Search

Leprechaunism features a clinical constellation characterized by extreme insulin resistance, growth retardation, and several distinct developmental abnormalities. One puzzling observation about leprechaunism is that mutations in the insulin receptor gene frequently associated with this syndrome cannot account for the aberrant responses of cultured cells to other growth factors. Here we report that the generation of reactive oxygen species (ROS) is impaired in cells from leprechaunism patients, thus shedding new light on this issue. Stimulation of patients' skin fibroblast cells with platelet-derived growth factor (PDGF) resulted in a lower-level tyrosine phosphorylation of cytosolic proteins compared with that seen in normal cells. In addition, consistent with the hypothesis that ROS mediate the level of tyrosine phosphorylation of cytosolic proteins through inactivation of protein tyrosine phosphatases (PTPases), patient fibroblast cells showed a significantly higher phosphatase activity than normal cells. We further showed that the lower-level tyrosine phosphorylation in response to growth factors results from the downregulation of an NADPH oxidase, Nox4, which in turn results in the reduction of ROS generation. Ectopic expression of Nox4 in the patient fibroblast cells consistently restored PDGF-induced ROS production and regulation of PTPase activities. Taken together, these data provide insight into the mechanisms through which growth retardation is associated with leprechaunism syndrome. [ABSTRACT FROM AUTHOR]

Spinocerebellar ataxia type-3 or Machado–Joseph disease (SCA3/MJD) is an autosomal dominant neurodegenerative disease caused by triplet nucleotide expansion. The expansion of the polyglutamine tract near the C terminus of the MJD1 gene product, ataxin-3, above a threshold of 40 glutamine repeats causes neuronal loss and degeneration. The expanded ataxin-3 forms aggregates, and nuclear inclusions, within neurons, possibly due to the misfolding of mutant proteins. Here we report upon the behavioral test changes related to truncated and expanded forms of MJD protein (MJDtr) in Drosophila, and show that expanded MJDtr, when expressed in the nervous system, causes characteristic locomotor dysfunction and anosmia. This phenomenon has not been previously reported in humans or in transgenic Drosophila models. In addition, the in vivo expression of the antiapoptotic gene bcl-2 showed no evidence of ameliorating the deleterious effect of MJDtr-Q78s, either in the eye or in the nervous system. The study shows that such Drosophila transgenic models express olfactory dysfunction and ataxic behavior as observed in human patients. [ABSTRACT FROM AUTHOR]

A DNA ligase gene from the hyperthermophilic bacterium Aquifex pyrophilus (Ap) was cloned and sequenced. An open reading frame of 2,157 bp that codes for a 82-kDa protein showed 40%–60% homology with a series of NAD+-dependent DNA ligases from different organisms. The recombinant enzyme Ap DNA ligase expressed in Escherichia coli was purified to homogeneity and characterized. The activity of Ap DNA ligase gradually increased in proportion to the concentration of monovalent salt up to 200 mM NaCl, 150 mM KCl, 200 mM NH4Cl, and 350 mM potassium glutamate. The optimum temperature and pH of Ap DNA ligase were greater than 65°C and 8.0–8.6, respectively, for nick-closing activity. More than 75% of the ligation activity was retained after incubation at 95°C for 60 min, whereas the half-lives of Thermus aquaticus and Escherichia coli DNA ligases at 95°C were ≤15 min and 5 min, respectively. Thermostable Ap DNA ligase was applied to repeat expansion detection (RED) and could be a useful enzyme in DNA diagnostics. [ABSTRACT FROM AUTHOR]

The mutations in the Cartilage Oligomeric Matrix Protein (COMP) gene are associated two common and allelic bony dysplasias: Psuedoachondroplasia (PSACH) and Multiple epiphyseal dysplasias-1 (MED-1). The characteristic radiological features of both has been well established in the literature, with areas of overlap between the two in certain forms of mild PSACH and severe MED. MED is also a genotypically and a phenotypically heterogeneous disease. Here, we emphasise the salient radiological features which aid in the diagnosis of PSACH and COMP MED; which may enable a targeted molecular analysis. [ABSTRACT FROM AUTHOR]

