Search

Abstract Land surface greening has substantially changed the carbon sequestration and hydrological processes over Tibetan Plateau (TP). Previous studies have revealed that the increased total precipitation (Ptotal) is the main driver of the enhanced peak growth in TP. However, the role of precipitation pattern, especially the frequency of precipitation (Pfreq, number of rainy days [>0.1 mm]), has not been well analyzed. We used time series of satellite‐derived Normalized Difference Vegetation Index (NDVI) to investigate the effect of Pfreq in controlling the peak growth (the maximum of the NDVI [NDVImax]) of different vegetation types in TP for the period of 1982–2015. We found that the widespread greening trend with Ptotal disappeared when Pfreq was introduced as a controlling variable, and that Pfreq alone contributed more than Ptotal to the increase of NDVImax. The underlying mechanism for the higher contribution of Pfreq than Ptotal to NDVImax is that increased Pfreq significantly improved soil moisture, reduced daytime temperature while increased nighttime temperature, thereby alleviating summer drought. Our results highlight the importance of Pfreq in interpreting the variation of peak growth, and these effects might be better represented in ecosystem models by considering Pfreq rather than Ptotal alone with future climate change.

Abstract Background Millions of nucleotide variants are identified through cancer genome sequencing and it is clinically important to identify the pathogenic variants among them. By introducing base substitutions at guide RNA target regions in the genome, CRISPR-Cas9-based base editors provide the possibility for evaluating a large number of variants in their genomic context. However, the variability in editing efficiency and the complexity of outcome mapping are two existing problems for assigning guide RNA effects to variants in base editing screens. Results To improve the identification of pathogenic variants, we develop a framework to combine base editing screens with sgRNA efficiency and outcome mapping. We apply the method to evaluate more than 9000 variants across all the exons of BRCA1 and BRCA2 genes. Our efficiency-corrected scoring model identifies 910 loss-of-function variants for BRCA1/2, including 151 variants in the noncoding part of the genes such as the 5′ untranslated regions. Many of them are identified in cancer patients and are reported as “benign/likely benign” or “variants of uncertain significance” by clinicians. Our data suggest a need to re-evaluate their clinical significance, which may be helpful for risk assessment and treatment of breast and ovarian cancer. Conclusions Our results suggest that base editing screens with efficiency correction is a powerful strategy to identify pathogenic variants in a high-throughput manner. Applying this strategy to assess variants in both coding and noncoding regions of the genome could have a direct impact on the interpretation of cancer variants.

Dematiaceous Fonsecaea monophora is one of the major pathogens of chromoblastomycosis. It has been well established that melanization is catalyzed by the type I polyketide synthase (PKS) in F. monophora. Multidomain protein Type I PKS is encoded by six genes, in which the last enzyme thioesterase (TE) catalyzes the cyclization and releases polyketide. Two PKS genes AYO21_03016 (pks1) and AYO21_10638 have been found in F. monophora and both PKS loci have the same gene arrangement but the TE domain in AYO21_10638 is truncated at 3'- end. TE may be the key enzyme to maintain the function of pks1. To test this hypothesis, we constructed a 3'-end 500 bp deletion mutant of AYO21_03016 (Δpks1-TE-C500) and its complemented strain. We profiled metabolome of this mutant and analyzed the consequences of impaired metabolism in this mutant by fungal growth in vitro and by pathogenesis in vivo. Compared with wild-type strain, we found that the mutant repressed pks1 expression and other 5 genes expression levels were reduced by more than 50%, perhaps leading to a corresponding melanin loss. The mutant also reduced sporulation and delayed germination, became vulnerable to various environmental stresses and was less resistance to macrophage or neutrophil killings in vitro, and less virulence in mice footpad model. Metabolomic analysis indicated that many metabolites were remarkably affected in Δpks1-TE-C500, in particular, an increased nicotinamide and antioxidant glutathione. In conclusion, we confirmed the crucial role of C-terminal TE in maintaining fully function of pks1 in F. monophora. Deletion of TE negatively impacts on the synthesis of melanin and metabolites that eventually affect growth and virulence of F. monophora. Any potential inhibitor of TE then could be a novel antifungal target for drug development.

BackgroundHepatocellular carcinoma (HCC) is one of the most lethal human tumors with extensive intratumor heterogeneity (ITH). Serine protease 3 (PRSS3) is an indispensable member of the trypsin family and has been implicated in the pathogenesis of several malignancies, including HCC. However, the paradoxical effects of PRSS3 on carcinogenesis due to an unclear molecular basis impede the utilization of its biomarker potential. We hereby explored the contribution of PRSS3 transcripts to tumor functional heterogeneity by systematically dissecting the expression of four known splice variants of PRSS3 (PRSS3-SVs, V1~V4) and their functional relevance to HCC.MethodsThe expression and DNA methylation of PRSS3 transcripts and their associated clinical relevance in HCC were analyzed using several publicly available datasets and validated using qPCR-based assays. Functional experiments were performed in gain- and loss-of-function cell models, in which PRSS3 transcript constructs were separately transfected after deleting PRSS3 expression by CRISPR/Cas9 editing.ResultsPRSS3 was aberrantly differentially expressed toward bipolarity from very low (PRSS3Low) to very high (PRSS3High) expression across HCC cell lines and tissues. This was attributable to the disruption of PRSS3-SVs, in which PRSS3-V2 and/or PRSS3-V1 were dominant transcripts leading to PRSS3 expression, whereas PRSS3-V3 and -V4 were rarely or minimally expressed. The expression of PRSS3-V2 or -V1 was inversely associated with site-specific CpG methylation at the PRSS3 promoter region that distinguished HCC cells and tissues phenotypically between hypermethylated low-expression (mPRSS3-SVLow) and hypomethylated high-expression (umPRSS3-SVHigh) groups. PRSS3-SVs displayed distinct functions from oncogenic PRSS3-V2 to tumor-suppressive PRSS3-V1, -V3 or PRSS3-V4 in HCC cells. Clinically, aberrant expression of PRSS3-SVs was translated into divergent relevance in patients with HCC, in which significant epigenetic downregulation of PRSS3-V2 was seen in early HCC and was associated with favorable patient outcome.ConclusionsThese results provide the first evidence for the transcriptional and functional characterization of PRSS3 transcripts in HCC. Aberrant expression of divergent PRSS3-SVs disrupted by site-specific CpG methylation may integrate the effects of oncogenic PRSS3-V2 and tumor-suppressive PRSS3-V1, resulting in the molecular diversity and functional plasticity of PRSS3 in HCC. Dysregulated expression of PRSS3-V2 by site-specific CpG methylation may have potential diagnostic value for patients with early HCC.

