitro influence of gamma-globulin on the cytokine suppression in Kawasaki disease
- Author
-
Dong-Kyu Jin, Noboru Kobayashi, Akio Nakamura, and Takao Kohsaka
- Subjects
Cytokine Suppression ,Clinical effectiveness ,business.industry ,Pediatrics, Perinatology and Child Health ,Immunology ,medicine ,Gamma globulin ,Kawasaki disease ,Cardiology and Cardiovascular Medicine ,medicine.disease ,business ,In vitro - Published
- 1992
357. Effect of Denopamine on Left Ventricular Function in Patients with Chronic Heart Failure
- Author
-
Hong Seog Seo, Young Moo Ro, Tae Hoon Ahn, Wan Joo Shim, Dong Kyu Jin, and Younghoon Kim
- Subjects
medicine.medical_specialty ,chemistry.chemical_compound ,Ventricular function ,chemistry ,business.industry ,Internal medicine ,Heart failure ,medicine ,Cardiology ,Denopamine ,In patient ,medicine.disease ,business - Published
- 1991
358. Childhood renal diseases in Korea
- Author
-
Hyun Lee, Soo Ha, Yong Kim, Dong Kyu Jin, Kwang Wook Ko, Hae Cheong, and Yong Choi
- Subjects
Male ,Nephrology ,medicine.medical_specialty ,Pathology ,Gastroenterology ,Nephropathy ,Nephritic syndrome ,Membranous nephropathy ,Internal medicine ,Humans ,Medicine ,Child ,Kidney ,Korea ,medicine.diagnostic_test ,business.industry ,Glomerulonephritis ,medicine.disease ,medicine.anatomical_structure ,Child, Preschool ,Pediatrics, Perinatology and Child Health ,Female ,Kidney Diseases ,Renal biopsy ,business ,Nephrotic syndrome - Abstract
Between June 1975 and March 1987, 662 renal biopsies were performed in 657 children at Seoul National University Children's Hospital. Nephrotic syndrome was the most indication for renal biopsy and accounted for 62% of all cases. Of these, 57% showed minimal change lesions and 21% showed focal segmental glomerular sclerosis. Nephropathy, associated with Australia-antigen-positive hepatitis, was the most prominent cause of secondary nephrotic syndrome, and of these patients membranous nephropathy was found in 86%. Diffuse proliferative glomerulonephritis was found in 60% of patients with acute nephritic syndrome. Fifty-eight percent of children with haematuria were found to have either IgA nephropathy or Henoch-Schönlein nephritis. Fifteen children with acute renal failure were biopsied, 2 of whom had haemorrhagic fever.
- Published
- 1987
359. A Report of an Indian Boy with a Delayed Diagnosis of Pseudochondroplasia.
- Author
-
SINGH, ANKUR, ABIRAMALATHA, T., PRADHAN, GAURAV, DONG- KYU JIN, and KAPOOR, SEEMA
- Abstract
The mutations in the Cartilage Oligomeric Matrix Protein (COMP) gene are associated two common and allelic bony dysplasias: Psuedoachondroplasia (PSACH) and Multiple epiphyseal dysplasias-1 (MED-1). The characteristic radiological features of both has been well established in the literature, with areas of overlap between the two in certain forms of mild PSACH and severe MED. MED is also a genotypically and a phenotypically heterogeneous disease. Here, we emphasise the salient radiological features which aid in the diagnosis of PSACH and COMP MED; which may enable a targeted molecular analysis. [ABSTRACT FROM AUTHOR]
- Published
- 2013
- Full Text
- View/download PDF
360. Prader-Willi syndrome: an update on obesity and endocrine problems.
- Author
-
Su Jin Kim, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
PRADER-Willi syndrome , *PITUITARY dwarfism , *ENDOCRINE diseases , *GENETIC disorders , *OBESITY - Abstract
Prader-Willi syndrome (PWS) is a rare complex genetic disorder that results from a lack of expression of the paternally inherited chromosome 15q11-q13. PWS is characterized by hypotonia and feeding difficulty in early infancy and development of morbid obesity aggravated by uncontrolled hyperphagia after childhood and adolescent. Dysmorphic facial features, delayed motor and language development, various degrees of cognitive impairment, and behavioral problems are common in PWS. Without early, intensive nutritional therapy along with behavioral modification, PWS patients develop severe obesity associated with type 2 diabetes, obstructive sleep apnea, right-side heart failure, and other obesity-related metabolic complications. Hypothalamic dysfunction in PWS can lead to several endocrine disorders, including short stature with growth hormone deficiency, hypothyroidism, central adrenal insufficiency, and hypogonadism. In this review, we discuss the natural history of PWS and the mechanisms of hyperphagia and obesity. We also provide an update on obesity treatments and recommendations for screening and monitoring of various endocrine problems that can occur in PWS. [ABSTRACT FROM AUTHOR]
- Published
- 2021
- Full Text
- View/download PDF
361. Decreased performance in IDUA knockout mouse mimic limitations of joint function and locomotion in patients with Hurler syndrome
- Author
-
Yokyung Chung, Jinguen Rheey, Sung Yoon Cho, Dong-Kyu Jin, Jeong-Yi Kwon, Min Jung Kwak, Chihwa Kim, and Ah-Ra Ko
- Subjects
Open-field test ,Male ,medicine.medical_specialty ,IDUA ,Mucopolysaccharidosis I ,Dermatan sulfate ,IDUA KO mice ,Rotarod test ,Iduronidase ,Mice ,chemistry.chemical_compound ,Mucopolysaccharidosis type I ,Grip strength ,BMD ,Internal medicine ,Hand strength ,Animals ,Humans ,Medicine ,Genetics(clinical) ,Pharmacology (medical) ,Hurler syndrome ,Genetics (clinical) ,Mice, Knockout ,Medicine(all) ,Hand Strength ,business.industry ,Research ,General Medicine ,medicine.disease ,Mice, Inbred C57BL ,Radiography ,Endocrinology ,chemistry ,Knockout mouse ,Immunology ,Female ,Joint Diseases ,business ,Locomotion - Abstract
Background Mucopolysaccharidosis type I (MPS I) is caused by the deficiency of alpha-L-iduronidase (IDUA), which is involved in the degradation of glycosaminoglycans (GAGs), such as heparan sulfate and dermatan sulfate in the lysosome. It has been reported that joint symptoms are almost universal in MPS I patients, and even in the case of attenuated disease, they are the first symptom that brings a child to medical attention. However, functional tests and biological markers have not been published for the evaluation of the limitations in joint and locomotion in animal model-mimicking MPS. Methods We generated IDUA knockout (KO) mice to observe whether they present impairment of joint function. KO mice were characterized phenotypically and tested dual-energy X-ray absorptiometry analysis (DEXA), open-field, rotarod, and grip strength. Results The IDUA KO mice, generated by disruption between exon 6 and exon 9, exhibited clinical and laboratory findings, such as high urinary GAGs excretion, GAGs accumulation in various tissues, and significantly increased bone mineral density (BMD) in both female and male mice in the DEXA of the femur and whole bone. Remarkably, we observed a decrease in grasp function, decreased performance in the rotarod test, and hypo-activity in the open-field test, which mimic the limitations of joint mobility and decreased motor performance in the 6-min walk test in patients with MPS I. Conclusions We generated a new IDUA KO mouse, tested open field, rotarod and grip strength and demonstrated decrease in grip strength, decreased performance and hypo-activity, which may be useful for investigating therapeutic approaches, and studying the pathogenesis of joint and locomotion symptoms in MPS I. Electronic supplementary material The online version of this article (doi:10.1186/s13023-015-0337-3) contains supplementary material, which is available to authorized users.