Prader-Willi syndrome (PWS) is a rare complex genetic disorder that results from a lack of expression of the paternally inherited chromosome 15q11-q13. PWS is characterized by hypotonia and feeding difficulty in early infancy and development of morbid obesity aggravated by uncontrolled hyperphagia after childhood and adolescent. Dysmorphic facial features, delayed motor and language development, various degrees of cognitive impairment, and behavioral problems are common in PWS. Without early, intensive nutritional therapy along with behavioral modification, PWS patients develop severe obesity associated with type 2 diabetes, obstructive sleep apnea, right-side heart failure, and other obesity-related metabolic complications. Hypothalamic dysfunction in PWS can lead to several endocrine disorders, including short stature with growth hormone deficiency, hypothyroidism, central adrenal insufficiency, and hypogonadism. In this review, we discuss the natural history of PWS and the mechanisms of hyperphagia and obesity. We also provide an update on obesity treatments and recommendations for screening and monitoring of various endocrine problems that can occur in PWS. [ABSTRACT FROM AUTHOR]

A letter to the editor is presented describing the case of a 4-year-old boy who was diagnosed with Lesch-Nyhan disease (LND) and was treated by peritoneal dialysis for four years.

Presents a letter to the editor about the article "Successful dialysis in a boy with methylmalonic acidemia."

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X?linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121?123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3?dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease. © 2003 Wiley?Liss, Inc. [ABSTRACT FROM AUTHOR]

An abstract of the study "Clinical, Biochemical, and Genetic Analysis of Two Korean Patients With Trichorhinophalangeal Syndrome Type 1 and Growth Hormone Deficiency" by Young Bae Sohn et al is presented.

An abstract of the study "Serum Levels of FGF21 Are Reduced and Negatively Correlated With Adiponectin in Children With Prader-Willi Syndrome" by Su Jin Kim et al is presented.

Coffin-Lowry syndrome (CLS, OMIM # 303600) is a rare X-linked disorder caused by mutations in RPS6KA3. CLS is characterized by facial dysmorphism, digit abnormalities, developmental delays, growth retardation, and progressive skeletal changes in male patients. Females with CLS are variably affected, complicating diagnosis. Here, we describe the clinical and molecular findings in a female Korean child with CLS and review the associated literature. A 5-year-old girl presented with short stature and developmental delays. She had a coarse facial appearance characterized by a prominent forehead, hypertelorism, thick lips, and hypodontia. She also had puffy tapering fingers and pectus excavatum. We performed exome sequencing and identified a novel, likely pathogenic, heterozygous variant, c.326_338delinsCTCGAGAC (p.Val109Alafs*10), in RPS6KA3 (NM_004586.2). This is the first Korean female genetically diagnosed with CLS. In contrast to the delayed bone age reported in previous studies, our patient showed advanced bone age and central precocious puberty. CLS should be considered as a differential diagnosis of short stature, tapering fingers, and developmental delay. We suggest that molecular techniques can be a useful tool for diagnosis of rare disorders such as CLS because such conditions are not simple, and the associated spectrum of phenotypes can vary. [ABSTRACT FROM AUTHOR]

Abstract Background Alternating of Childhood (AHC) is an uncommon and complex disorder characterized by age of onset before 18 months with recurrent hemiplegia of one or either sides of the body or quadriplegia. The disorder is mainly caused by mutations in ATP1A3 gene, and to a lesser extent in ATP1A2 gene. In AHC neurological co-morbidities are various and frequently reported including developmental delay, epilepsy, tonic or dystonic spells, nystagmus,autonomic manifestations with intrafamilial variability. Case presentation Clinical and genetic findings of a couple of twins (Family 1: Case 1 and Case 2) and a couple of siblings (Family 2: Case 3 and Case 4) coming from two different Italian families affected by AHC were deeply examined. In twins of Family 1, a pathogenic variant in ATP1A3 gene (c.2318A>G) was detected. In siblings of Family 2, the younger brother showed a novel GRIN2A variant (c.3175 T > A), while the older carried the same GRIN2A variant, and two missense mutations in SCNIB (c.632 > A) and KCNQ2 (1870 G > A) genes. Clinical manifestations of the four affected children were reported along with cases of AHC drawn from the literature. Conclusions Hemiplegic episode is only a sign even if the most remarkable of several and various neurological comorbidities in AHC affected individuals. Molecular analysis of the families here reported showed that clinical features of AHC may be also the result of an unexpected genetic heterogeneity.