Abstract Background Aroma, berry firmness and berry shape are three main quality traits in table grape production, and also the important target traits in grapevine breeding. However, the information about their genetic mechanisms is limited, which results in low accuracy and efficiency of quality breeding in grapevine. Mapping and isolation of quantitative trait locus (QTLs) based on the construction of genetic linkage map is a powerful approach to decipher the genetic determinants of complex quantitative traits. Results In the present work, a final integrated map consisting of 3411 SLAF markers on 19 linkage groups (LGs) with an average distance of 0.98 cM between adjacent markers was generated using the specific length amplified fragment sequencing (SLAF-seq) technique. A total of 9 significant stable QTLs for Muscat flavor, berry firmness and berry shape were identified on two linkage groups among the hybrids analyzed over three consecutive years from 2016 to 2018. Notably, new stable QTLs for berry firmness and berry shape were found on LG 8 respectively for the first time. Based on biological function and expression profiles of candidate genes in the major QTL regions, 3 genes (VIT_08s0007g00440, VIT_08s0040g02740 and VIT_08s0040g02350) related to berry firmness and 3 genes (VIT_08s0032g01110, VIT_08s0032g01150 and VIT_08s0105g00200) linked to berry shape were highlighted. Overexpression of VIT_08s0032g01110 in transgenic Arabidopsis plants caused the change of pod shape. Conclusions A new high-density genetic map with total 3411 markers was constructed with SLAF-seq technique, and thus enabled the detection of narrow interval QTLs for relevant traits in grapevine. VIT_08s0007g00440, VIT_08s0040g02740 and VIT_08s0040g02350 were found to be related to berry firmness, while VIT_08s0032g01110, VIT_08s0032g01150 and VIT_08s0105g00200 were linked to berry shape.

Brainstem gliomas are heterogenous in terms of clinical outcome and disease etiology. Here, the authors present a genetic and epigenetic landscape of brainstem gliomas, finding distinct epigenetic clusters associated with unique genetic and clinical profiles.

Abstract Background Stress-induced hormones are essential for plants to modulate their microbiota and dynamically adjust to the environment. Despite the emphasis of the role of the phytohormone ethylene in the plant physiological response to heterospecific neighbour detection, less is known about how this activated signal mediates focal plant rhizosphere microbiota to enhance plant fitness. Here, using 3 years of peanut (Arachis hypogaea L.), a legume, and cyanide-containing cassava (Manihot esculenta Crantz) intercropping and peanut monocropping field, pot and hydroponic experiments in addition to exogenous ethylene application and soil incubation experiments, we found that ethylene, a cyanide-derived signal, is associated with the chemical identification of neighbouring cassava and the microbial re-assemblage in the peanut rhizosphere. Results Ethylene production in peanut roots can be triggered by cyanide production of neighbouring cassava plants. This gaseous signal alters the microbial composition and re-assembles the microbial co-occurrence network of peanut by shifting the abundance of an actinobacterial species, Catenulispora sp., which becomes a keystone in the intercropped peanut rhizosphere. The re-assembled rhizosphere microbiota provide more available nutrients to peanut roots and support seed production. Conclusions Our findings suggest that root ethylene acts as a signal with a dual role. It plays a role in perceiving biochemical cues from interspecific neighbours, and also has a regulatory function in mediating the rhizosphere microbial assembly, thereby enhancing focal plant fitness by improving seed production. This discovery provides a promising direction to develop novel intercropping strategies for targeted manipulations of the rhizosphere microbiome through phytohormone signals. Video abstract.

Plant phenology is of great significance for global change study and it serves as an important indicator of vegetation productivity. Increasing efforts have been made to retrieve the plant phenology using remote sensing observations at regional-to-global scale due to its large spatial coverage. Compared with our understanding on drivers of spring phenology, it remains unclear that to which extent is leaf coloration in autumn controlled by climate forcing, especially on the relative importance between daytime and nighttime temperatures. Using a total of 160 site-year leaf coloring date (LCD) data observed from 14 sites in China, we showed that three frequently used remote sensing algorithms (i.e., the dynamic threshold approach, the simple and double logistic approaches) were not able to accurately retrieve LCD. Surprisingly, the nighttime land surface temperature (LSTnight) explained as much as 62% of LCD variability, compared with 28% for daytime temperature (LSTday). We, therefore proposed a new model that combines the enhanced vegetation index and LSTnight for the reconstruction of LCD. We demonstrated that LCD of China's ecosystems has been delayed at a rate of 0.7 days per year over 2003-2014, and a longer LCD contributed to the increased annual gross primary productivity for most (66%) regions. Our results have important implications as it sheds light on the role of LSTnight in controlling plant phenology. This article strongly suggests the combined use of vegetation index and LSTnight in the reconstruction of phenological variations in autumn across species and plant functional types.

Abstract Euthyroidism is of profound importance for lifetime health. However, the early diagnosis or therapeutics of thyroid developmental defects has not been established, mainly due to limited understanding of human thyroid development and a lack of recapitulating research model. Herein, the authors elaborate the cell atlas and potential regulatory signaling of the evolution of heterogeneous thyrocyte population from 12 to 16 gestational weeks. Moreover, they establish a long‐term culture of human fetal thyroid organoids (hFTOs) system, which retains the fetal thyroid lineages and molecular signatures, as well as the ability to generate functional human thyroid follicles post mice renal transplantation. Notably, cAMP signaling activation in hFTOs by forskolin boosts the maturation of follicle and thus thyroid hormone T4 secretion, which recapitulates the key developmental events of fetal thyroid. Employing this ex vivo system, it is found that enhanced chromatin accessibility at thyroid maturation genes (such as TPO and TG) loci permits the transcription for hormone production. This study provides the cell atlas of and an organoid model for human thyroid development, which will facilitate thyroid research and prospective medicine.

BackgroundMicrophthalmos (MCO) is a rare developmental defect characterized by small malformed eyes. Our study aimed to describe the clinical characteristics of posterior microphthalmos syndrome caused by a novel variant in MFRP gene in a Chinese patient.MethodsComplete ophthalmologic examinations were performed for the proband and proband's family members. Whole exon sequencing (WES) and Sanger sequencing were used to identify the mutated genes, and bioinformatic analysis was undertaken to predict the effect of this variant.ResultsClinical analysis showed that the proband had reduced axial length (17.95 and 17.98 mm) with normal-size corneas and shallow anterior chamber depth. Fundus photography showed scattered yellowish-white spots in the whole retina with cup-to-disc ratios of 0.95 in both eyes. Retinoschisis in the inner nuclear layer and reduced outer retina thickness were apparent on OCT examination, and optic nerve drusen demonstrated increased autofluorescence in fundus autofluorescence (FAF). Perimeter examination revealed a tubular visual field for the right eye, and electroretinography (ERG) revealed a moderately reduced rod response combined with compromised cone response. Ocular examinations of the patient's family members were unremarkable. WES revealed that the proband had homozygous mutations in c.55-1 (IVS1) G>A in intron 1 for the MFRP gene. Both the proband's parents and offspring were confirmed to be heterozygous by Sanger sequencing. Bioinformatic analysis showed this mutation was deleterious.ConclusionWe reported autosomal recessive posterior microphthalmia, atypical retinitis pigmentosa, and retinoschisis caused by a novel mutation in the MFRP gene in this consanguineous marriage family. Our study further broadens the mutation and phenotype spectrum of the MFRP gene in microphthalmia.

Purpose: Congenital cataract (CC) is a common disease resulting in leukocoria and the leading cause of blindness in children worldwide. Approximately 50% of congenital cataract is inherited. Our aim is to identify mutations in a Chinese family with congenital cataract.Methods: A four-generation Chinese family diagnosed with congenital cataract was recruited in West China Hospital of Sichuan University. Genomic DNA was extracted from the peripheral blood of these participants. All coding exons and flanking regions were amplified and sequenced, and the variants were validated using Sanger sequencing. AlphaFold2 was used to predict possible protein structural changes in this variant.Results: The proband had congenital nuclear cataract with nystagmus. A heterozygous variant c.233C > T was identified in exon 2 of the CRYGD gene in chromosome 2. This mutation resulted in a substitution of serine with phenylalanine at amino acid residue 78 (p.S78F). The variant might result in a less stable structure with a looser loop and broken hydrogen bond predicted by AlphaFold2, and this mutation was co-segregated with the disease phenotype in this family.Conclusion: We described cases of human congenital cataract caused by a novel mutation in the CRYGD gene and provided evidence of further phenotypic heterogeneity associated with this variant. Our study further extends the mutation spectrum of the CRYGD gene in congenital cataract.

