Search

Contrary to general concepts of bacterial saccharide metabolism, melibiose (25 to 32 g/liter) and fructose (5 to 14 g/liter) accumulated as extracellular intermediates during the catabolism of raffinose (O-alpha-D-galactopyranosyl-1, 6-alpha-D-glucopyranosyl-beta-D-fructofuranoside) (90 g/liter) by ethanologenic recombinants of Escherichia coli B, Klebsiella oxytoca M5A1, and Erwinia chrysanthemi EC16. Both hydrolysis products (melibiose and fructose) were subsequently transported and further metabolized by all three organisms. Raffinose catabolism was initiated by beta-fructosidase; melibiose was subsequently hydrolyzed to galactose and glucose by alpha-galactosidase. Glucose and fructose were completely metabolized by all three organisms, but galactose accumulated in the fermentation broth with EC16(pLOI555) and P2. MM2 (a raffinose-positive E. coli mutant) was the most effective biocatalyst for ethanol production (38 g/liter) from raffinose. All organisms rapidly fermented sucrose (90 g/liter) to ethanol (48 g/liter) at more than 90% of the theoretical yield. During sucrose catabolism, both hydrolysis products (glucose and fructose) were metabolized concurrently by EC16(pLOI555) and P2 without sugar leakage. However, fructose accumulated extracellularly (27 to 28 g/liter) at early stages of fermentation with KO11 and MM2. Sequential utilization of glucose and fructose correlated with a diauxie in base utilization (pH maintenance). The mechanism of sugar escape remains unknown but may involve downhill leakage via permease which transports precursor saccharides or novel sugar export proteins. If sugar escape occurs in nature with wild organisms, it could facilitate the development of complex bacterial communities which are based on the sequence of saccharide catabolism and the hierarchy of sugar utilization.

One of the strategies used by Gram-negative bacteria to secrete proteins across the two membranes which delimit the cells, is sec independent and dedicated to proteins lacking an N-terminal signal peptide. It depends on ABC protein-mediated exporters, which consist of three cell envelope proteins, two inner membrane proteins, an ATPase (the ABC protein), a membrane fusion protein (MFP) and an outer membrane polypeptide. Erwinia chrysanthemi metalloproteases B and C and Serratia marcescens hemoprotein HasA are secreted by such homologous pathways and interact with the ABC protein. Using as protein substrates HasA and GST-PrtC, a chimeric protein which has a glutathione S-transferase moiety fused to a large C-terminal domain of protease C, we developed a simple system to identify proteins bound to the substrate based on substrate affinity-chromatography using heme- or glutathione-agarose. We show an ordered association between the protein substrates and the three exporter components: the substrate recognizes the ABC protein which interacts with the MFP which in turn binds the outer membrane component. Substrate binding is required for assembly of the three components.

Two extracellular polysaccharides from strains of Erwinia chrysanhemi Ech 1 and 9, phytopathogens of potatoes, have been isolated and purified. Both have similar compositions and other properties to that produced by strain SR 260, a phytopathogen of corn. These polysaccharides are composed of L-rhamnose, D-mannose, D-glucose, D-glucuronic acid in the ratio 3:1:1:1. Initial structural aspects of these polysaccharides are reflected in the 600 MHz 1H NMR spectra and the products of partial acid hydrolysis, which are presented for comparison.

Iron is unlikely to be readily available in plant tissues for invading microorganisms. Soft rot, caused by Erwinia chrysanthemi strain 3937 on African violets, is a valuable model for studying the role of iron and its ligands in plant-pathogen interactions. These studies could lead to the development of new control strategies against microbial infections of plants.