Wilson disease (WD) is a relatively common genetic hepatic disease in children and is characterized by excessive copper accumulation, predominantly in the liver and brain. It is an autosomal recessive disease caused by an ATP7B mutation that causes brain degeneration and is potentially fatal if diagnosed late or untreated. In the early phase of WD, its initial presentation may include mild hepatic involvement. WD may be overlooked as a cause of liver disease due to severe obesity but should not be excluded from differential diagnosis. We report a case of WD with severe obesity and fatty liver diagnosed in the early phase by targeted gene panel sequencing and review the endocrine problems associated with WD. Early suspicion of WD is important for good prognosis. [ABSTRACT FROM AUTHOR]

Osteopetrosis refers to a group of genetic skeletal disorders characterized by osteosclerosis and fragile bones. Osteopetrosis can be classified into autosomal dominant, autosomal recessive, or X-linked forms, which might differ in clinical characteristics and disease severity. Autosomal recessive osteopetrosis, also known as malignant osteopetrosis, has an earlier onset, more serious clinical symptoms, and is usually fatal. We encountered a 1-day-old girl who was born full-term via vaginal delivery, which was complicated by meconium-stained amniotic fluid, cephalo-pelvic disproportion, and nuchal cord. Routine neonatal care was provided, in addition to blood tests and chest radiography to screen for sepsis, as well as skull radiography to rule out head injuries. Initial blood tests revealed hypocalcemia, which persisted on follow-up tests the next day. Radiographic examinations revealed diffusely increased bone density and a "space alien" appearance of the skull. Based on radiographic and laboratory findings, the infantile form of osteopetrosis was suspected and genetic testing for identification of the responsible gene. Eventually, a heterozygous mutation of the T cell immune regulator 1, ATPase H+ transporting V0 subunit a3 (TCIRG1) gene (c.292C>T) was identified, making this the first reported case of neonatal-onset malignant osteopetrosis with TCIRG1 mutation in South Korea. Early-onset hypocalcemia is common and usually results from prematurity, fetal growth restriction, maternal diabetes, perinatal asphyxia, and physiologic hypoparathyroidism. However, if hypocalcemia persists, we recommend considering 'infantile of osteopetrosis' as a rare cause of neonatal hypocalcemia and performing radiographic examinations to establish the diagnosis.

Prader-Willi syndrome (PWS) is characterized by hypotonia, distinctive facial features, hyperphagia, obesity, short stature, hypogonadism, intellectual disability, and behavior problems. Uncontrolled hyperphagia can lead to dangerous foodseeking behavior and with life-threatening obesity. Severe obesity is prone to obstructive sleep apnea (OSA) and can lead to cor pulmonale. This study reports on a case involving a 21-year-old man with PWS who developed OSA due to severe obesity, which led to cor pulmonale, a life-threatening complication. Multidisciplinary care provided in the intensive care unit included weight reduction, ventilation support, antipsychotics, sedative drugs, rehabilitation, and meticulous skin care. The patient did recover. To prevent severe obesity in adults with PWS, hyperphagia must be controlled, and the patient must also be managed by an endocrinologist throughout childhood. [ABSTRACT FROM AUTHOR]

Abstract Background BENEFIT-KOREA (BEnefits after 24 weeks of NEbivolol administration For essential hypertensIon patients wiTh various comorbidities and treatment environments in Korea) study, an observational study in South Korea, demonstrated the efficacy and safety of nebivolol in Asian patients with essential hypertension with and without comorbidities in real-world settings. We present a subanalysis of the efficacy and safety of nebivolol across age and sex in the BENEFIT-KOREA cohort. Methods Adult South Korean patients with essential hypertension participated in the prospective, single-arm, open, observational BENEFIT-KOREA study; 3011 patients received nebivolol as monotherapy or add-on therapy. Changes in systolic blood pressure (SBP) and diastolic blood pressure (DBP), and pulse rate at 12 and 24 weeks were evaluated. Participants were divided into three age groups—young males and females:

Diabetic ketoacidosis (DKA) is a medically fatal condition in poorly controlled hyperglycemia or newly diagnosed diabetes mellitus. Severe hypertriglyceridemia (HTG) is an uncommon complication of DKA and can be associated with acute pancreatitis (AP). We present the clinical manifestations, laboratory findings, and management of AP associated with HTG in a 14-year-old girl with DKA. The patient, with a 7-year history of type 2 diabetes presented with epigastric pain, 1 month after stopping insulin injection. DKA, severe HTG, and AP were diagnosed based on the laboratory and imaging tests. She recovered from DKA after conventional treatment for DKA, and her triglyceride (TG) level was reduced from 10,867 mg/dL to the normal range after 7 days of admission without antilipid medication. Given that her C-peptide level was not too low and considering her negative diabetes-related antibodies and high TG level, targeted gene panel sequencing was performed on the genes associated with diabetes and HTG. We identified a heterozygous mutation, c.4607C>T (p. Ala1537Val), in ABCC8 related to maturityonset diabetes of the young (MODY) 12. To our knowledge, this is the first reported case of HTG-induced AP with DKA in a patient with MODY. In addition, we reviewed the literature for pediatric cases of HTG with DKA. In patients with DKA, timely awareness of severe HTG related to insulin deficiency is crucial for improving the consequences of AP. We recommend considering AP in all DKA patients presenting with severe HTG to ensure early and proper management. [ABSTRACT FROM AUTHOR]

Objectives: Hyperphagia is a highly stressful, life-threatening feature of Prader-Willi syndrome (PWS). It is important to assess this complex behavior accurately over time. This study aimed to develop and validate the Pediatric-Youth Hyperphagia Assessment for Prader-Willi syndrome (PYHAP) as a tool targeting children and adolescents.Methods: After an extensive literature review and qualitative interviews, the final version of the PYHAP with 14 questions in 3 domains (verbal [5], behavior [4], and social [5]) was developed and tested at Samsung Medical Center in Seoul, Korea from July 2018 to September 2019. Exploratory factor analysis and confirmatory factor analysis (CFA) were performed to confirm construct validity. The correlations between the PYHAP and the Korean Children's Eating Behavior Questionnaire (K-CEBQ) were calculated to evaluate convergent and discriminant validity. Criterion validity and the validity of the response categories were also tested.Results: Cronbach's alpha coefficient of the PYHAP was 0.91. The fit indices for CFA were good (comparative fit index, 0.87; standardized root mean squared residual, 0.08). The domains of the PYHAP were closely correlated with the relevant domains of the K-CEBQ. The accuracy of the PYHAP score for predicting uncontrolled hyperphagia was good (area under the curve, 0.75; 95% confidence interval, 0.65 to 0.85).Conclusions: The PYHAP was confirmed to be a reliable and valid tool to evaluate hyperphagia in children and adolescents with PWS via caregivers' assessments. It is recommended to use the PYHAP to communicate with parents or caregivers about patients' hyperphagia or to monitor and manage extreme behaviors in children with PWS. [ABSTRACT FROM AUTHOR]

Abstract Background Mutations in Proline-rich Transmembrane Protein 2 (PRRT2) have been primarily associated with individuals presenting with infantile epilepsy, including benign familial infantile epilepsy, benign infantile epilepsy, and benign myoclonus of early infancy, and/or with dyskinetic paroxysms such as paroxysmal kinesigenic dyskinesia, paroxysmal non-kinesigenic dyskinesia, and exercise-induced dyskinesia. However, the clinical manifestations of this disorder vary widely. PRRT2 encodes a protein expressed in the central nervous system that is mainly localized in the pre-synaptic neurons and is involved in the modulation of synaptic neurotransmitter release. The anomalous function of this gene has been proposed to cause dysregulation of neuronal excitability and cerebral disorders. Case presentation We hereby report on a young child followed-up for three years who presents with a spectrum of clinical manifestations such as congenital microcephaly, dysmorphic features, severe intellectual disability, and drug-resistant epileptic encephalopathy in association with a synonymous variant in PRRT2 gene (c.501C > T; p.Thr167Ile) of unknown clinical significance variant (VUS) revealed by diagnostic exome sequencing. Conclusion Several hypotheses have been advanced on the specific role that PRRT2 gene mutations play to cause the clinical features of affected patients. To our knowledge, the severe phenotype seen in this case has never been reported in association with any clinically actionable variant, as the missense substitution detected in PRRT2 gene. Intriguingly, the same mutation was reported in the healthy father: the action of modifying factors in the affected child may be hypothesized. The report of similar observations could extend the spectrum of clinical manifestations linked to this mutation.