As a traditional Chinese medicine-originated disease-modifying anti-rheumatic drug prescription, Baihu-Guizhi decoction (BHGZD) is extensively used for the treatment of rheumatoid arthritis (RA) with a satisfying therapeutic efficacy. Mechanically, our previous data indicated that BHGZD may ameliorate RA partially by restoring the balance of the “inflammation-immune” system through regulating the TLR4-c-Fos-IL2-TNF-alpha axis. Toll-like receptor 4 (TLR4) has been revealed to be involved in the activation of the NLR family pyrin domain containing 3 (NLRP3) inflammasome complex. Thus, the aim of the current study was to determine the regulatory effects of BHGZD on the TLR4–mediated inflammasome activation during RA progression based on the modified adjuvant-induced arthritis model (AIA-M) and the lipopolysaccharide/adenosine triphosphate (LPS/ATP)–induced pyroptosis cellular models. As a result, oral administration of BHGZD exhibited prominent improvement in the disease severity of AIA-M rats, such as reducing the redness and swelling of joints, arthritis incidence, arthritic scores, and diameter of the limb and increasing pain thresholds. In line with the in vivo findings, BHGZD treatment effectively inhibited the LPS/ATP–induced pyroptosis of both Raw264.7 macrophage and MH7A cells in vitro by reducing pyroptotic cell death morphology (swollen cells) and decreasing propidium iodide–positive and terminal deoxynucleotidyl transferase–mediated dUTP-fluorescein nick end labeling (TUNEL)–positive cells. Notably, the increased expression levels of TLR4, NLRP3, interleukin 1β, and interleukin 18 proteins and the elevated activities of caspase-1 and lactic dehydrogenase in in vivo and in vitro disease models were markedly reversed by the treatment with BHGZD. In conclusion, the above findings proved the immunomodulatory and anti-inflammatory activities of BHGZD, especially in pyroptosis, which may be attributed to the activation of TLR4–mediated NLRP3 inflammasome signaling.

Modern engineering systems are designed and utilized to realize complicated functions, and their operation mechanisms are becoming more complex. Nevertheless, prior related research mainly focused on the reliability evaluations of the systems with a single operation mechanism, which are not appropriate to depict the operation process of systems with multiple operation mechanisms. Faced with the research gaps and practical needs, this paper establishes a new reliability model for the multi-state k-out-of-n: F system composed of n subsystems, which runs under multiple interactive operation mechanisms, including performance sharing, balanced requirement, and protection strategy. The units in each subsystem can share the performance via a common bus, with the purpose of regulating the performance of all equal units. A new triggering criterion of the protection device in each subsystem is proposed based on the total performance of the units. Due to the protection from the device, the degradation rate of the units between two adjacent states decreases to a lower rate. Each subsystem breaks down when the total performance of the units reaches a critical value. According to the number of failed subsystems, the state of the entire system can be divided into multiple states. The Markov process imbedding method combined with the finite Markov chain imbedding approach is developed to obtain the probabilistic indexes of each subsystem and the entire system. The applicability of the proposed model and the effectiveness of the method can be sufficiently demonstrated by illustrative examples and sensitivity analyses.

Conventional radars commonly use a linear frequency-modulated (LFM) waveform as the transmitted signal. The LFM radar is a simple system, but its impulse-response function produces a −13.25 dB sidelobe, which in turn can make the detection of weak targets difficult by drowning out adjacent weak target information with the sidelobe of a strong target. To overcome this challenge, this paper presents a modeling and optimization method for non-linear frequency-modulated (NLFM) waveforms. Firstly, the time-frequency relationship model of the NLFM signal was combined by using the Legendre polynomial. Next, the signal was optimized by using a bio-inspired method, known as the Firefly algorithm. Finally, the numerical results show that the advantages of the proposed NLFM waveform include high resolution and high sensitivity, as well as ultra-low sidelobes without the loss of the signal-to-noise ratio (SNR). To the authors’ knowledge, this is the first study to use NLFM signals for target-velocity improvement measurements. Importantly, the results show that mitigating the sidelobe of the radar waveform can significantly improve the accuracy of the velocity measurements.

Cadmium (Cd), chromium (Cr), lead (Pb), mercury (Hg) and arsenic (As) are potent toxicants to human health via dietary intake. It is imperative to establish accurate soil thresholds based on soil-plant transfer models and food safety standards for safe agricultural production. This study takes rice genotypes and soil properties into account to derive soil thresholds for five heavy metal(loid)s using the bioconcentration factors (BCF) and species sensitivity distribution (SSD) based on the food safety standard. The BCF generated from two paddy soils was calculated to investigate the sensitivity of heavy metal accumulation in nine rice cultivars in a greenhouse pot experiment. Then, empirical soil-plant transfer models were developed from a middle-sensitivity rice cultivar (Denong 2000, one selected from nine rice) grown in nineteen paddy soils with various soil properties under a proper exogenously metal(loid)s concentration gradient. After normalization, hazardous concentrations from the fifth percentile (HC5) were calculated from the SSD curves, and the derived soil thresholds were obtained from HC5 prediction models that based on the combination of pH and organic carbon (OC) or cation exchange capacity (CEC). The soil Cd threshold derived based on pH and organic carbon (pH 6, CEC ≥ 20 cmolc kg−1) was 3.1 times lower than the current threshold. The derived thresholds for five elements were validated to be reliable through literature data and field experiments. The results suggested that deriving soil heavy metal(loid)s threshold using SSD method and local food safety standards is feasible and also applicable to other crops as well as other regions with potential health risks of toxic elements contamination in agricultural production.

Abstract The authors have successfully treated and monitored a case of paraneoplastic pemphigus in association with follicular dendritic cell sarcoma aggravated by hyaline-vascular Castleman's disease. The patient was a 56-year-old female who presented with recalcitrant erosive lichen planus of the oral cavity, tongue, and genital mucosa, along with polymorphous eruptions throughout her body. Histological examination of the cutaneous lesions, indirect immunofluorescence on rat bladder epithelium, and western blot of human keratinocyte proteins identified anti-epidermal antibodies in the patient's serum. Positron emission tomography and computed tomography scans found a mass in her retroperitoneal region. Pathology and immunohistochemistry investigation further corroborated the diagnosis of follicular dendritic cell sarcoma originated from hyaline-vascular Castleman's disease. Complete remission was achieved and the patient has been monitored for four years.