- Full Text
- View/download PDF
362. TCTAP A-197 Risk Factors, Biomarkers, and Echocardiographic Parameters According to Coronary Artery Calcium Scoring (Agatstone) Measured by 64-Channel Multidetector Computed Tomography
- Author
-
Sang-Ho Park, Seung-Woon Rha, Ung Jun, Se-Whan Lee, Won-Yong Shin, Seung-Jin Lee, Dong-Kyu Jin, Byoung Geol Choi, Se Yeon Choi, Yoonjee Park, Akkala Raghavender Goud, Hu Li, Sunki Lee, Ji Bak Kim, Sung Il Im, Jin Oh Na, Cheol Ung Choi, Hong Euy Lim, Jin Won Kim, Eung Ju Kim, Chang Gyu Park, Hong Seog Seo, and Dong Joo Oh
- Subjects
medicine.medical_specialty ,High prevalence ,business.industry ,medicine.medical_treatment ,Stent ,equipment and supplies ,Asymptomatic ,medicine.anatomical_structure ,Internal medicine ,Multidetector computed tomography ,medicine ,Cardiology ,cardiovascular diseases ,Radiology ,medicine.symptom ,Cardiology and Cardiovascular Medicine ,business ,Coronary Artery Calcium Scoring ,Artery - Abstract
Conclusion: Stent fracture was observed frequently in not only RCA but also other coronary artery at long term follow-up even in asymptomatic and event-free patients. The high prevalence of stent fracture in chronic phase was observed in our study, although aneurysmal change and ISR due to stent fracture were rare. MDCT in chronic phases after SES implantation can indicate whether the patient needs to continue dual antiplatelet therapy or not.
- Full Text
- View/download PDF
363. TCTAP A-174 Left Ventricular Mass Index and Septal E/E' Ratio Is Associated with Coronary Artery Calcium Score Severity in Subjects with Normal Left Ventricular Ejection Fraction
- Author
-
Sunki Lee, Cheol Ung Choi, Byoung Geol Choi, Won-Yong Shin, Jin Oh Na, Hong Euy Lim, Akkala Raghavender Goud, Dong Joo Oh, Chang Gyu Park, Seung Jin Lee, Seung-Woon Rha, Hu Li, Sang-Ho Park, Dong-Kyu Jin, Ji Bak Kim, Yoonjee Park, Se Yeon Choi, Eung Ju Kim, Hong Seog Seo, Jin Won Kim, and Sung Il Im
- Subjects
Left ventricular mass ,medicine.medical_specialty ,Ejection fraction ,business.industry ,Coronary artery calcium score ,Internal medicine ,medicine ,Cardiology ,Cardiology and Cardiovascular Medicine ,business - Full Text
- View/download PDF
364. Phase I/II clinical trial of enzyme replacement therapy with idursulfase beta in patients with mucopolysaccharidosis II (Hunter Syndrome)
- Author
-
Sung Won Park, Eun-Kyung Kwon, Sung Yoon Cho, Young Bae Sohn, Su Jin Kim, Dong-Kyu Jin, Sun Ju Han, and Ah-Ra Ko
- Subjects
Adult ,Male ,Adolescent ,Mucopolysaccharidosis II ,Idursulfase ,Iduronate Sulfatase ,Idursulfase beta ,law.invention ,Glycosaminoglycan ,Recombinant iduornate-2-sulfatase ,Young Adult ,Randomized controlled trial ,law ,medicine ,Humans ,Enzyme Replacement Therapy ,Single-Blind Method ,Genetics(clinical) ,Pharmacology (medical) ,Beta (finance) ,Child ,Genetics (clinical) ,Glycosaminoglycans ,Medicine(all) ,business.industry ,Research ,Hunter syndrome ,General Medicine ,Enzyme replacement therapy ,medicine.disease ,Clinical trial ,Echocardiography ,Immunology ,ERT ,business ,medicine.drug - Abstract
Background Mucopolysaccharidosis II (MPS II, Hunter syndrome) is a rare X-linked lysosomal storage disorder caused by the deficiency of iduronate-2-sulfatase (IDS). In affected patients, glycosaminoglycan (GAG) accumulates in the lysosomes of many organs and tissues contributing to the pathology associated with MPS II. The objective of this phase I/II clinical study was to evaluate the efficacy and safety of recombinant human iduronate-2-sulfatase (idursulfase beta, Hunterase®) in the treatment of MPS II. Methods Thirty-one MPS II patients between 6 and 35 years of age were enrolled in a randomized, single-blinded, active comparator-controlled phase I/II trial for 24 weeks. Patients were randomized to active comparator infusions (N=11), 0.5 mg/kg idursulfase beta infusions (N=10), or 1.0 mg/kg idursulfase beta infusions (N=10). The primary efficacy variable was the level of urinary GAG excretion. The secondary variables were changes in the distance walked in 6 minutes (6-minute walk test, 6MWT), echocardiographic findings, pulmonary function tests, and joint mobility. Results Patients in all three groups exhibited reduction in urine GAG and this reduced GAG level was maintained for 24 weeks. Urine GAG was also significantly reduced in the 0.5 mg/kg and 1.0 mg/kg idursulfase beta groups when compared to the active comparator group (P = 0.043, 0.002, respectively). Changes in 6MWT were significantly greater in the 0.5 mg/kg and 1.0 mg/kg idursulfase groups than in the active comparator group (p= 0.003, 0.015, respectively). Both idursulfase beta infusions were generally safe and well tolerated, and elicited no serious adverse drug reactions. The most frequent adverse events were urticaria and skin rash, which were easily controlled with administration of antihistamines. Conclusions This study indicates that idursulfase beta generates clinically significant reduction of urinary GAG, improvements in endurance as measured by 6MWT, and it has an acceptable safety profile for the treatment of MPS II. Trial registration ClinicalTrials.gov: NCT01301898
- Full Text
- View/download PDF
365. Serum levels of FGF21 are reduced and negatively correlated with adiponectin in children with Prader-Willi syndrome
- Author
-
Young Ok Choi, Sung Yoon Cho, Young Bae Sohn, Chi Hwa Kim, Dong-Kyu Jin, and Su Jin Kim
- Subjects
congenital, hereditary, and neonatal diseases and abnormalities ,medicine.medical_specialty ,FGF21 ,Adiponectin ,business.industry ,Maternal and child health ,Regulator ,nutritional and metabolic diseases ,Insulin sensitivity ,nervous system diseases ,Endocrinology ,Internal medicine ,Poster Presentation ,Medicine ,Glucose homeostasis ,business ,Beneficial effects ,Human obesity - Abstract
Background/Aims FGF21 (fibroblast growth factor 21) is a novel metabolic regulator that has beneficial effects on glucose homeostasis and insulin sensitivity. In human obesity, serum FGF21 level was increased. The aims of this study were comparing fasting serum levels of FGF21 in Prader-Willi syndrome (PWS) and obese control children and finding correlations these levels with insulin sensitivity and obesity-related parameters.