Congenital lipoid adrenal hyperplasia (CLAH) is one of the most fatal conditions caused by an abnormality of adrenal and gonadal steroidogenesis. CLAH results from loss-of-function mutations of the steroidogenic acute regulatory (STAR) gene; the disease manifests with electrolyte imbalances and hyperpigmentation in neonates or young infants due to adrenocortical hormone deficiencies, and 46, XY genetic male CLAH patients can be phenotypically female. Meanwhile, some patients with STAR mutations develop hyperpigmentation and mild signs of adrenal insufficiency, such as hypoglycemia, after infancy. These patients are classified as having nonclassic CLAH (NCCLAH) caused by STAR mutations that retain partial activity of STAR. We present the case of a Korean boy with normal genitalia who was diagnosed with NCCLAH. He presented with whole-body hyperpigmentation and electrolyte abnormalities, which were noted at the age of 17 months after an episode of sepsis with peritonitis. The compound heterozygous mutations p.Gly221Ser and c.653C>T in STAR were identified by targeted gene-panel sequencing. Skin hyperpigmentation should be considered an important clue for diagnosing NCCLAH. [ABSTRACT FROM AUTHOR]

Purpose: Pompe disease (PD) is an autosomal recessive disorder caused by a deficiency of acid alphaglucosidase resulting from pathogenic GAA variants. This study describes the clinical features, genotypes, changes before and after enzyme replacement therapy (ERT), and long-term outcomes in patients with infantile-onset PD (IOPD) and late-onset PD (LOPD) at a tertiary medical center. Methods: The medical records of 5 Korean patients (2 male, 3 female patients) diagnosed with PD between 2002 and 2013 at Samsung Medical Center in Seoul, Republic of Korea were retrospectively reviewed for data, including clinical and genetic characteristics at diagnosis and clinical course after ERT. Results: Common initial symptoms included hypotonia, cyanosis, and tachycardia in patients with IOPD and limb girdle weakness in patients with LOPD. Electrocardiography at diagnosis revealed hypertrophic cardiomyopathy in all patients with IOPD who showed a stable disease course during a median follow-up period of 10 years. Patients with LOPD showed improved hepatomegaly and liver transaminase level after ERT. Conclusion: As ERT is effective for treatment of PD, early identification of this disease is very important. Thus, patients with IOPD should be considered candidates for clinical trials of new drugs in the future. [ABSTRACT FROM AUTHOR]

Deletion on the short arm of chromosome 18 is a rare disorder characterized by intellectual disability, growth retardation, and craniofacial malformations (such as prominent ears, microcephaly, ptosis, and a round face). The phenotypic spectrum is wide, encompassing a range of abnormalities from minor congenital malformations to holoprosencephaly. We present a case of a 2-year-old girl with ptosis, a round face, broad neck with low posterior hairline, short stature, and panhypopituitarism. She underwent ventilation tube insertion for recurrent otitis media with effusion. Brain magnetic resonance imaging showed an ectopic posterior pituitary gland and a shallow, small sella turcica with poor visualization of the pituitary stalk. Cytogenetic and chromosomal microarray analysis revealed a de novo deletion on the short arm of chromosome 18 (arr 18p11.32p11.21[136,227-15,099,116]x1). She has been treated with recombinant human growth hormone (GH) therapy since the age of 6 months after diagnosis of GH deficiency. Her growth rate has improved without any side effects from the GH treatment. This case expands the phenotypic spectrum of 18p deletion syndrome and emphasizes the positive impact of GH therapy on linear growth in this syndrome characterized by growth deficiency. Further studies are required to define the genotype-phenotype correlation according to size and loci of the deletion in 18p deletion syndrome and to predict prognosis. [ABSTRACT FROM AUTHOR]