Background/Aims: Stress-induced cell senescence, which contributes to cell cycle arrest and is independent of age, plays an important role in chronic kidney disease (CKD) progression. DcR2, as a senescent marker, exclusively expressed in senescent tubular epithelia. The objective of this study was to examine whether urinary DcR2 (uDcR2) could be a potential biomarker for tubulointerstitial fibrosis (TIF) in patients with immunoglobulin A nephropathy (IgAN). Methods: This study included 210 IgAN patients and 80 healthy volunteers, with uDcR2 levels measured using enzyme-linked immunosorbent assay. We examined the relationship among uDcR2/Cr levels, renal function, and pathological parameters, using regression analysis to identify risk factors for TIF and the area under the curve (AUC) approach to predict TIF. Renal DcR2 expression was quantified by immunohistochemistry. Co-expression of DcR2 with fibrotic markers (α-smooth muscle actin [α-SMA], collagen III) was analyzed by confocal microscopy. Results: Levels of uDcR2/Cr were significantly higher in IgAN patients and in those with more severe TIF, compared with healthy controls. Serum DcR2 levels were similar across groups. The proportion of IgAN patients with stages 1–2 CKD and T0 was highest among those with uDcR2/Cr 201 ng/g had stages 4–5 CKD and T2. Levels of uDcR2/Cr were positively associated with urinary albumin to creatinine ratio (ACR), urinary N-acetyl-β-D-glucosaminidase (uNAG)/Cr, and TIF scores and negatively associated with estimated glomerular filtration rate (eGFR). uDcR2/Cr, uNAG, ACR, and eGFR were independent predictors for TIF, with AUC of 0.907 for uDcR2/Cr. This AUC value was higher than that observed for eGFR, uNAG/Cr, or ACR. The sensitivity and specificity of uDcR2/Cr in predicting TIF were 87.0 and 80.5%, respectively. Moreover, uDcR2/Cr levels were positively associated with the percentage of renal DcR2 expression. Renal DcR2 co-localized with α-SMA and collagen III in the kidneys of IgAN patients. Conclusions: Levels of uDcR2/Cr were closely associated with the severity of TIF and renal function parameters. uDcR2/Cr represents a potential biomarker for predicting TIF in IgAN patients.

Abstract Introduction This 24-week randomized, double-blind, non-inferiority study compared the efficacy and safety of febuxostat, a xanthine oxidase inhibitor, with allopurinol using an up-titration method in hyperuricemic Chinese subjects with or without gout. Methods Eligible adults (serum uric acid [SUA] > 7.0 mg/dl with a history of gout, SUA ≥ 8.0 mg/dl with complications or SUA ≥ 9.0 mg/dl without complications) were randomized (1:1:1) to febuxostat 40 mg/day, 80 mg/day, or allopurinol 300 mg/day. Starting doses of febuxostat 20 mg/day and allopurinol 100 mg/day were up-titrated, up to 16 weeks, to the randomized doses and maintained to week 24. Primary endpoint was non-inferiority of febuxostat 40 mg/day versus allopurinol 300 mg/day based on the percentage of subjects with SUA ≤ 6.0 mg/dl at week 24. The same comparison was made between febuxostat 60 mg/day or 80 mg/day versus allopurinol 300 mg/day. Safety assessments included measurement of treatment-emergent adverse events (TEAEs). Results The per-protocol population comprised 472 subjects. Non-inferiority of febuxostat 40 mg/day versus allopurinol 300 mg/day was not demonstrated based on the protocol-defined margin of − 10% (44.7 vs. 50.0%; − 5.3% difference; 95% confidence interval [CI]: − 16.4%, 5.8%); however, superiority over allopurinol 300 mg/day was demonstrated for febuxostat 60 mg/day at week 16 (66.3 vs. 51.2%; a 15.0% difference; 95% CI: 4.2%, 25.9%) and febuxostat 80 mg/day at week 24 (70.0 vs. 50.0%; a 20.0% difference; 95% CI: 9.3%, 30.7%). The frequency of TEAEs was similar across groups, with gout flares occurring frequently. Conclusions Using a novel dose-titration method, although the primary endpoint of non-inferiority of febuxostat 40 mg/day versus allopurinol 300 mg/day was not reached, non-inferiority and superiority of febuxostat 60 mg/day and 80 mg/day versus allopurinol 300 mg/day was demonstrated at weeks 16 and 24, respectively. Febuxostat demonstrated an acceptable tolerability profile in the treatment of hyperuricemia in Chinese subjects with or without gout. Trial Registration JapicCTI-132106. Funding Astellas Pharma Global Development, Inc.

Rice bean (Vigna umbellata) is consumed as a common vegetable in Southeast Asia. Methyl jasmonate (MeJA) functions as an endogenous/exogenous stress signal to elicit the production of specific metabolites during sprouting. To elucidate the changes in metabolites and the effects of MeJA on rice bean sprouting, non-targeted ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry along with principal component analysis and supervised orthogonal projection to latent structure-discriminant analysis was performed to analyze the dissimilar profiles among the sprouts at different stages. Analysis of the abundance of biomarkers, such as sugars, free fatty acids, amino acids, flavonoids, benzoic acid derivatives, triglycerides, and lipids, showed the main effects of MeJA involved in the significant metabolite pathways. Our study elucidated the changes in rice bean composition and metabolites associated with various stages of sprouting and the roles of MeJA in sprout physiology. Our results can help improve this economically important grain crop.

Nitroreductase (NTR) is a type of cytoplasmic enzyme that depends on flavin mononucleotide or flavin adenine dinucleotide, and that is widely present in tumor cells where it increases during hypoxia. NTR can effectively reduce aromatic nitro compounds to corresponding amino compounds, with the assistance of reduced nicotinamide adenine dinucleotide (NADH). In this study, a nitro-containing fluorescent turn-on probe, TP-NO, was synthesized and characterized. TP-NO exhibited a fast and selective response towards NTR (LOD = 1.96 ng/mL), and which reaction mechanism was proved through molecular docking. In addition, TP-NO has been successfully applied in imaging hypoxia levels in tumor cells, and zebrafish. This work provided a probe that can be applied to investigate NTR in biological systems.

As one of the most destructive oligophagous pests, the chrysanthemum aphid (Macrosiphoniella sanborni) has seriously restricted the sustainable development of the chrysanthemum industry. Olfaction plays a critical role in the environmental perception of aphids, but very little is currently known about the chemosensory mechanism of M. sanborni. In this study, four MsanOBPs, four MsanCSPs, eight MsanORs, two MsanIRs and one MsanSNMP were identified among the 28,323 unigenes derived from the antennal transcriptome bioinformatic analysis of M. sanborni adults. Then, comprehensive phylogenetic analyses of these olfactory-related proteins in different aphid species were performed using multiple sequence alignment. Subsequently, the odor-specific and wing-specific expression profiles of these candidate chemosensory genes were investigated using quantitative real-time PCR. The data showed that most of these chemosensory genes exhibited higher expression levels in alate aphids. Among them, MsanOBP9, MsanOR2, MsanOR4, MsanOR43b-1, MsanCSP1, MsanCSP2, MsanCSP4, MsanIR25a and MsanIR40a in alate aphids showed remarkably higher expression levels than in apterous aphids under the effect of the host plant volatiles, indicating that these genes may take part in the specific behaviors of alate adults, such as host recognition, oviposition site selection and so on. This study lays the groundwork for future research into the molecular mechanism of olfactory recognition in M. sanborni.