- Full Text
- View/download PDF
366. TCT-359 Predictors associated with Major Adverse Cardiac Events following Successful Chronic Total Occlusion Intervention with Drug-eluting Stents
- Author
-
Cheol Ung Choi, Ung Jun, Hong Euy Lim, Dong Joo Oh, Hong Seog Seo, Seung-Woon Rha, Won-Yong Shin, Jin-Soo Byun, Jin Won Kim, Byoung Geol Choi, Chang Gyu Park, Seungjin Lee, Sang-Ho Park, Se-Whan Lee, Jin Oh Na, Eung Ju Kim, and Dong-Kyu Jin
- Subjects
Drug ,medicine.medical_specialty ,business.industry ,media_common.quotation_subject ,Internal medicine ,Intervention (counseling) ,medicine ,Cardiology and Cardiovascular Medicine ,business ,Total occlusion ,media_common - Full Text
- View/download PDF
367. URIC ACID AND HEMOGLOBIN LEVEL: NOVEL RISK PREDICTORS OF ACUTE KIDNEY INJURY IN PATIENT UNDERGOING PERCUTANEOUS CORONARY INTERVENTION WITH DRUG-ELUTING STENTS
- Author
-
Seung Jin Lee, Cheol Ung Choi, Hong Euy Lim, Jin Won Kim, Ji Young Park, Sang-Ho Park, Seung-Woon Rha, Hong Seog Seo, Yun Kyung Kim, Dong Joo Oh, Byoung Geol Choi, Won-Yong Shin, Chang Gyu Park, Dong-Kyu Jin, Meera Kumari, and Kanhaiya L. Poddar
- Subjects
Drug ,medicine.medical_specialty ,business.industry ,medicine.medical_treatment ,media_common.quotation_subject ,Acute kidney injury ,Percutaneous coronary intervention ,medicine.disease ,urologic and male genital diseases ,chemistry.chemical_compound ,chemistry ,Internal medicine ,Cardiology ,Medicine ,Uric acid ,In patient ,Hemoglobin ,cardiovascular diseases ,business ,Cardiology and Cardiovascular Medicine ,media_common - Full Text
- View/download PDF
368. TCTAP A-050 Restenotic Stented Versus De Novo Chronic Total Occlusion Outcomes Following Successful Intervention with Drug-eluting Stents
- Author
-
Eung Ju Kim, Dong-Kyu Jin, Seung-Woon Rha, Seungjin Lee, Won-Yong Shin, Cheol Ung Choi, Akkala Raghavender Goud, Sang-Ho Park, Chang Gyu Park, Byoung Geol Choi, Ji Bak Kim, Yoonjee Park, Dong Joo Oh, Hong Euy Lim, Se-Whan Lee, Hong Seog Seo, Hu Li, Se Yeon Choi, Jin Oh Na, Jin Won Kim, Sung Il Im, Sunki Lee, and Ung Jun
- Subjects
Drug ,medicine.medical_specialty ,business.industry ,media_common.quotation_subject ,equipment and supplies ,Total occlusion ,Surgery ,Lesion ,Intervention (counseling) ,medicine ,Population study ,medicine.symptom ,Cardiology and Cardiovascular Medicine ,business ,media_common - Abstract
There are limited data comparing angiographic and clinical outcomes of re-stenotic stented chronic total occlusive (CTO) lesion successfully revascularized with drug-eluting stents (DESs) with those of de novo CTO lesion. The study population consisted of consecutive 269 CTO patients (pts) who
- Full Text
- View/download PDF
369. IMPACT OF CORONARY ARTERY SPASM ON FIVE-YEARS CLINICAL OUTCOMES: A PROPENSITY SCORE-MATCHED ANALYSIS
- Author
-
Dong Joo Oh, Seung-Woon Rha, Chang Gyu Park, Byoung Geol Choi, Cheol Ung Choi, Won-Yong Shin, Dong-Kyu Jin, Taehoon Ahn, Won Yu Kang, Sang-Ho Park, and Hong-Seog Seo
- Subjects
medicine.medical_specialty ,medicine.anatomical_structure ,business.industry ,Internal medicine ,Propensity score matching ,medicine ,Cardiology ,Cardiology and Cardiovascular Medicine ,business ,Artery - Full Text
- View/download PDF
370. TCT-581 Long-term Patient-related and Stent-related Outcomes of Second-Generation Everolimus-Eluting Xience V Stents versus Zotarolimus-Eluting Resolute Stents in Real-World Practice: Three Year Results From the Multicenter Prospective EXCELLENT and RESOLUTE-Korea Registries
- Author
-
Kyung Woo Park, Hyo-Soo Kim, Bon-Kwon Koo, Taehoon Ahn, Joo Myung Lee, Jong Seon Park, Doo-Il Kim, Dong-Kyu Jin, Hui-Kyung Jeon, Jung-Kyu Han, Seok-Kyu Oh, Dong Woon Jeon, Han-Mo Yang, S I Woo, Min Su Hyon, Do Sun Lim, Jin Sik Park, Han Cheol Lee, and Hyun Jae Kang
- Subjects
medicine.medical_specialty ,Everolimus ,business.industry ,medicine.medical_treatment ,medicine ,Stent ,Zotarolimus ,business ,Cardiology and Cardiovascular Medicine ,equipment and supplies ,Surgery ,medicine.drug ,Term (time) - Full Text
- View/download PDF
371. Chronic peritoneal dialysis in a 4-year-old boy with Lesch–Nyhan disease.
- Author
-
Su Kim, Young Sohn, Sung Park, Dong-kyu Jin, and Kyung Paik
- Subjects
LETTERS to the editor ,HEMODIALYSIS patients - Abstract
A letter to the editor is presented describing the case of a 4-year-old boy who was diagnosed with Lesch-Nyhan disease (LND) and was treated by peritoneal dialysis for four years.
- Published
- 2009
- Full Text
- View/download PDF
372. Successful dialysis in a boy with methylmalonic acidemia.
- Author
-
Kyung Hoon Paik, Ji Eun Lee, and Dong-Kyu Jin
- Subjects
LETTERS to the editor ,DIALYSIS (Chemistry) - Abstract
Presents a letter to the editor about the article "Successful dialysis in a boy with methylmalonic acidemia."
- Published
- 2004
- Full Text
- View/download PDF
373. Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutationsCommunicated by Mark H. PaalmanOnline Citation: Human Mutation, Mutation in Brief #599 (2002) Onlinehttp://www.interscience.wiley.com/humanmutation/pdf/mutation/599.pdf
- Author
-
Chi Hwa Kim, Hye Zin Hwang, Seng Mi Song, Kyung Hoon Paik, Eun Kyung Kwon, Kwang Bin Moon, Jeong Hyeok Yoon, Cheol Kyu Han, and Dong?Kyu Jin
- Subjects
MUCOPOLYSACCHARIDOSIS ,GENETIC disorders ,NONSENSE mutation ,PROTEIN folding ,NUCLEOTIDE sequence ,BIOLOGICAL models ,PATIENTS - Abstract
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X?linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121?123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3?dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease. © 2003 Wiley?Liss, Inc. [ABSTRACT FROM AUTHOR]
- Published
- 2003
- Full Text
- View/download PDF
374. Clinical, biochemical, and genetic analysis of two Korean patients with Trichorhinophalangeal syndrome type I and growth hormone deficiency.
- Author
-
Young Bae Sohn, Chang-Seok Ki, Sung Won Park, Sung-Yoon Cho, Ah-Ra Ko, Min-Jung Kwon, Ji-Youn Kim, Hyung-Doo Park, Ok-Hwa Kim, and Dong-Kyu Jin
- Subjects
PITUITARY dwarfism ,HUMAN genetics ,KOREANS ,DISEASES - Abstract
An abstract of the study "Clinical, Biochemical, and Genetic Analysis of Two Korean Patients With Trichorhinophalangeal Syndrome Type 1 and Growth Hormone Deficiency" by Young Bae Sohn et al is presented.
- Published
- 2013
- Full Text
- View/download PDF
375. Serum levels of FGF21 are reduced and negatively correlated with adiponectin in children with Prader-Willi syndrome.
- Author
-
Su Jin Kim, Young Bae Sohn, Sung-Yoon Cho, Young Ok Choi, Chi Hwa Kim, and Dong-Kyu Jin
- Subjects
SERUM ,ADIPONECTIN ,PRADER-Willi syndrome - Abstract
An abstract of the study "Serum Levels of FGF21 Are Reduced and Negatively Correlated With Adiponectin in Children With Prader-Willi Syndrome" by Su Jin Kim et al is presented.
- Published
- 2013
- Full Text
- View/download PDF
376. First female Korean child with Coffin-Lowry syndrome: a novel variant in RPS6KA3 diagnosed by exome sequencing and a literature review.