The type II or Sec-dependent secretion system is used by diverse Gram-negative bacteria for secretion of extracellular proteins. Of the 12-15 proteins involved in secretion, the requirement for many has not been demonstrated and little is known about their functions in the secretion process. The plant pathogens Erwinia chrysanthemi and Erwinia carotovora secrete extra-cellular pectate lyases (Pels) using the type II or Out pathway. However, these two bacteria cannot secrete Pels encoded by heterologously expressed genes from the other species, suggesting the presence of species-specific recognition factors in the Out systems of the two Erwinia species. We previously reported the isolation of a cosmid clone, pCPP2OO6, from E. chrysanthemi EC16, which enables Escherichia coil to secrete heterologously expressed E. chrysanthemi Pels. Sequencing in a region required for secretion revealed the presence of 12 genes, outC-M and outO. We report here the construction of functionally non-polar mutations in each gene in the outC-M operon and outS and outB using a polA(ts) strain of E. coli to facilitate homologous recombination between out genes carrying deletions and their wild-type copies on pCPP2006. By testing for complementation of each deletion with wild-type out genes from E. chrysanthemi EC16 and E. carotovora SCRI193 we have demonstrated that: (i) each out gene is required for secretion of E. chrysanthemi PelE from E. coli with the exception of outH; (ii) each mutation can be complemented by its homologue from E. carotovora, except for outC and outD; (iii) outC and outD from E. carotovora do not confer secretion of Pel1 on the E. chrysanthemi Out system; and (iv) Pel1 secretion can be conferred on the E. chrysanthemi Out system by the presence of outC-M, S and B from E. carotovora. The data suggest that OutC and OutD are gatekeepers of the Out system involved in recognition of Pels targeted for secretion but that OutC and OutD from E. carotovora cannot be successfully assembled into the E. chrysanthemi Out system.

The Erwinia chrysanthemi pecS gene encodes a repressor that negatively regulates the expression of virulence factors such as pectinases or cellulases. The cloned pecS gene was overexpressed using a phage T7 system. The purification of PecS involved DEAE-anion exchange and TSK-heparin columns and delivered the PecS protein that was purified to homogeneity. The purified repressor displayed an 18 kDa apparent molecular mass and an isoelectric point near to neutrality (pl = 6.5). Gel-filtration experiments revealed that the PecS protein is a dimer. Bandshift assays demonstrated that the PecS protein could specifically bind in vitro to the regulatory sites of the in vivo PecS-regulated genes. The interaction between the PecS protein and its DNA-binding site was characterized by a relatively low affinity (about 10(-8) M). DNase I footprintings revealed short protected sequences only with the most in vivo PecS-regulated genes. Alignment of these PecS-binding sites did not show a well-conserved consensus sequence. Immunoblotting demonstrated that the copy number of the PecS protein was approximately 50 dimers per cell. The low affinity of the PecS repressor for its DNA targets and the low cellular PecS content suggest the existence of E. chrysanthemi-specific factors able to potentiate PecS protein activity in vivo.

Growth of Erwinia chrysanthemi in media of elevated osmolarity can be achieved by the uptake and accumulation of various osmoprotectants. This study deals with the cloning and sequencing of the ousA gene-encoded osmoprotectant uptake system A from E. chrysanthemi 3937. OusA belongs to the superfamily of solute ion cotransporters. This osmotically inducible system allows the uptake of glycine betaine, proline, ectoine, and pipecolic acid and presents strong similarities in nucleotide sequence and protein function with the proline/betaine porter of Escherichia coli encoded by proP. The control of ousA expression is clearly different from that of proP. It is induced by osmotic strength and repressed by osmoprotectants. Its expression in E. coli is controlled by H-NS and is rpoS dependent in the exponential phase but unaffected by the stationary phase.

In planta expression of a high-affinity iron-uptake system involving the siderophore chrysobactin in Erwinia chrysanthemi 3937 contributes greatly to invasive growth of this pathogen on its natural host, African violets. A previous study reported that global regulation by iron in this strain was mediated at the transcriptional level via the cbr locus which, when inactivated by insertional mutation, prevents the chrysobactin system from being tightly repressed by FeCl3. Herein, we report the nucleotide sequence of this locus and the functional analysis of its encoded products. Sequence analysis of a 4.8 kb genomic segment of a plasmid encompassing the cbr locus and characterization of the cognate translated products made it possible to uncover a system exhibiting similarity with prokaryotic transporters implicated in the transport of iron complexes. Accordingly, the CbrA product was shown to be the periplasmic component of a permease complex also including two integral membrane proteins, CbrB and CbrC, and the ATP-binding unit CbrD. This system allowed internalization of Fe(III) when supplied to bacterial cells as 59FeCl3 or 59Fe dicitrate, via complexation to a second siderophore recently detected in strain 3937. Most notably, we demonstrate that this second siderophore-mediated iron-acquisition system is operational in bacterial cells grown in the presence of FeCl3. The regulatory effect of cbr was further assessed on a lacZ chrysobactin operon fusion indicating that the transcriptional control exerted by cbr on expression of the chrysobactin system is of homeostatic nature. in conclusion, E. chrysanthemi provides an interesting model in which iron acquisition involves an inductive process resulting in differential expression of two siderophore-mediated pathways in relation to external iron accessibility.