It is hard for current time series reconstruction methods to achieve the balance of high-precision time series reconstruction and explanation of the model mechanism. The goal of this paper is to improve the reconstruction accuracy with a well-explained time series model. Thus, we developed a function-based model, the CCTM (Continuous Change Tracker Model) model, that can achieve high precision in time series reconstruction by tracking the time series variation rate. The goal of this paper is to provide a new solution for high-precision time series reconstruction and related applications. To test the reconstruction effects, the model was applied to four types of datasets: normalized difference vegetation index (NDVI), gross primary productivity (GPP), leaf area index (LAI), and MODIS surface reflectance (MSR). Several new observations are as follows. First, the CCTM model is well explained and based on the second-order derivative theorem, which divides the yearly time series into four variation types including uniform variations, decelerated variations, accelerated variations, and short-periodical variations, and each variation type is represented by a designed function. Second, the CCTM model provides much better reconstruction results than the Harmonic model on the NDVI, GPP, MSR, and LAI datasets for the seasonal segment reconstruction. The combined use of the Savitzky–Golay filter and the CCTM model is better than the combinations of the Savitzky–Golay filter with other models. Third, the Harmonic model has the best trend-fitting ability on the yearly time series dataset, with the highest R-Square and the lowest RMSE among the four function fitting models. However, with seasonal piecewise fitting, the four models all achieved high accuracy, and the CCTM performs the best. Fourth, the CCTM model should also be applied to time series image compression, two compression patterns with 24 coefficients and 6 coefficients respectively are proposed. The daily MSR dataset can achieve a compression ratio of 15 by using the 6-coefficients method. Finally, the CCTM model also has the potential to be applied to change detection, trend analysis, and phenology and seasonal characteristics extractions.

Abstract Background To identify biomarkers for guiding therapy and predicting clinical response of Tripterysium Glycosides Tablets (TGT) treatment is an urgent task due to individual differences in TGT response across rheumatoid arthritis (RA) patients. Competing endogenous RNA (ceRNA) regulatory system may influence drug response with involvement in diverse biological processes. Herein, we aimed to identify a TGT response‐related ceRNA axis. Methods A TGT response‐related ceRNA axis was screened according to clinical cohort‐based RNA expression profiling, lncRNA‐mRNA coexpression, and ceRNA network analyses. Its clinical relevance was evaluated by computational modeling. Regulatory mechanisms of ceRNA axis were also experimentally investigated. Results The ceRNA regulatory axis combined with lncRNA ENST00000494760, miR‐654‐5p, and C1QC was identified as a candidate biomarker for RA patients' response to TGT. Both ENST00000494760 and C1QC mRNA expression were significantly lower, while miR‐654‐5p expression was dramatically higher in TGT responders than nonresponders. Its clinical relevance was verified by computational modeling based on both independent clinical validation cohort and collagen‐induced arthritis (CIA) mice. Mechanistically, miR‐654‐5p directly bound to the 3′‐untranslated region of both ENST00000494760 and C1QC mRNA to inhibit their expression. Moreover, miR‐654‐5p suppressed C1QC mRNA expression, but ENST00000494760 bound to miR‐654‐5p and relieved its repression on C1QC mRNA, leading to RA aggressive progression and weak TGT response. Conclusions LncRNA ENST00000494760 overexpression may sponge miR‐654‐5p to promote C1QC expression in RA patients. This novel ceRNA axis may serve as a biomarker for screening the responsive RA patients to TGT treatment, which will allow improved personalized healthcare.

Currently most methods take manual strategies to annotate cell types after clustering the single-cell RNA sequencing (scRNA-seq) data. Such methods are labor-intensive and heavily rely on user expertise, which may lead to inconsistent results. We present SCSA, an automatic tool to annotate cell types from scRNA-seq data, based on a score annotation model combining differentially expressed genes (DEGs) and confidence levels of cell markers from both known and user-defined information. Evaluation on real scRNA-seq datasets from different sources with other methods shows that SCSA is able to assign the cells into the correct types at a fully automated mode with a desirable precision.

Research has shown that abnormal brain networks in patients with schizophrenia appear at different frequencies, but the relationship between these different frequencies is unclear. Therefore, it is necessary to use a multilayer network model to evaluate the integration of information from different frequency bands. To explore the mechanism of integration and separation in the multilayer network of schizophrenia, we constructed multilayer frequency brain network models in 50 patients with schizophrenia and 69 healthy subjects, and the entropy of the multiplex degree (EMD) and multilayer clustering coefficient (MCC) were calculated. The results showed that the ability to integrate and separate information in the multilayer network of patients was significantly higher than that of normal people. This difference was mainly reflected in the default mode network, sensorimotor network, subcortical network, and visual network. Among them, the subcortical network was different in both MCC and EMD outcomes. Furthermore, differences were found in the posterior cingulate gyrus, hippocampus, amygdala, putamen, pallidum, and thalamus. The thalamus and posterior cingulate gyrus were associated with the patient’s symptom scores. Our results showed that the cross-frequency interaction ability of patients with schizophrenia was significantly enhanced, among which the subcortical network was the most active. This interaction may serve as a compensation mechanism for intralayer dysfunction.

China has implemented a portfolio of large-scale forest conservation and restoration programs (FCRPs) to advance the sustainable management of forests. However, the contributions of these programs to forest recovery and land surface greening were generally evaluated on a local scale, which hindered the systematic planning of FCRPs. In this study, we analyzed the spatiotemporal patterns of tree cover (TC) change before and after the intensification of FCRPs using the Mann-Kendall test and the Theil–Sen slope estimator. With the improved phenology-based residual trend analysis (P-RESTREND) method, we derived the spatiotemporal patterns of human-induced tree cover (TC _H ) change on the national scale. Then, we calculated the effectiveness index of FCRPs at the provincial level, based on which the effectiveness levels for the 31 provinces of mainland China were classified. Our study showed that the area of forested lands with a significant greening trend was almost five times larger in the post-intensification phase (1999–2015) than in the pre-intensification phase of FCRPs (1982–1998). More than 29.9% of the forested lands were significantly improved in TC by human activities in the post-intensification phase. Provinces with high effectiveness levels were generally distributed in humid areas, whereas the majority of provinces with low and moderately low effectiveness levels were spread in arid and semi-arid regions. We concluded that the implementation of FCRPs had contributed greatly to the land surface greening in China. Moreover, the effectiveness of FCRPs in forest recovery was heterogeneous at the provincial level and was driven by multiple natural and socioeconomic factors.

Abstract Background Approximately 30% of rheumatoid arthritis (RA) patients treated with Tripterysium glycosides (TG) tablets fail to achieve clinical improvement, implying the essentiality of predictive biomarkers and tools. Herein, we aimed to identify possible biomarkers predictive of therapeutic effects of TG tablets in RA. Methods Gene expression profile in peripheral blood mononuclear cells obtained from a discovery cohort treated with TG tablets was detected by Affymetrix EG1.0 arrays. Then, a list of candidate gene biomarkers of response to TG tablets were identified by integrating differential expression data analysis and gene signal transduction network analysis. After that, a partial-least-squares (PLS) model based on the expression levels of the candidate gene biomarkers in RA patients was constructed and evaluated using a validation cohort. Results Six candidate gene biomarkers (MX1, OASL, SPINK1, CRK, GRAPL and RNF2) were identified to be predictors of TG therapy. Following the construction of a PLS-based model using their expression levels in peripheral blood, both the 5-fold cross-validation and independent dataset validations showed the high predictive efficiency of this model, and demonstrated a distinguished improvement of the PLS-model based on six candidate gene biomarkers’ expression in combination over the commonly used clinical and inflammatory parameters, as well as the gene biomarkers alone, in predicting RA patients’ response to TG tablets. Conclusions This hypothesis-generating study identified MX1, OASL, SPINK1, CRK, GRAPL and RNF2 as novel targets for RA therapeutic intervention, and the PLS model based on the expression levels of these candidate biomarkers may have a potential prognostic value in RA patients treated with TG tablets.