- Author
-
Ari Song, Minji Im, Min-Sun Kim, Eu Seon Noh, Chiwoo Kim, Jahyun Jang, Sae-Mi Lee, Chang-Seok Ki, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
LITERATURE reviews , *SHORT stature , *GROWTH disorders , *DEVELOPMENTAL delay , *GENETIC variation , *PRECOCIOUS puberty , *CHEILITIS - Abstract
Coffin-Lowry syndrome (CLS, OMIM # 303600) is a rare X-linked disorder caused by mutations in RPS6KA3. CLS is characterized by facial dysmorphism, digit abnormalities, developmental delays, growth retardation, and progressive skeletal changes in male patients. Females with CLS are variably affected, complicating diagnosis. Here, we describe the clinical and molecular findings in a female Korean child with CLS and review the associated literature. A 5-year-old girl presented with short stature and developmental delays. She had a coarse facial appearance characterized by a prominent forehead, hypertelorism, thick lips, and hypodontia. She also had puffy tapering fingers and pectus excavatum. We performed exome sequencing and identified a novel, likely pathogenic, heterozygous variant, c.326_338delinsCTCGAGAC (p.Val109Alafs*10), in RPS6KA3 (NM_004586.2). This is the first Korean female genetically diagnosed with CLS. In contrast to the delayed bone age reported in previous studies, our patient showed advanced bone age and central precocious puberty. CLS should be considered as a differential diagnosis of short stature, tapering fingers, and developmental delay. We suggest that molecular techniques can be a useful tool for diagnosis of rare disorders such as CLS because such conditions are not simple, and the associated spectrum of phenotypes can vary. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
377. Alternating Hemiplegia of Childhood: neurological comorbidities and intrafamilial variability
- Author
-
Piero Pavone, Xena Giada Pappalardo, Naira Mustafa, Sung Yoon Cho, Dong Kyu Jin, Gemma Incorpora, Raffaele Falsaperla, Simona Domenica Marino, Giovanni Corsello, Enrico Parano, and Martino Ruggieri
- Subjects
Alternating hemiplegia of childhood (AHC) ,Epilepsy ,Comorbidities ,GRIN2A ,Case report ,Pediatrics ,RJ1-570 - Abstract
Abstract Background Alternating of Childhood (AHC) is an uncommon and complex disorder characterized by age of onset before 18 months with recurrent hemiplegia of one or either sides of the body or quadriplegia. The disorder is mainly caused by mutations in ATP1A3 gene, and to a lesser extent in ATP1A2 gene. In AHC neurological co-morbidities are various and frequently reported including developmental delay, epilepsy, tonic or dystonic spells, nystagmus,autonomic manifestations with intrafamilial variability. Case presentation Clinical and genetic findings of a couple of twins (Family 1: Case 1 and Case 2) and a couple of siblings (Family 2: Case 3 and Case 4) coming from two different Italian families affected by AHC were deeply examined. In twins of Family 1, a pathogenic variant in ATP1A3 gene (c.2318A>G) was detected. In siblings of Family 2, the younger brother showed a novel GRIN2A variant (c.3175 T > A), while the older carried the same GRIN2A variant, and two missense mutations in SCNIB (c.632 > A) and KCNQ2 (1870 G > A) genes. Clinical manifestations of the four affected children were reported along with cases of AHC drawn from the literature. Conclusions Hemiplegic episode is only a sign even if the most remarkable of several and various neurological comorbidities in AHC affected individuals. Molecular analysis of the families here reported showed that clinical features of AHC may be also the result of an unexpected genetic heterogeneity.
- Published
- 2022
- Full Text
- View/download PDF
378. Wilson disease diagnosed incidentally by targeted gene panel sequencing in a Korean boy with severe obesity.
- Author
-
Minji Im, Ari Song, Jiyeon Kim, Min-Sun Kim, Sae-Mi Lee, Mi Jin Kim, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
FATTY liver , *NON-alcoholic fatty liver disease , *GENETIC disorders , *OBESITY , *DIAGNOSIS , *BRAIN degeneration - Abstract
Wilson disease (WD) is a relatively common genetic hepatic disease in children and is characterized by excessive copper accumulation, predominantly in the liver and brain. It is an autosomal recessive disease caused by an ATP7B mutation that causes brain degeneration and is potentially fatal if diagnosed late or untreated. In the early phase of WD, its initial presentation may include mild hepatic involvement. WD may be overlooked as a cause of liver disease due to severe obesity but should not be excluded from differential diagnosis. We report a case of WD with severe obesity and fatty liver diagnosed in the early phase by targeted gene panel sequencing and review the endocrine problems associated with WD. Early suspicion of WD is important for good prognosis. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
379. Autosomal Recessive Malignant Infantile Osteopetrosis Associated with a TCIRG1 Mutation: A Case Report of a Neonate Presenting with Hypocalcemia in South Korea
- Author
-
Yun Kyo Oh, Koung Eun Choi, Youn-Jeong Shin, Eun Ryoung Kim, Ji Yeon Kim, Min Sun Kim, Sung Yoon Cho, and Dong Kyu Jin
- Subjects
osteopetrosis ,infant, newborn ,mutation ,bone density ,hypocalcemia ,Pediatrics ,RJ1-570 - Abstract
Osteopetrosis refers to a group of genetic skeletal disorders characterized by osteosclerosis and fragile bones. Osteopetrosis can be classified into autosomal dominant, autosomal recessive, or X-linked forms, which might differ in clinical characteristics and disease severity. Autosomal recessive osteopetrosis, also known as malignant osteopetrosis, has an earlier onset, more serious clinical symptoms, and is usually fatal. We encountered a 1-day-old girl who was born full-term via vaginal delivery, which was complicated by meconium-stained amniotic fluid, cephalo-pelvic disproportion, and nuchal cord. Routine neonatal care was provided, in addition to blood tests and chest radiography to screen for sepsis, as well as skull radiography to rule out head injuries. Initial blood tests revealed hypocalcemia, which persisted on follow-up tests the next day. Radiographic examinations revealed diffusely increased bone density and a "space alien" appearance of the skull. Based on radiographic and laboratory findings, the infantile form of osteopetrosis was suspected and genetic testing for identification of the responsible gene. Eventually, a heterozygous mutation of the T cell immune regulator 1, ATPase H+ transporting V0 subunit a3 (TCIRG1) gene (c.292C>T) was identified, making this the first reported case of neonatal-onset malignant osteopetrosis with TCIRG1 mutation in South Korea. Early-onset hypocalcemia is common and usually results from prematurity, fetal growth restriction, maternal diabetes, perinatal asphyxia, and physiologic hypoparathyroidism. However, if hypocalcemia persists, we recommend considering 'infantile of osteopetrosis' as a rare cause of neonatal hypocalcemia and performing radiographic examinations to establish the diagnosis.
- Published
- 2021
- Full Text
- View/download PDF
380. `Tailored management of life-threatening complications related to severe obesity in a young adult with Prader-Willi syndrome: `.
- Author
-
Min-Sun Kim, Jiyeon Kim, Joongbum Cho, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
PRADER-Willi syndrome , *YOUNG adults , *OBESITY , *SLEEP apnea syndromes , *INTENSIVE care units , *ARTIFICIAL respiration , *CEPHALOMETRY - Abstract
Prader-Willi syndrome (PWS) is characterized by hypotonia, distinctive facial features, hyperphagia, obesity, short stature, hypogonadism, intellectual disability, and behavior problems. Uncontrolled hyperphagia can lead to dangerous foodseeking behavior and with life-threatening obesity. Severe obesity is prone to obstructive sleep apnea (OSA) and can lead to cor pulmonale. This study reports on a case involving a 21-year-old man with PWS who developed OSA due to severe obesity, which led to cor pulmonale, a life-threatening complication. Multidisciplinary care provided in the intensive care unit included weight reduction, ventilation support, antipsychotics, sedative drugs, rehabilitation, and meticulous skin care. The patient did recover. To prevent severe obesity in adults with PWS, hyperphagia must be controlled, and the patient must also be managed by an endocrinologist throughout childhood. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
381. Efficacy and safety of nebivolol in Korean patients with hypertension by age and sex: a subanalysis from the BENEFIT-KOREA study
- Author
-
Kyoung Im Cho, Dong Woon Jeon, Hyo Seung Ahn, Dong Kyu Jin, Hyun Sang Lee, Jong-Young Lee, Hong-Seok Lim, Athanasios J. Manolis, Seung-Woon Rha, and Sang Won Park
- Subjects
Essential hypertension ,Nebivolol ,Asian ,Monotherapy ,Combination therapy ,Add-on therapy ,Medicine ,Internal medicine ,RC31-1245 - Abstract
Abstract Background BENEFIT-KOREA (BEnefits after 24 weeks of NEbivolol administration For essential hypertensIon patients wiTh various comorbidities and treatment environments in Korea) study, an observational study in South Korea, demonstrated the efficacy and safety of nebivolol in Asian patients with essential hypertension with and without comorbidities in real-world settings. We present a subanalysis of the efficacy and safety of nebivolol across age and sex in the BENEFIT-KOREA cohort. Methods Adult South Korean patients with essential hypertension participated in the prospective, single-arm, open, observational BENEFIT-KOREA study; 3011 patients received nebivolol as monotherapy or add-on therapy. Changes in systolic blood pressure (SBP) and diastolic blood pressure (DBP), and pulse rate at 12 and 24 weeks were evaluated. Participants were divided into three age groups—young males and females:
- Published
- 2021
- Full Text
- View/download PDF
382. Hypertriglyceridemia with acute pancreatitis in a 14-year-old girl with diabetic ketoacidosis.
- Author
-
Hyojung Park, Min-Sun Kim, Jiyeon Kim, Sae-Mi Lee, Sung Yoon Cho, Eun-Gyong Yoo, and Dong-Kyu Jin
- Subjects
- *
DIABETIC acidosis , *HYPERTRIGLYCERIDEMIA , *PANCREATITIS , *TYPE 2 diabetes , *SYMPTOMS , *HYPERGLYCEMIA , *DYSLIPIDEMIA - Abstract
Diabetic ketoacidosis (DKA) is a medically fatal condition in poorly controlled hyperglycemia or newly diagnosed diabetes mellitus. Severe hypertriglyceridemia (HTG) is an uncommon complication of DKA and can be associated with acute pancreatitis (AP). We present the clinical manifestations, laboratory findings, and management of AP associated with HTG in a 14-year-old girl with DKA. The patient, with a 7-year history of type 2 diabetes presented with epigastric pain, 1 month after stopping insulin injection. DKA, severe HTG, and AP were diagnosed based on the laboratory and imaging tests. She recovered from DKA after conventional treatment for DKA, and her triglyceride (TG) level was reduced from 10,867 mg/dL to the normal range after 7 days of admission without antilipid medication. Given that her C-peptide level was not too low and considering her negative diabetes-related antibodies and high TG level, targeted gene panel sequencing was performed on the genes associated with diabetes and HTG. We identified a heterozygous mutation, c.4607C>T (p. Ala1537Val), in ABCC8 related to maturityonset diabetes of the young (MODY) 12. To our knowledge, this is the first reported case of HTG-induced AP with DKA in a patient with MODY. In addition, we reviewed the literature for pediatric cases of HTG with DKA. In patients with DKA, timely awareness of severe HTG related to insulin deficiency is crucial for improving the consequences of AP. We recommend considering AP in all DKA patients presenting with severe HTG to ensure early and proper management. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
383. Development and validation of the Pediatric-Youth Hyperphagia Assessment for Prader-Willi syndrome.
- Author
-
Sung Yoon Cho, Danbee Kang, Minji Im, Aram Yang, Min-Sun Kim, Jiyeon Kim, Eu-Seon Noh, Eun Kyung Kwon, Eujin Choi, Sunju Han, Young Ah Park, Min Jung Kwak, Youngha Kim, Juhee Cho, Dong-Kyu Jin, Cho, Sung Yoon, Kang, Danbee, Im, Minji, Yang, Aram, and Kim, Min-Sun
- Abstract
Objectives: Hyperphagia is a highly stressful, life-threatening feature of Prader-Willi syndrome (PWS). It is important to assess this complex behavior accurately over time. This study aimed to develop and validate the Pediatric-Youth Hyperphagia Assessment for Prader-Willi syndrome (PYHAP) as a tool targeting children and adolescents.Methods: After an extensive literature review and qualitative interviews, the final version of the PYHAP with 14 questions in 3 domains (verbal [5], behavior [4], and social [5]) was developed and tested at Samsung Medical Center in Seoul, Korea from July 2018 to September 2019. Exploratory factor analysis and confirmatory factor analysis (CFA) were performed to confirm construct validity. The correlations between the PYHAP and the Korean Children's Eating Behavior Questionnaire (K-CEBQ) were calculated to evaluate convergent and discriminant validity. Criterion validity and the validity of the response categories were also tested.Results: Cronbach's alpha coefficient of the PYHAP was 0.91. The fit indices for CFA were good (comparative fit index, 0.87; standardized root mean squared residual, 0.08). The domains of the PYHAP were closely correlated with the relevant domains of the K-CEBQ. The accuracy of the PYHAP score for predicting uncontrolled hyperphagia was good (area under the curve, 0.75; 95% confidence interval, 0.65 to 0.85).Conclusions: The PYHAP was confirmed to be a reliable and valid tool to evaluate hyperphagia in children and adolescents with PWS via caregivers' assessments. It is recommended to use the PYHAP to communicate with parents or caregivers about patients' hyperphagia or to monitor and manage extreme behaviors in children with PWS. [ABSTRACT FROM AUTHOR]- Published
- 2022
- Full Text
- View/download PDF
384. PRRT2 gene variant in a child with dysmorphic features, congenital microcephaly, and severe epileptic seizures: genotype-phenotype correlation?
- Author
-
Piero Pavone, Giovanni. Corsello, Sung Yoon Cho, Xena Giada Pappalardo, Martino Ruggieri, Simona Domenica Marino, Dong Kyu Jin, Silvia Marino, and Raffaele Falsaperla
- Subjects
PRRT2 mutation ,Dysmorphic features ,Microcephaly ,Epileptic encephalopathy ,Pediatrics ,RJ1-570 - Abstract
Abstract Background Mutations in Proline-rich Transmembrane Protein 2 (PRRT2) have been primarily associated with individuals presenting with infantile epilepsy, including benign familial infantile epilepsy, benign infantile epilepsy, and benign myoclonus of early infancy, and/or with dyskinetic paroxysms such as paroxysmal kinesigenic dyskinesia, paroxysmal non-kinesigenic dyskinesia, and exercise-induced dyskinesia. However, the clinical manifestations of this disorder vary widely. PRRT2 encodes a protein expressed in the central nervous system that is mainly localized in the pre-synaptic neurons and is involved in the modulation of synaptic neurotransmitter release. The anomalous function of this gene has been proposed to cause dysregulation of neuronal excitability and cerebral disorders. Case presentation We hereby report on a young child followed-up for three years who presents with a spectrum of clinical manifestations such as congenital microcephaly, dysmorphic features, severe intellectual disability, and drug-resistant epileptic encephalopathy in association with a synonymous variant in PRRT2 gene (c.501C > T; p.Thr167Ile) of unknown clinical significance variant (VUS) revealed by diagnostic exome sequencing. Conclusion Several hypotheses have been advanced on the specific role that PRRT2 gene mutations play to cause the clinical features of affected patients. To our knowledge, the severe phenotype seen in this case has never been reported in association with any clinically actionable variant, as the missense substitution detected in PRRT2 gene. Intriguingly, the same mutation was reported in the healthy father: the action of modifying factors in the affected child may be hypothesized. The report of similar observations could extend the spectrum of clinical manifestations linked to this mutation.
- Published
- 2019
- Full Text
- View/download PDF
385. Nonclassic congenital lipoid adrenal hyperplasia diagnosed at 17 months in a Korean boy with normal male genitalia: emphasis on pigmentation as a diagnostic clue.