X-linked hypophosphatemic rickets is caused by loss-of-function mutations in PHEX, which encodes a phosphate-regulating endopeptidase homolog. We report a 26-year-old man with X-linked hypophosphatemic rickets who showed decreased serum phosphate accompanied by bilateral genu valgum and short stature. He had received medical treatment with vitamin D (alfacalcidol) and phosphate from the age of 3 to 20 years. He underwent surgery due to valgus deformity at the age of 14 and 15. Targeted gene panel sequencing for Mendelian genes identified a nonsense mutation in PHEX (c.589C>T; p.Gln197Ter) and a mosaic pattern where only 38% of sequence reads showed the variant allele. This mutation was not found in his mother, who had a normal phenotype. This is a case of a sporadic nonsense mutation in PHEX and up to date, this is the first case of a mosaic mutation in PHEX in Korea. [ABSTRACT FROM AUTHOR]

Purpose: In the present study, the etiological trends in male central precocious puberty (CPP) were examined, and annual distribution was evaluated. Methods: Seventy-one male CPP subjects who started puberty before 9 years of age were included in this study. All individuals were diagnosed as having CPP at Samsung Medical Center between 2001 and 2016. Chronological age at puberty onset, diagnosis of CPP, bone age, weight (kg), height (cm), puberty stage, brain magnetic resonance imaging findings, testosterone level, basal gonadotropin level, and gonadotropin level after gonadotropin releasing hormone stimulation were analyzed. Results: The 71 patients were divided into 2 groups: idiopathic (group I) and organic (group II) when the lesion was identified as associated with the central nervous system (CNS) or when the patient received chemotherapy for non-CNS tumors before CPP diagnosis, respectively. Forty-four cases (62%) were idiopathic, and 27 (38%) were organic. The proportion of idiopathic CPP was higher than that of organic CPP during the study period. In 51.9% of organic cases, puberty started before 8 years of age, whereas it started after that age in 93.2% of the idiopathic cases. Conclusion: In the present study, among all male CPP cases, 62% were idiopathic. The probability of idiopathic CPP prevalence was higher in males when the puberty onset was after 8 years of age with no history of cranial radiotherapy or chemotherapy. [ABSTRACT FROM AUTHOR]

Autosomal-dominant hypocalcemia with hypercalciuria (ADHH) is a genetic disease characterized by hypoparathyroidism with hypercalciuria. Most patients with ADHH have calcium-sensing receptor (CaSR) gene mutations. The CaSR gene controls parathyroid secretions, and mutations in this gene can be detected via changes in serum calcium level. The activating mutation of the CaSR gene results in familial or sporadic ADHH. Most activating mutations of the CaSR gene are reportedly de novo missense mutations. This is the first case report of a novel activating variant of the CaSR gene in a neonate with congenital hypoparathyroidism with hypomagnesemia and hypercalciuria. We also report the 3-month follow-up management of the patient. [ABSTRACT FROM AUTHOR]

Background: Hypoparathyroidism, sensorineural hearing loss, and renal disease (HDR) syndrome, also known as Barakat syndrome, is a rare genetic disorder with high phenotypic heterogeneity caused by haploinsufficiency of the GATA3 gene on chromosome 10p14-p15. For these reasons, the diagnosis of HDR syndrome is challenging and requires a high index of suspicion as well as genetic analysis. Case presentation: A 14-month-old boy, with sensorineural hearing loss in both ears, showed typical radiological features of X-linked stapes gusher on preoperative temporal bone computed tomography (CT) for cochlear implantations. Then after his discharge from hospital, he suffered a hypocalcemic seizure and we discovered a renal cyst during investigation of hypocalcemia. He was finally diagnosed with HDR syndrome by clinical findings, which were confirmed by molecular genetic testing. Direct sequencing of the GATA3 gene showed a heterozygous 2-bp deletion (c.1201_1202delAT), which is predicted to cause a frameshift of the reading frame (p.Met401Valfs*106). Conclusions: To our knowledge, this is the first case of HDR syndrome with a novel de novo variant mimicking a congenital X-linked stapes gusher syndrome. Novel mutations and the diversity of clinical manifestations expand the genotypic and phenotypic spectrum of HDR syndrome. Diagnosis of HDR syndrome is still challenging, but clinicians should consider it in their differential diagnosis for children with a wide range of clinical manifestations including hypocalcemia induced seizures and deafness. We hope that this case will contribute to further understanding and studies of HDR-associated GATA3 mutations. [ABSTRACT FROM AUTHOR]