The Erwinia chrysanthemi metalloprotease C and the Serratia marcescens haem acquisition protein HasA are both secreted from Gram-negative bacteria by a signal peptide-independent pathway which requires a C-terminal secretion signal and a specific ABC-transporter made up of three proteins: a membrane ATPase (the ABC-protein), a second inner membrane component belonging to the membrane fusion protein family and an outer membrane polypeptide. HasA and protease C transporters are homologous although the secreted polypeptides share no sequence homology. Whereas protease C can use both translocators, HasA is secreted only by its specific transporter. Functional analysis of protease C and HasA secretion through hybrid transporters obtained by combining components from each system demonstrates that the ABC-protein is responsible for the substrate specificity and that inhibition of protease C secretion in the presence of HasA results from a defective interaction between HasA and the ABC-protein. We also show that the outer membrane protein, TolC, can combine with the membrane fusion protein HasE in the presence of either ABC-protein to form a functional transporter but not with the membrane fusion protein, PrtE. This indicates a specific interaction between the outer membrane component and the membrane fusion protein.

Many strains of Erwinia chrysanthemi, which are Gram-negative bacterial phytopathogens, produce copious amounts of extracellular polysaccharides. The extracellular polysaccharide from E. chrysanthemi pv. zeae strain SR 260, a phytopathogen of corn, is a branched-chain glucomannorhamnan of proven structure (Gray et al., Carbohydr. Res. 1993, 245, 271-287). The extracellular polysaccharide from E. chrysanthemi Ech6 is different, containing no rhamnose or mannose. It is composed of L-fucose, D-galactose, D-glucose and D-glucuronic acid in the ratio 2:2:1:1. The structure of the polysaccharide is as follows: [sequence: see text]

PrtG is an extracellular metalloprotease secreted by the Gram-negative bacterium Erwinia chrysanthemi through a signal peptide-independent secretion pathway. Previous studies showed that the PrtG secretion signal is COOH-terminal and located in the last 56 residues of PrtG. We have now performed a deletion and elongation mapping of a short secretion competent COOH-terminal peptide CterG. This approach allowed us to show that: (i) the smaller COOH-terminal sequence containing the information necessary to promote the secretion of a small polypeptide is contained in the last 29 residues of PrtG; (ii) a low but significant level of secretion can be promoted by the last 15 residues of PrtG when fused to the COOH terminus of a non-secreted PrtG derivative; (iii) the extreme COOH-terminal sequence Dxxx, where xs are hydrophobic residues, is a conserved motif in all constructs that are secreted through the E. chrysanthemi transporter. (vi) This motif has to be COOH terminally exposed since addition of even one amino acid impairs the secretion of CterG. The extent of the secretion defect observed with the COOH terminally extended variants correlates with the length of the extension. These results indicate a key role for the COOH-terminal exposition of the last four amino acids in the secretion of PrtG.

Erwinia chrysanthemi pv zeae strain SR260, a phytopathogen of corn, produced from lactose an acidic extracellular polysaccharide which was purified and found to consist of L-rhamnose, D-mannose, D-glucose, and D-glucuronic acid in the ratio of 3:1:1:1. A combination of chemical (carboxyl-group reduction, methylation analysis, periodate oxidation, Smith degradation, and lithium-ethylenediamine degradation) and physical (1 and 2D NMR spectroscopy) methods revealed that the polysaccharide is composed of a hexasaccharide repeating unit 1: [formula: see text]

Uptake of [14C]galacturonic acid in Erwinia chrysanthemi was found to be stimulated during growth on pectin and its degradation products, saturated digalacturonic acid and galacturonic acid. Cells isolated from macerated potato tissue also showed increased levels of uptake activity for this molecule compared with those showed by glycerol-grown cells. Uptake was found to be an active process, and it displayed saturation kinetics. An Escherichia coli galacturonic acid transport mutant harboring the E. chrysanthemi exuT gene(s) for galacturonic acid uptake was able to transport galacturonic acid but unable to take up the dimer [3H]digalacturonic acid.