- Author
-
Hosun Bae, Min-Sun Kim, Hyojung Park, Ja-Hyun Jang, Jong-Moon Choi, Sae-Mi Lee, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
ADRENOGENITAL syndrome , *MALE reproductive organs , *ADRENAL insufficiency , *HORMONE deficiencies , *ANIMAL coloration , *ADRENOCORTICAL hormones - Abstract
Congenital lipoid adrenal hyperplasia (CLAH) is one of the most fatal conditions caused by an abnormality of adrenal and gonadal steroidogenesis. CLAH results from loss-of-function mutations of the steroidogenic acute regulatory (STAR) gene; the disease manifests with electrolyte imbalances and hyperpigmentation in neonates or young infants due to adrenocortical hormone deficiencies, and 46, XY genetic male CLAH patients can be phenotypically female. Meanwhile, some patients with STAR mutations develop hyperpigmentation and mild signs of adrenal insufficiency, such as hypoglycemia, after infancy. These patients are classified as having nonclassic CLAH (NCCLAH) caused by STAR mutations that retain partial activity of STAR. We present the case of a Korean boy with normal genitalia who was diagnosed with NCCLAH. He presented with whole-body hyperpigmentation and electrolyte abnormalities, which were noted at the age of 17 months after an episode of sepsis with peritonitis. The compound heterozygous mutations p.Gly221Ser and c.653C>T in STAR were identified by targeted gene-panel sequencing. Skin hyperpigmentation should be considered an important clue for diagnosing NCCLAH. [ABSTRACT FROM AUTHOR]
- Published
- 2020
- Full Text
- View/download PDF
386. Characterization of Transcriptional Regulators of Ghrelin Hormone Which Causes Genetic Obesity
- Author
-
Dong-Kyu Jin
- Published
- 2011
387. Clinical and molecular characterization of Korean children with infantile and late-onset Pompe disease: 10 years of experience with enzyme replacement therapy at a single center.
- Author
-
Min-Sun Kim, Ari Song, Minji Im, June Huh, I-Seok Kang, Jinyoung Song, Aram Yang, Jinsup Kim, Eun-Kyung Kwon, Eu-Jin Choi, Sun-Ju Han, Hyung-Doo Park, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
CARDIOMYOPATHIES , *GLYCOGEN storage disease type II , *CLINICAL drug trials , *GLYCOGEN storage disease , *HYPERTROPHIC cardiomyopathy , *HUMAN chromosome abnormality diagnosis , *ENZYMES - Abstract
Purpose: Pompe disease (PD) is an autosomal recessive disorder caused by a deficiency of acid alphaglucosidase resulting from pathogenic GAA variants. This study describes the clinical features, genotypes, changes before and after enzyme replacement therapy (ERT), and long-term outcomes in patients with infantile-onset PD (IOPD) and late-onset PD (LOPD) at a tertiary medical center. Methods: The medical records of 5 Korean patients (2 male, 3 female patients) diagnosed with PD between 2002 and 2013 at Samsung Medical Center in Seoul, Republic of Korea were retrospectively reviewed for data, including clinical and genetic characteristics at diagnosis and clinical course after ERT. Results: Common initial symptoms included hypotonia, cyanosis, and tachycardia in patients with IOPD and limb girdle weakness in patients with LOPD. Electrocardiography at diagnosis revealed hypertrophic cardiomyopathy in all patients with IOPD who showed a stable disease course during a median follow-up period of 10 years. Patients with LOPD showed improved hepatomegaly and liver transaminase level after ERT. Conclusion: As ERT is effective for treatment of PD, early identification of this disease is very important. Thus, patients with IOPD should be considered candidates for clinical trials of new drugs in the future. [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
388. A case of de novo 18p deletion syndrome with panhypopituitarism.
- Author
-
Aram Yang, Jinsup Kim, Sung Yoon Cho, Ji-Eun Lee, Hee-Jin Kim, and Dong-Kyu Jin
- Subjects
- *
OTITIS media with effusion , *HUMAN growth hormone , *DRUG side effects , *PITUITARY gland , *DWARFISM , *SHORT stature - Abstract
Deletion on the short arm of chromosome 18 is a rare disorder characterized by intellectual disability, growth retardation, and craniofacial malformations (such as prominent ears, microcephaly, ptosis, and a round face). The phenotypic spectrum is wide, encompassing a range of abnormalities from minor congenital malformations to holoprosencephaly. We present a case of a 2-year-old girl with ptosis, a round face, broad neck with low posterior hairline, short stature, and panhypopituitarism. She underwent ventilation tube insertion for recurrent otitis media with effusion. Brain magnetic resonance imaging showed an ectopic posterior pituitary gland and a shallow, small sella turcica with poor visualization of the pituitary stalk. Cytogenetic and chromosomal microarray analysis revealed a de novo deletion on the short arm of chromosome 18 (arr 18p11.32p11.21[136,227-15,099,116]x1). She has been treated with recombinant human growth hormone (GH) therapy since the age of 6 months after diagnosis of GH deficiency. Her growth rate has improved without any side effects from the GH treatment. This case expands the phenotypic spectrum of 18p deletion syndrome and emphasizes the positive impact of GH therapy on linear growth in this syndrome characterized by growth deficiency. Further studies are required to define the genotype-phenotype correlation according to size and loci of the deletion in 18p deletion syndrome and to predict prognosis. [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
389. A novel de novo mosaic mutation in PHEX in a Korean patient with hypophosphatemic rickets.
- Author
-
Misun Yang, Jinsup Kim, Aram Yang, Jahyun Jang, Tae Yeon Jeon, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
RICKETS , *THERAPEUTICS , *NONSENSE mutation , *SHORT stature - Abstract
X-linked hypophosphatemic rickets is caused by loss-of-function mutations in PHEX, which encodes a phosphate-regulating endopeptidase homolog. We report a 26-year-old man with X-linked hypophosphatemic rickets who showed decreased serum phosphate accompanied by bilateral genu valgum and short stature. He had received medical treatment with vitamin D (alfacalcidol) and phosphate from the age of 3 to 20 years. He underwent surgery due to valgus deformity at the age of 14 and 15. Targeted gene panel sequencing for Mendelian genes identified a nonsense mutation in PHEX (c.589C>T; p.Gln197Ter) and a mosaic pattern where only 38% of sequence reads showed the variant allele. This mutation was not found in his mother, who had a normal phenotype. This is a case of a sporadic nonsense mutation in PHEX and up to date, this is the first case of a mosaic mutation in PHEX in Korea. [ABSTRACT FROM AUTHOR]
- Published
- 2018
- Full Text
- View/download PDF
390. Increased Expression of Adiponectin Receptor 2 in the Mononuclear Cells in Children With Prader-Willi Syndrome
- Author
-
Dong-Kyu Jin
- Published
- 2008
391. Etiological trends in male central precocious puberty.
- Author
-
Jisun Lee, Jinsup Kim, Aram Yang, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
PRECOCIOUS puberty , *LUTEINIZING hormone releasing hormone , *MAGNETIC resonance imaging of the brain , *DIAGNOSIS - Abstract
Purpose: In the present study, the etiological trends in male central precocious puberty (CPP) were examined, and annual distribution was evaluated. Methods: Seventy-one male CPP subjects who started puberty before 9 years of age were included in this study. All individuals were diagnosed as having CPP at Samsung Medical Center between 2001 and 2016. Chronological age at puberty onset, diagnosis of CPP, bone age, weight (kg), height (cm), puberty stage, brain magnetic resonance imaging findings, testosterone level, basal gonadotropin level, and gonadotropin level after gonadotropin releasing hormone stimulation were analyzed. Results: The 71 patients were divided into 2 groups: idiopathic (group I) and organic (group II) when the lesion was identified as associated with the central nervous system (CNS) or when the patient received chemotherapy for non-CNS tumors before CPP diagnosis, respectively. Forty-four cases (62%) were idiopathic, and 27 (38%) were organic. The proportion of idiopathic CPP was higher than that of organic CPP during the study period. In 51.9% of organic cases, puberty started before 8 years of age, whereas it started after that age in 93.2% of the idiopathic cases. Conclusion: In the present study, among all male CPP cases, 62% were idiopathic. The probability of idiopathic CPP prevalence was higher in males when the puberty onset was after 8 years of age with no history of cranial radiotherapy or chemotherapy. [ABSTRACT FROM AUTHOR]