Background: Prader-Willi syndrome (PWS) is often related to severe obesity and type-2 diabetes mellitus (T2DM). However, few studies, and none in Korea, have examined prevalence of T2DM and other variables in PWS. The aim of this study was to identify the prevalence and associated risk factors for T2DM in Korean patients with PWS.Methods: We performed a retrospective cohort study of the 84 PWS patients aged 10 or over (10.3-35.8 years of age) diagnosed with PWS at Samsung Medical Center from 1994 to 2016. We estimated occurrence of T2DM according to age (10-18 years versus >18 years), body mass index (BMI), genotype, history of growth hormone therapy, homeostasis model of assessment-insulin resistance (HOMA-IR), and the presence of dyslipidemia, hypogonadism, or central precocious puberty. Additionally, we investigated cutoff values of risk factors for development of T2DM.Results: Twenty-nine of a total 211 patients, diagnosed with PWS over the study period, were diagnosed as having T2DM (13.7%, mean age 15.9 ± 3.6 years). In the >18 years group, obesity, HOMA-IR, and presence of dyslipidemia, hypogonadism, or central precocious puberty were associated with the occurrence of T2DM in univariate analysis. In multivariate logistic regression analysis, only obesity (p = 0.001) and HOMA-IR (p < 0.001) were significant predictive factors for T2DM. Based on the receiver operating a characteristic curve analysis, the cutoff values of HOMA-IR and BMI for predicting T2DM were >2.7 and >28.49 kg/m2, respectively. Of the 29 patients, seven had ≥1 microvascular complication, with non-proliferative diabetic retinopathy in 6 of 7 cases. Advanced age and HOMA-IR were positively correlated with diabetic microvascular complications (p < 0.05, Spearman correlation coefficient 0.393 and 0.434, respectively).Conclusions: The prevalence of diabetes in Korean PWS was similar to that in previous results. BMI and HOMA-IR were strong predictive factors for the development of T2DM in PWS. We specifically suggest the regular monitoring of glucose homeostasis parameters through a detailed settlement of ethnically specific cutoff values for BMI and HOMA-IR in PWS to prevent progression of T2DM and diabetic microvascular complications. [ABSTRACT FROM AUTHOR]

Chromosome 2q37 deletion syndrome is a rare chromosomal disorder characterized by mild to moderate developmental delay, brachydactyly of the third to fifth digits or toes, short stature, obesity, hypotonia, a characteristic facial appearance, and autism spectrum disorder. Here, we report on a patient with 2q37 deletion presenting with dilated cardiomyopathy (DCMP). Congenital heart malformations have been noted in up to 20% of patients with 2q37 deletions. However, DCMP has not been reported in 2q37 deletion patients previously. The patient exhibited the characteristic facial appearance (a flat nasal bridge, deep-set eyes, arched eyebrows, and a thin upper lip), developmental delay, mild mental retardation, peripheral nerve palsy, and Albright hereditary osteodystrophy (AHO)-like phenotypes (short stature and brachydactyly). Conventional chromosomal analysis results were normal; however, microarray-based comparative genomic hybridization revealed terminal deletion at 2q37.1q37.3. In addition, the patient was confirmed to have partial growth hormone (GH) deficiency and had shown a significant increase in growth rate after substitutive GH therapy. Chromosome 2q37 deletion syndrome should be considered in the differential diagnosis of patients presenting with AHO features, especially in the presence of facial dysmorphism. When patients are suspected of having a 2q37 deletion, high-resolution cytogenetic analysis is recommended. [ABSTRACT FROM AUTHOR]