Aggregation always occurs in industrial processes with fractal-like particles, especially in dense systems (the volume fraction, ϕ>1%). However, the classic aggregation theory, established by Smoluchowski in 1917, cannot sufficiently simulate the particle dynamics in dense systems, particularly those of generat ed fractal-like particles. In this article, the Langevin dynamic was applied to study the collision rate of aggregations as well as the structure of aggregates affected by different volume fractions. It is shown that the collision rate of highly concentrated particles is progressively higher than that of a dilute concentration, and the SPSD (self-preserving size distribution) is approached (σg,n≥1.5). With the increase in volume fraction, ϕ, the SPSD broadens, and the geometric standard is 1.54, 1.98, and 2.73 at ϕ=0.1, 0.2, and 0.3. When the volume fraction, ϕ, is higher, the radius of gyration is smaller with the same cluster size (number-based), which means the particle agglomerations are in a tighter coagulation. The fractal-like property Df is in the range of 1.60–2.0 in a high-concentration system. Knowing the details of the collision progress in a high-concentration system can be useful for calculating the dynamics of coagulating fractal-like particles in the industrial process.

Abstract Background Most cancer risk-associated single nucleotide polymorphisms (SNPs) identified by genome-wide association studies (GWAS) are noncoding and it is challenging to assess their functional impacts. To systematically identify the SNPs that affect gene expression by modulating activities of distal regulatory elements, we adapt the self-transcribing active regulatory region sequencing (STARR-seq) strategy, a high-throughput technique to functionally quantify enhancer activities. Results From 10,673 SNPs linked with 996 cancer risk-associated SNPs identified in previous GWAS studies, we identify 575 SNPs in the fragments that positively regulate gene expression, and 758 SNPs in the fragments with negative regulatory activities. Among them, 70 variants are regulatory variants for which the two alleles confer different regulatory activities. We analyze in depth two regulatory variants—breast cancer risk SNP rs11055880 and leukemia risk-associated SNP rs12142375—and demonstrate their endogenous regulatory activities on expression of ATF7IP and PDE4B genes, respectively, using a CRISPR-Cas9 approach. Conclusions By identifying regulatory variants associated with cancer susceptibility and studying their molecular functions, we hope to help the interpretation of GWAS results and provide improved information for cancer risk assessment.

Increased pro-inflammatory signaling is a hallmark of metabolic dysfunction in obesity and diabetes. Although both inflammatory and energy substrate handling processes represent critical layers of metabolic control, their molecular integration sites remain largely unknown. Here, we identify the heterodimerization interface between the α and β subunits of transcription factor GA-binding protein (GAbp) as a negative target of tumor necrosis factor alpha (TNF-α) signaling. TNF-α prevented GAbpα and β complex formation via reactive oxygen species (ROS), leading to the non-energy-dependent transcriptional inactivation of AMP-activated kinase (AMPK) β1, which was identified as a direct hepatic GAbp target. Impairment of AMPKβ1, in turn, elevated downstream cellular cholesterol biosynthesis, and hepatocyte-specific ablation of GAbpα induced systemic hypercholesterolemia and early macro-vascular lesion formation in mice. As GAbpα and AMPKβ1 levels were also found to correlate in obese human patients, the ROS-GAbp-AMPK pathway may represent a key component of a hepato-vascular axis in diabetic long-term complications.

Abstract Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Snow cover plays an important role in hydrological processes and seasonal water balance. Especially in the Tibetan Plateau (TP), snow cover is an important source of the Yangtze River, Yellow River and Lancang River (SRYYL), which greatly influences regional water balance. In this study, we quantified the temporal trend and spatial variation of snow cover across the TP by calibrating and developing the Advance Very High Resolution Radiometer (AVHRR) Long Term Data Record (LTDR)-derived snow cover products during 1982-2011. We also examined the relationship of snow cover with temperature and precipitation over the TP during 1982–2011. The results indicate that seasonal snow cover generally starts to accumulate from central plateau in October, while significant melting starts to occur from the southeastern plateau in May of following year. The long-term variability of snow cover is characterized by the tendency for a slight decrease in the mean snow coverage during the period of hydrological year (HY) 1982–1993 and a slight increase from HY2001 to 2011, but the total snow cover area remains relatively stable over the past 30 years. The results also show that temperature plays a critical role in controlling the snow cover days.

Objective: To extract the computed tomography (CT) imaging features of the primary lesions in patients with advanced esophageal squamous cell carcinoma (ESCC) and to study whether these imaging features can predict the short-term outcome after concurrent chemoradiotherapy (CCRT). Methods: From January 2014 to December 2015, a total of 49 patients with locally advanced ESCC who underwent CCRT were analyzed retrospectively. They were randomly categorized into the training and validation groups. Collection of CT imaging of patients before and intermediate stage undergoing radiotherapy. The correlations between imaging characteristics and short-term outcome were analyzed. The accuracy of cutoff value was verified by imaging characteristics of patients in validation group. Result: There were 38 patients in the training group and 11 patients in the validation group. 13 patients in the training group were classified as responders and 25 patients as nonresponders. According to the CT imaging before radiotherapy, there are no significant differences between responders and nonresponders. According to the CT imaging in the middle stage of radiotherapy, responders showed significantly higher Roundness than nonresponders ( P = .004, 95% confidence interval [CI] = 0.0419-0.212). The areas under the ROC curves for the ability to predict significantly tumor response were 0.768 for Roundness ( P = .001, 95% CI = 0.603-0.889). The cutoff value of Roundness is 0.3099. Roundness showed no significant associations with survival parameters. Conclusions: Computed tomography imaging in the middle stage of radiotherapy can predict the short-term outcome of concurrent chemoradiotherapy for patients with locally advanced ESCC but have no predictive effect on the total survival time.

In recent years, the demand for natural herbal products (NHP) has increased; however, the quality of these products is difficult to confirm due to the lack of a comprehensive quality control system. Traditional methods are not effective in detecting processed ingredients. DNA barcoding is an established technique that has been used for more than 10 years. This technique uses short standard sequences (generally 200–600 bp) to identify species. While a complete DNA barcode is difficult to obtain from NHP due to DNA degradation, mini-barcoding is a complementary tool to identify species in NHP. DNA mini-barcoding uses smaller DNA segments for polymerase chain reaction amplification and can be applied to identify species rapidly. The present review summarizes the development and application of DNA mini-barcodes over recent years and discusses the limitations of this technique. This review also compares mini-barcoding and meta-barcoding, a technique using universal polymerase chain reaction primers to simultaneously amplify multiple DNA barcodes and identify many species in a single environmental sample. Additionally, other detection methods that can be combined with mini-barcodes, such as nucleotide signatures, high-resolution DNA melting analysis, and gold nanoparticles, are discussed. DNA mini-barcoding can fill the gaps left by other methods in the field of herbal molecular identification.