- Published
- 2018
- Full Text
- View/download PDF
392. De novo a novel variant of CaSR gene in a neonate with congenital hypoparathyroidism.
- Author
-
Jung-Eun Moon, Su-Jeong Lee, Suk-Hyun Park, Jinsup Kim, Dong-Kyu Jin, and Cheol Woo Ko
- Subjects
- *
HYPOPARATHYROIDISM , *CALCIUM-sensing receptors , *GENETIC mutation , *GENETICS - Abstract
Autosomal-dominant hypocalcemia with hypercalciuria (ADHH) is a genetic disease characterized by hypoparathyroidism with hypercalciuria. Most patients with ADHH have calcium-sensing receptor (CaSR) gene mutations. The CaSR gene controls parathyroid secretions, and mutations in this gene can be detected via changes in serum calcium level. The activating mutation of the CaSR gene results in familial or sporadic ADHH. Most activating mutations of the CaSR gene are reportedly de novo missense mutations. This is the first case report of a novel activating variant of the CaSR gene in a neonate with congenital hypoparathyroidism with hypomagnesemia and hypercalciuria. We also report the 3-month follow-up management of the patient. [ABSTRACT FROM AUTHOR]
- Published
- 2018
- Full Text
- View/download PDF
393. HDR syndrome with a novel mutation in GATA3 mimicking a congenital X-linked stapes gusher: a case report.
- Author
-
Aram Yang, Jinsup Kim, Chang-Seok Ki, Sung Hwa Hong, Sung Yoon Cho, and Dong-Kyu Jin
- Subjects
- *
HYPOPARATHYROIDISM , *COMPUTED tomography , *GENETIC polymorphisms , *GENETIC carriers - Abstract
Background: Hypoparathyroidism, sensorineural hearing loss, and renal disease (HDR) syndrome, also known as Barakat syndrome, is a rare genetic disorder with high phenotypic heterogeneity caused by haploinsufficiency of the GATA3 gene on chromosome 10p14-p15. For these reasons, the diagnosis of HDR syndrome is challenging and requires a high index of suspicion as well as genetic analysis. Case presentation: A 14-month-old boy, with sensorineural hearing loss in both ears, showed typical radiological features of X-linked stapes gusher on preoperative temporal bone computed tomography (CT) for cochlear implantations. Then after his discharge from hospital, he suffered a hypocalcemic seizure and we discovered a renal cyst during investigation of hypocalcemia. He was finally diagnosed with HDR syndrome by clinical findings, which were confirmed by molecular genetic testing. Direct sequencing of the GATA3 gene showed a heterozygous 2-bp deletion (c.1201_1202delAT), which is predicted to cause a frameshift of the reading frame (p.Met401Valfs*106). Conclusions: To our knowledge, this is the first case of HDR syndrome with a novel de novo variant mimicking a congenital X-linked stapes gusher syndrome. Novel mutations and the diversity of clinical manifestations expand the genotypic and phenotypic spectrum of HDR syndrome. Diagnosis of HDR syndrome is still challenging, but clinicians should consider it in their differential diagnosis for children with a wide range of clinical manifestations including hypocalcemia induced seizures and deafness. We hope that this case will contribute to further understanding and studies of HDR-associated GATA3 mutations. [ABSTRACT FROM AUTHOR]
- Published
- 2017
- Full Text
- View/download PDF
394. Prevalence and risk factors for type 2 diabetes mellitus with Prader-Willi syndrome: a single center experience.
- Author
-
Aram Yang, Jinsup Kim, Sung Yoon Cho, Dong-Kyu Jin, Yang, Aram, Kim, Jinsup, Cho, Sung Yoon, and Jin, Dong-Kyu
- Subjects
- *
TYPE 2 diabetes , *PRADER-Willi syndrome , *OBESITY , *DISEASE prevalence , *DISEASE risk factors , *LOGISTIC regression analysis , *INSULIN resistance , *BODY mass index , *RETROSPECTIVE studies - Abstract
Background: Prader-Willi syndrome (PWS) is often related to severe obesity and type-2 diabetes mellitus (T2DM). However, few studies, and none in Korea, have examined prevalence of T2DM and other variables in PWS. The aim of this study was to identify the prevalence and associated risk factors for T2DM in Korean patients with PWS.Methods: We performed a retrospective cohort study of the 84 PWS patients aged 10 or over (10.3-35.8 years of age) diagnosed with PWS at Samsung Medical Center from 1994 to 2016. We estimated occurrence of T2DM according to age (10-18 years versus >18 years), body mass index (BMI), genotype, history of growth hormone therapy, homeostasis model of assessment-insulin resistance (HOMA-IR), and the presence of dyslipidemia, hypogonadism, or central precocious puberty. Additionally, we investigated cutoff values of risk factors for development of T2DM.Results: Twenty-nine of a total 211 patients, diagnosed with PWS over the study period, were diagnosed as having T2DM (13.7%, mean age 15.9 ± 3.6 years). In the >18 years group, obesity, HOMA-IR, and presence of dyslipidemia, hypogonadism, or central precocious puberty were associated with the occurrence of T2DM in univariate analysis. In multivariate logistic regression analysis, only obesity (p = 0.001) and HOMA-IR (p < 0.001) were significant predictive factors for T2DM. Based on the receiver operating a characteristic curve analysis, the cutoff values of HOMA-IR and BMI for predicting T2DM were >2.7 and >28.49 kg/m2, respectively. Of the 29 patients, seven had ≥1 microvascular complication, with non-proliferative diabetic retinopathy in 6 of 7 cases. Advanced age and HOMA-IR were positively correlated with diabetic microvascular complications (p < 0.05, Spearman correlation coefficient 0.393 and 0.434, respectively).Conclusions: The prevalence of diabetes in Korean PWS was similar to that in previous results. BMI and HOMA-IR were strong predictive factors for the development of T2DM in PWS. We specifically suggest the regular monitoring of glucose homeostasis parameters through a detailed settlement of ethnically specific cutoff values for BMI and HOMA-IR in PWS to prevent progression of T2DM and diabetic microvascular complications. [ABSTRACT FROM AUTHOR]- Published
- 2017
- Full Text
- View/download PDF
395. 2q37 Deletion syndrome confirmed by high-resolution cytogenetic analysis.