PurposeMucopolysaccharidosis IVA (MPS IVA; Morquio A syndrome) is rare lysosomal storage disorder caused by N-acetylgalactosamine-6-sulfatase (GALNS) deficiency. Only a few MPS IVA cases have been reported in the Korean literature; there is a paucity of research about clinical or radiologic findings for this disorder. Therefore, we studied clinical findings, radiological features, and genetic data of Korean MPS IVA patients for determining factors that may allow early diagnosis and that may thus improve the patients' quality of life.MethodMPS IVA was confirmed via assay for enzymatic activity of leukocytes in 10 patients. The GALNS gene was analyzed. Patients' charts were retrospectively reviewed for obtaining clinical features and evaluated for radiological skeletal surveys, echocardiography, pulmonary function test, and ophthalmologic test results.ResultNine patients had severe clinical phenotype, and 1 had an intermediate phenotype, on the basis of clinical phenotype criteria. Radiologic findings indicated skeletal abnormalities in all patients, especially in the hips and extremities. Eight patients had an odontoid hypoplasia, and 1 showed mild atlantoaxial subluxation and cord myelopathy. Genetic analysis indicated 10 different GALNS mutations. Two mutations, c.451C>A and c.1000C>T, account for 37.5% (6/16) and 25% (4/16) of all mutations in this samples, respectively.ConclusionAn understanding of the clinical and radiological features involved in MPS IVA may allow early diagnosis of MPS IVA. Adequate evaluations and therapy in the early stages may improve the quality of life of patients suffering from skeletal abnormalities and may reduce life-threatening effects of atlantoaxial subluxation.

The mutations in the Cartilage Oligomeric Matrix Protein (COMP) gene are associated two common and allelic bony dysplasias: Psuedoachondroplasia (PSACH) and Multiple epiphyseal dysplasias-1 (MED-1). The characteristic radiological features of both has been well established in the literature, with areas of overlap between the two in certain forms of mild PSACH and severe MED. MED is also a genotypically and a phenotypically heterogeneous disease. Here, we emphasise the salient radiological features which aid in the diagnosis of PSACH and COMP MED; which may enable a targeted molecular analysis.

Long-term outcomes are imperative to confirm safety of drug-eluting stents. There have been 2 randomized controlled trials comparing everolimus-eluting stents (EESs) and Resolute zotarolimus-eluting stents (ZES-Rs). To date, long-term clinical outcomes of these stents were limited to only 1 report, which has recently reported 4-year comparisons of these stents. Therefore, more evidence is needed regarding long-term clinical outcomes of the second-generation stents. This study compared the long-term clinical outcomes of EES with ZES-R in "all-comer" cohorts up to 3-year follow-up. The EXCELLENT and RESOLUTEKorea registries prospectively enrolled 3,056 patients treated with EES and 1,998 with ZESR, respectively, without exclusions. Stent-related composite outcomes (target lesion failure) and patient-related composite events up to 3-year follow-up were compared in crude and propensity score--matched analyses. Of 5,054 patients, 3,830 patients (75.8%) had off-label indication (2,217 treated with EES and 1,613 treated with ZES-R). The stent-related outcome (189 [6.2%] vs 127 [6.4%], p = 0.812) and the patient-related outcome (420 [13.7%] vs 250 [12.5%], p = 0.581) did not differ between EES and ZES-R, respectively, at 3 years, which was corroborated by similar results from the propensity score--matched cohort (hazard ratio [HR] 0.92, 95% confidence interval [CI] 0.70 to 1.20, p = 0.523 and 0.85, 95% CI 0.70 to 1.02, p = 0.081, for stent- and patient-related outcomes, respectively). The rate of definite or probable stent thrombosis up to 3 years (22 [0.7%] vs 10 [0.5%], p = 0.370) was also similar. The rate of very late definite or probable stent thrombosis was very low and comparable between the 2 stents (3 [0.1%] vs 1 [0.1%], p = 0.657). In multivariate analysis, chronic renal failure (adjusted HR 3.615, 95% CI 2.440 to 5.354, p <0.001) and off-label indication (adjusted HR 1.782, 95% CI 1.169 to 2.718, p = 0.007) were the strongest predictors of target lesion failure at 3 years. In conclusion, both stents showed comparable safety and efficacy at 3-year follow-up in this robust real-world registry with unrestricted use of EES and ZES-R. Overall incidences of target lesion failure and definite stent thrombosis, including very late stent thrombosis, were low, even in the patients with off-label indications, suggesting excellent long-term safety and sustained efficacy of both types of second-generation drug-eluting stents. [ABSTRACT FROM AUTHOR]

Studies the effects of hormone replacement therapy (HRT) on plaque stability, inflammatory responses and fibrinolysis in hypertensive or overweight postmenopausal women. Potential of non-lipid mechanisms of HRT to contribute to the cardiovascular event reduction in hypertensive and/or overweight postmenopausal women, independent of lipoprotein changes; Likelihood that HRT may provoke thrombosis.