Background: Altered resting-state functional connectivity of the cerebellum in obsessive-compulsive disorder (OCD) has been previously reported. However, the previous study investigating cerebellar–cerebral functional connectivity relied on a priori–defined seeds from specific networks. In this study, we aimed to explore the connectivity alterations of the cerebellum in OCD under resting-state conditions with a hypothesis-free approach.Methods: Thirty patients with OCD and 26 healthy controls (HCs) underwent functional magnetic resonance imaging (fMRI) scanning at resting state. Regional cerebral function was evaluated by measuring the fraction of amplitude of low-frequency fluctuation (fALFF). Regions with mean fALFF (mfALFF) alterations were used as seeds in seed correlation analysis (SCA). An independent samples t test was used to compare the differences in mfALFF and functional connection (FC) between the two groups. Pearson correlation analysis was performed to identify the association between functional neural correlates and OCD symptom severity evaluated using the Yale-Brown Obsessive Compulsive Scale (Y-BOCS).Results: Compared with the HC group, the OCD group showed significantly increased mfALFF values in bilateral cerebellar. The results of FC analysis showed weakened connectivity among the left Crus II, lobule VIII, and right striatum and between the right lobule VIII and the right striatum, and cingulate in the OCD group compared with the HC group. Some of the abovementioned results were associated with symptom severity.Conclusions: OCD patients showed abnormal spontaneous cerebellar activity and weakened functional connectivity between the cerebellum and the cortico-striato-thalamo-cortical (CSTC) circuit (striatum and cingulate), suggesting that the cerebellum may play an essential role in the pathophysiology of OCD.

The Guanzhong region is a typical and important grain-producing area in China. The effect of accumulated temperature and rainfall on maize production is important in the face of global warming. Here, we collected meteorological data from six test sites in the Guanzhong region to study climate change from 1972 to 2018 in this area. A two-year study was conducted at multiple experimental sites to analyze the effect of climatic factors on maize yield and disease in the Guanzhong region. In the past 40 years, average temperatures have significantly increased at all sites, except for Hancheng. Rainfall varied significantly between years at each site, except for Huxian, with an overall declining trend. Accumulated temperature had a significant positive effect on yield (R2 = 0.28, p = 0.041 < 0.05), but rainfall did not affect yield (R2 = 0.0971, p = 0.324 > 0.05). During the growing period, total rainfall had a significant positive correlation with northern leaf blight disease in maize, and rainfall before silking had a significant positive correlation with ear length and row grain number. The demand for accumulated temperature by maize differed between sites. It is predicted that maize yield will increase with increasing temperature in the Guanzhong region. Greater attention should be paid to improve agronomic practices, such as adjustment of sowing dates, straw mulching, deep tillage, and pest control to adapt to future climate change.

Ecosystem models provide an effective approach to quantify the terrestrial carbon cycle, but the lack of accurate phenological information prevents them from better simulations of the physical processes. Compared with spring phenology (i.e. the start of the growing season, SOS), the vegetation phenology in autumn (the end of the growing season, EOS) is not well-simulated and it is challenging to incorporate vegetation phenology into ecosystem models. The simulation of EOS based on temperature and photoperiod was widely accepted, such as Delpierre et al (2009 Agric. For. Meteorol. 149 938–48)’s model (DM), yet its accuracy has not been fully discussed at a regional scale. Here, we developed a regional autumn phenological model (DMS) with inputs of temperature, photoperiod, and water availability for China’s terrestrial ecosystems. The new DMS model significantly improved the representation of EOS in terms of the lower root mean square error (RMSE), higher model efficiency, and a higher percentage of significant correlation with the referenced EOS. We observed widespread delaying trends of EOS with an average rate of 0.1 d yr ^−1 for vegetated areas over 2001–2018. We further incorporated the improved EOS into the boreal ecosystem productivity simulator (BEPS) and found that the phenology-modified BEPS model had better performances in predicting annual gross primary productivity (GPP) with ∼28% lower RMSE than the original model when testing against GPP measurements from flux tower sites. From 2001 to 2017, the interannual GPP simulated by the modified BEPS model showed an increasing trend with a rate of 6.0 g C m ^−2 yr ^−2 . In conclusion, our study proves that water availability is of great significance for modeling autumn phenology, and the incorporation of phenological dates into an ecosystem model is helpful for productivity simulation.

TSC22D4 regulates hepatic lipoprotein production, but has so far mainly been studied in the context of cancer cachexia. Here, the authors show TSC22D4 inhibition improves insulin sensitivity in several mouse models of diabetes, which they attribute at least in part to the induction of secreted LCN13.

Spring phenology is a sensitive indicator of climate change and has substantial impacts on the carbon cycle. The global N cycle has been greatly disturbed by anthropogenic activities resulting in altered atmospheric N deposition worldwide. Research has been focused on the changes in the spring phenology and its covariations with climatic factors. However, the influences of N deposition on spring phenology have not been well documented to date. Herein, we investigated the effects of N deposition on the start of growing season (SOS) in continental United States (CONUS) during the years 1986–2015 using the normalized difference vegetation index (NDVI) datasets derived from both the third generation NDVI dataset and the Moderate Resolution Imaging Spectroradiometer (MODIS). We observed that N deposition could only explain approximately 5% of temporal variation in SOS in CONUS. However, the sensitivities of SOS in response to unit change in both temperature (S _T ) and precipitation (S _P ) showed clear decreasing spatial patterns with increasing N deposition. The S _T generally decreased from −6 d/°C in low N deposition regions (4 kg ha ^−1 . Furthermore, the positive S _P also showed a continuously decreasing pattern with the increase in N deposition, but the negative S _P was gradually weakened when N deposition was >1.0 kg ha ^−1 . The results have important implications as it reveals the role of N deposition on spring plant phenology, and strongly suggest the consideration of N deposition effects when analyzing or predicting spring phenology in response to future climate change.

The intra-aggregate architecture of soil macroaggregates provides suitable microhabitats for nematodes to graze on microorganisms. However, it is not fully clear how nematodes and microbial communities interactively mediate soil organic carbon (SOC) turnover. Here, we aimed to illustrate the relationships between nematodes, microbial community, and SOC turnover in the macroaggregates of a red soil receiving long-term manure application. Soil macroaggregates (>2 mm) were sampled from an 11-year field experiment including four manure treatments: no manure (M0), low manure rate (M1), high manure rate (M2), and high manure rate with lime (M3). The abundances of nematodes and microbial communities were substantially increased under manure treatments. Bacterivores dominated under the M2 and M3 treatments, while plant parasites were enriched under the M1 treatment. Phospholipid fatty acid analysis indicated that the ratio of bacteria to fungi significantly increased, but the ratio of Gram-positive bacteria to Gram-negative bacteria declined with the increasing manure addition. Random forest modeling showed that soil porosity had a primary effect on nematode assemblages, while pH and SOC contributed profoundly to the structure of the microbial community and carbon metabolic capacity. Structural equation modeling suggested that nematode grazing promoted carbon metabolic activities predominantly due to increased microbial biomass. Taken together, the mechanistic understanding of nematode-microorganism interactions may have important implications for improving soil fertility by nematode-mediated microbial processes.

Accumulating clinical evidence show that not all rheumatoid arthritis (RA) patients benefit to the same extent from a Tripterygium wilfordii Hook F (TwHF)-based therapy-Tripterysium glycosides tablets (TG tablets), which emphasizes the need of predictive biomarkers and tools for drug response. Herein, we integrated TG tablets' response-related miRNA and mRNA expression profiles obtained from the clinical cohort-based microarray, miRNA target prediction, miRNA-target gene coexpression, as well as gene-gene interactions, to identify four candidate circulating miRNA biomarkers that were predictive of response to TG tablets. Moreover, we applied the support vector machines (SVM) algorithm to construct the prediction model for the treatment outcome of TG tablets based on the levels of the candidate miRNA biomarkers, and also confirmed its good performance via both 5-fold cross-validation and the independent clinical cohort validations. Collectively, this circulating miRNA-based biomarker model may assist in screening the responsive RA patients to TG tablets and thus potentially benefit individualized therapy of RA in a daily clinical setting.