- Author
-
Eun-Kyung Cho, Jinsup Kim, Aram Yang, Sung Yoon, and Dong-Kyu Jin
- Subjects
- *
CHROMOSOME abnormalities , *BRACHYDACTYLY , *CARDIOMYOPATHIES , *CONGENITAL heart disease , *PSEUDO-pseudohypoparathyroidism , *AUTISM spectrum disorders , *FACIAL abnormalities , *HUMAN cytogenetics - Abstract
Chromosome 2q37 deletion syndrome is a rare chromosomal disorder characterized by mild to moderate developmental delay, brachydactyly of the third to fifth digits or toes, short stature, obesity, hypotonia, a characteristic facial appearance, and autism spectrum disorder. Here, we report on a patient with 2q37 deletion presenting with dilated cardiomyopathy (DCMP). Congenital heart malformations have been noted in up to 20% of patients with 2q37 deletions. However, DCMP has not been reported in 2q37 deletion patients previously. The patient exhibited the characteristic facial appearance (a flat nasal bridge, deep-set eyes, arched eyebrows, and a thin upper lip), developmental delay, mild mental retardation, peripheral nerve palsy, and Albright hereditary osteodystrophy (AHO)-like phenotypes (short stature and brachydactyly). Conventional chromosomal analysis results were normal; however, microarray-based comparative genomic hybridization revealed terminal deletion at 2q37.1q37.3. In addition, the patient was confirmed to have partial growth hormone (GH) deficiency and had shown a significant increase in growth rate after substitutive GH therapy. Chromosome 2q37 deletion syndrome should be considered in the differential diagnosis of patients presenting with AHO features, especially in the presence of facial dysmorphism. When patients are suspected of having a 2q37 deletion, high-resolution cytogenetic analysis is recommended. [ABSTRACT FROM AUTHOR]
- Published
- 2017
- Full Text
- View/download PDF
396. Clinical, radiologic, and genetic features of Korean patients with Mucopolysaccharidosis IVA
- Author
-
Na Hee Lee, Sung Yoon Cho, Se Hyun Maeng, Tae Yeon Jeon, Young Bae Sohn, Su Jin Kim, Hyung-Doo Park, and Dong Kyu Jin
- Subjects
Mucopolysaccharidosis IVA ,Atlantoaxial subluxation ,Morquio A syndrome ,Pediatrics ,RJ1-570 - Abstract
PurposeMucopolysaccharidosis IVA (MPS IVA; Morquio A syndrome) is rare lysosomal storage disorder caused by N-acetylgalactosamine-6-sulfatase (GALNS) deficiency. Only a few MPS IVA cases have been reported in the Korean literature; there is a paucity of research about clinical or radiologic findings for this disorder. Therefore, we studied clinical findings, radiological features, and genetic data of Korean MPS IVA patients for determining factors that may allow early diagnosis and that may thus improve the patients' quality of life.MethodMPS IVA was confirmed via assay for enzymatic activity of leukocytes in 10 patients. The GALNS gene was analyzed. Patients' charts were retrospectively reviewed for obtaining clinical features and evaluated for radiological skeletal surveys, echocardiography, pulmonary function test, and ophthalmologic test results.ResultNine patients had severe clinical phenotype, and 1 had an intermediate phenotype, on the basis of clinical phenotype criteria. Radiologic findings indicated skeletal abnormalities in all patients, especially in the hips and extremities. Eight patients had an odontoid hypoplasia, and 1 showed mild atlantoaxial subluxation and cord myelopathy. Genetic analysis indicated 10 different GALNS mutations. Two mutations, c.451C>A and c.1000C>T, account for 37.5% (6/16) and 25% (4/16) of all mutations in this samples, respectively.ConclusionAn understanding of the clinical and radiological features involved in MPS IVA may allow early diagnosis of MPS IVA. Adequate evaluations and therapy in the early stages may improve the quality of life of patients suffering from skeletal abnormalities and may reduce life-threatening effects of atlantoaxial subluxation.
- Published
- 2012
- Full Text
- View/download PDF
397. A Report of an Indian Boy with a Delayed Diagnosis of Pseudochondroplasia
- Author
-
Ankur Singh, T Abiramalatha, Gaurav Pradhan, Dong- Kyu Jin, and Seema Kapoor
- Subjects
pseudochondroplasia ,multiple epiphyseal dysplasia ,comp gene ,Medicine - Abstract
The mutations in the Cartilage Oligomeric Matrix Protein (COMP) gene are associated two common and allelic bony dysplasias: Psuedoachondroplasia (PSACH) and Multiple epiphyseal dysplasias-1 (MED-1). The characteristic radiological features of both has been well established in the literature, with areas of overlap between the two in certain forms of mild PSACH and severe MED. MED is also a genotypically and a phenotypically heterogeneous disease. Here, we emphasise the salient radiological features which aid in the diagnosis of PSACH and COMP MED; which may enable a targeted molecular analysis.
- Published
- 2013
- Full Text
- View/download PDF
398. Three-Year Patient-Related and Stent-Related Outcomes of Second-Generation Everolimus-Eluting Xience V Stents Versus Zotarolimus-Eluting Resolute Stents in Real-World Practice (from the Multicenter Prospective EXCELLENT and RESOLUTE-Korea Registries).
- Author
-
Joo Myung Lee, Kyung Woo Park, Jung-Kyu Han, Han-Mo Yang, Hyun-Jae Kang, Bon-Kwon Koo, Jang-Whan Bae, Sung-ll Woo, Jin Sik Park, Dong-Kyu Jin, Dong Woon Jeon, Seok Kyu Oh, Jong-Seon Park, Doo-ll Kim, Min Su Hyon, Hui-Kyung Jeon, Do-Sun Lim, Myeong-Gon Kim, Seung-Woon Rha, and Sung-Ho Her
- Subjects
- *
DRUG-eluting stents , *EVEROLIMUS , *THROMBOSIS , *TISSUE wounds , *CHRONIC kidney failure , *SURGICAL stents , *HEART diseases , *THERAPEUTICS - Abstract
Long-term outcomes are imperative to confirm safety of drug-eluting stents. There have been 2 randomized controlled trials comparing everolimus-eluting stents (EESs) and Resolute zotarolimus-eluting stents (ZES-Rs). To date, long-term clinical outcomes of these stents were limited to only 1 report, which has recently reported 4-year comparisons of these stents. Therefore, more evidence is needed regarding long-term clinical outcomes of the second-generation stents. This study compared the long-term clinical outcomes of EES with ZES-R in "all-comer" cohorts up to 3-year follow-up. The EXCELLENT and RESOLUTEKorea registries prospectively enrolled 3,056 patients treated with EES and 1,998 with ZESR, respectively, without exclusions. Stent-related composite outcomes (target lesion failure) and patient-related composite events up to 3-year follow-up were compared in crude and propensity score--matched analyses. Of 5,054 patients, 3,830 patients (75.8%) had off-label indication (2,217 treated with EES and 1,613 treated with ZES-R). The stent-related outcome (189 [6.2%] vs 127 [6.4%], p = 0.812) and the patient-related outcome (420 [13.7%] vs 250 [12.5%], p = 0.581) did not differ between EES and ZES-R, respectively, at 3 years, which was corroborated by similar results from the propensity score--matched cohort (hazard ratio [HR] 0.92, 95% confidence interval [CI] 0.70 to 1.20, p = 0.523 and 0.85, 95% CI 0.70 to 1.02, p = 0.081, for stent- and patient-related outcomes, respectively). The rate of definite or probable stent thrombosis up to 3 years (22 [0.7%] vs 10 [0.5%], p = 0.370) was also similar. The rate of very late definite or probable stent thrombosis was very low and comparable between the 2 stents (3 [0.1%] vs 1 [0.1%], p = 0.657). In multivariate analysis, chronic renal failure (adjusted HR 3.615, 95% CI 2.440 to 5.354, p <0.001) and off-label indication (adjusted HR 1.782, 95% CI 1.169 to 2.718, p = 0.007) were the strongest predictors of target lesion failure at 3 years. In conclusion, both stents showed comparable safety and efficacy at 3-year follow-up in this robust real-world registry with unrestricted use of EES and ZES-R. Overall incidences of target lesion failure and definite stent thrombosis, including very late stent thrombosis, were low, even in the patients with off-label indications, suggesting excellent long-term safety and sustained efficacy of both types of second-generation drug-eluting stents. [ABSTRACT FROM AUTHOR]
- Published
- 2014
- Full Text
- View/download PDF
399. Effects of Hormone Replacement Therapy on Plaque Stability, Inflammation, and Fibrinolysis in Hypertensive or Overweight Postmenopausal Women.
- Author
-
Kwang Kon Koh, Jeong Yeal Ahn, Moon Ho Kang, Dae Sung Kim, Dong Kyu Jin, Min Soo Sohn, Gi Soo Park, In Suck Choi, and Eak Kyun Shin
- Subjects
- *
HORMONE therapy for menopause , *CARDIOVASCULAR system , *THROMBOSIS , *LIPOPROTEINS - Abstract
Studies the effects of hormone replacement therapy (HRT) on plaque stability, inflammatory responses and fibrinolysis in hypertensive or overweight postmenopausal women. Potential of non-lipid mechanisms of HRT to contribute to the cardiovascular event reduction in hypertensive and/or overweight postmenopausal women, independent of lipoprotein changes; Likelihood that HRT may provoke thrombosis.
- Published
- 2001
- Full Text
- View/download PDF
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.