Objective: One of the major side effects of glucocorticoid (GC) treatment is lean tissue wasting, indicating a prominent role in systemic amino acid metabolism. In order to uncover a novel aspect of GCs and their intracellular-receptor, the glucocorticoid receptor (GR), on metabolic control, we conducted amino acid and acylcarnitine profiling in human and mouse models of GC/GR gain- and loss-of-function. Methods: Blood serum and tissue metabolite levels were determined in Human Addison's disease (AD) patients as well as in mouse models of systemic and liver-specific GR loss-of-function (AAV-miR-GR) with or without dexamethasone (DEX) treatments. Body composition and neuromuscular and metabolic function tests were conducted in vivo and ex vivo, the latter using precision cut liver slices. Results: A serum metabolite signature of impaired urea cycle function (i.e. higher [ARG]:[ORN + CIT]) was observed in human (CTRL: 0.45 ± 0.03, AD: 1.29 ± 0.04; p

Abstract Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of cancer fatalities in Western societies, characterized by high metastatic potential and resistance to chemotherapy. Critical molecular mechanisms of these phenotypical features still remain unknown, thus hampering the development of effective prognostic and therapeutic measures in PDAC. Here, we show that transcriptional co‐factor Transducin beta‐like (TBL) 1 was over‐expressed in both human and murine PDAC. Inactivation of TBL1 in human and mouse pancreatic cancer cells reduced cellular proliferation and invasiveness, correlating with diminished glucose uptake, glycolytic flux, and oncogenic PI3 kinase signaling which in turn could rescue TBL1 deficiency‐dependent phenotypes. TBL1 deficiency both prevented and reversed pancreatic tumor growth, mediated transcriptional PI3 kinase inhibition, and increased chemosensitivity of PDAC cells in vivo. As TBL1 mRNA levels were also found to correlate with PI3 kinase levels and overall survival in a cohort of human PDAC patients, TBL1 was identified as a checkpoint in the malignant behavior of pancreatic cancer and its expression may serve as a novel molecular target in the treatment of human PDAC.

Since the implementation of China’s afforestation and conservation projects during recent decades, an increasing number of studies have reported greening trends in the karst regions of southwest China using coarse-resolution satellite imagery, but small-scale changes in the heterogenous landscapes remain largely unknown. Focusing on two typical karst regions in the Nandong and Xiaojiang watersheds in Yunnan province, we processed 2,497 Landsat scenes from 1988 to 2016 using the Google Earth Engine cloud platform and analyzed vegetation trends and associated drivers. We found that both watersheds experienced significant increasing trends in annual fractional vegetation cover, at a rate of 0.0027 year−1 and 0.0020 year−1, respectively. Notably, the greening trends have been intensifying during the conservation period (2001−2016) even under unfavorable climate conditions. Human-induced ecological engineering was the primary factor for the increased greenness. Moreover, vegetation change responded differently to variations in topographic gradients and lithological types. Relatively more vegetation recovery was found in regions with moderate slopes and elevation, and pure limestone, limestone and dolomite interbedded layer as well as impure carbonate rocks than non-karst rocks. Partial correlation analysis of vegetation trends and temperature and precipitation trends suggested that climate change played a minor role in vegetation recovery. Our findings contribute to an improved understanding of the mechanisms behind vegetation changes in karst areas and may provide scientific supports for local afforestation and conservation policies.

The ability of process-based biogeochemical models in estimating the gross primary productivity (GPP) of alpine vegetation is largely hampered by the poor representation of phenology and insufficient calibration of model parameters. The development of remote sensing technology and the eddy covariance (EC) technique has made it possible to overcome this dilemma. In this study, we have incorporated remotely sensed phenology into the Biome-BGC model and calibrated its parameters to improve the modeling of GPP of alpine grasslands on the Tibetan Plateau (TP). Specifically, we first used the remotely sensed phenology to modify the original meteorological-based phenology module in the Biome-BGC to better prescribe the phenological states within the model. Then, based on the GPP derived from EC measurements, we combined the global sensitivity analysis method and the simulated annealing optimization algorithm to effectively calibrate the ecophysiological parameters of the Biome-BGC model. Finally, we simulated the GPP of alpine grasslands on the TP from 1982 to 2015 based on the Biome-BGC model after a phenology module modification and parameter calibration. The results indicate that the improved Biome-BGC model effectively overcomes the limitations of the original Biome-BGC model and is able to reproduce the seasonal dynamics and magnitude of GPP in alpine grasslands. Meanwhile, the simulated results also reveal that the GPP of alpine grasslands on the TP has increased significantly from 1982 to 2015 and shows a large spatial heterogeneity, with a mean of 289.8 gC/m2/yr or 305.8 TgC/yr. Our study demonstrates that the incorporation of remotely sensed phenology into the Biome-BGC model and the use of EC measurements to calibrate model parameters can effectively overcome the limitations of its application in alpine grassland ecosystems, which is important for detecting trends in vegetation productivity. This approach could also be upscaled to regional and global scales.

Granules with superior fluidity and low moisture absorption are ideal for tableting and capsule filling. Melt granulation as a solvent-free technology has attracted increasing interest for the granulation of moisture-sensitive drugs. The objective of the present study was to develop a solvent-less and high throughput melt granulation method via the melt centrifugal atomization (MCA) technique. The granule formability of various drugs and excipients via MCA and their dissolution properties were studied. It was found that the yield, fluidity, and moisture resistance of the granules were affected by the drug and excipient types, operation temperature, and collector diameter. The drugs were in an amorphous state in pure drug granules, or were highly dispersed in excipients as solid dispersions. The granules produced via MCA showed an improved drug dissolution. The present study demonstrated that the solvent-free, one-step, and high-throughput MCA approach can be used to produce spherical granules with superior fluidity and immediate drug release characteristics for poorly water-soluble and moisture-sensitive therapeutics.

Satellite-derived vegetation phenology has been recognized as a key indicator for detecting changes in the terrestrial biosphere in response to global climate change. However, multi-decadal changes and spatial variation of vegetation phenology over the Northern Hemisphere and their relationship to climate change have not yet been fully investigated. In this article, we investigated the spatial variability and temporal trends of vegetation phenology over the Northern Hemisphere by calibrating and analyzing time series of the satellite-derived normalized difference vegetation index (NDVI) during 1982-2012, and then further examine how vegetation phenology responds to climate change within different ecological zones. We found that during the period from 1982 to 2012 most of the high latitude areas experienced an increase in growing period largely due to an earlier beginning of vegetation growing season (BGS), but there was no significant trend in the vegetation growing peaks. The spatial pattern of phenology within different eco-zones also experienced a large variation over the past three decades. Comparing the periods of 1982-1992, 1992-2002 with 2002-2012, the spatial pattern of change rate of phenology shift (RPS) shows a more significant trend in advancing of BGS, delaying of EGS (end of growing season) and prolonging of LGS (length of growing season) during 2002-2012, overall shows a trend of accelerating change. Temperature is a major determinant of phenological shifts, and the response of vegetation phenology to temperature varied across different eco-zones.