Erwinia chrysanthemi 3937 possesses a saturable, high-affinity transport system for the ferric complex of its native siderophore chrysobactin, [N-alpha-(2,3-dihydroxybenzoyl)-D-lysyl-L-serine]. Uptake of 55Fe-labeled chrysobactin was completely inhibited by respiratory poison or low temperature and was significantly reduced in rich medium. The kinetics of chrysobactin-mediated iron transport were determined to have apparent Km and Vmax values of about 30 nM and of 90 pmol/mg.min, respectively. Isomers of chrysobactin and analogs with progressively shorter side chains mediated ferric iron transport as efficiently as the native siderophore, which indicates that the chrysobactin receptor primarily recognizes the catechol-iron center. Free ligand in excess only moderately reduced the accumulation of 55Fe. Chrysobactin may therefore be regarded as a true siderophore for E. chrysanthemi.

Systemic virulence of the phytopathogen Erwinia chrysanthemi 3937 requires a functional iron assimilation system which, in this enterobacterium, is mediated by the siderophore chrysobactin and the outer membrane transport protein Fct. We investigated the regulation of this system by iron. No direct similarity with the Escherichia coli fur gene was found. Insertional mutagenesis allowed isolation of a regulatory mutant which expressed chrysobactin and two other high-affinity iron transport systems previously characterized in strain 3937, regardless of the iron level. RNA/DNA hybridization analysis established that regulation of chrysobactin by iron occurs at the transcriptional level. From a wild-type gene library, a recombinant cosmid able to restore normal regulation in the mutant strain was isolated. By generating a series of subclones and mini-Mulac insertions, we identified a regulatory locus (cbr) extending beyond c. 2.5kb which encodes two polypeptides, CbrA and CbrB, with molecular weights of 34,000 and 55,000 respectively. Functional analysis of the locus suggests that the cognate genes cbrA and cbrB are clustered within an operon. Their expression was studied through chromosomal lac gene fusions, in the presence of plasmid-borne wild-type constructions, under high- and low-iron conditions. In summary, the data show that in the presence of iron, cbr negatively regulates the chrysobactin biosynthetic and transport genes, while under conditions of depletion, cbr is subject to negative autogeneous regulation.

The phytopathogenic bacterium Erwinia chrysanthemi produces the monocatecholate siderophore chrysobactin under conditions of iron deprivation. Only the catecholate hydroxyl groups participate in metal coordination, and chrysobactin is therefore unable to provide full 1:1 coordination of Fe(III). The stoichiometry in aqueous solution is a variable dependent on pH and metal/ligand ratio, in addition to being concentration dependent. At neutral pH and concentrations of about 0.1 mM, ferric chrysobactin exists as a mixture of bis and tris complexes. Chrysobactin and its isomers form optically active tris complexes. The dominant configuration depends on the chirality of the amino acid to which the catecholate moiety is attached.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.

The iron assimilation system of Erwinia chrysanthemi 3937 is mediated by the catechol-type siderophore chrysobactin and the outer membrane transport protein Fct. We generated a variety of subclones in high- and low-copy-number vectors from a wild-type recombinant cosmid shown previously to carry the gene cluster fct-cbsA, cbsB, cbsC, cbsE encoding chrysobactin transport and biosynthetic functions, respectively. We studied their expression in Escherichia coli enterobactin-deficient entA, entB, entC, and entE mutants. This provided evidence that the fct and cbs genes are regrouped within a single genetic unit of ca. 8 kb in the following order: fct, cbsC, cbsE, cbsB, and cbsA. The gene boundaries were determined, and the various recombinant plasmids were expressed in Escherichia coli minicells: CbsA and CbsC enzymatic activities were clearly identified as polypeptides with apparent molecular masses of 32,000 and 38,000, respectively.

Erwinia chrysanthemi, a Gram-negative phythopathogenic bacterium, secretes two related extracellular metalloproteases, B and C, which do not have N-terminal signal sequences. The specific pathway by which they are secreted, which has been reconstituted in Escherichia coli, comprises three proteins -- PrtD, PrtE and PrtF. Hybrid proteins containing segments of these proteins fused to the C-terminus of protease B were purified and used to immunize rabbits. The antisera thus obtained were used to study the location and membrane topology of the three proteins. PrtD and PrtE were found to cofractionate almost exclusively with the cytoplasmic membrane, whereas PrtF was found to co-fractionate mostly with the outer membrane. Proteinase K accessibility experiments as well as sequence data lead us to propose that PrtF has one or both ends exposed to the periplasm, that PrtE has one transmembrane segment with its amino-terminus facing the cytoplasm and its C-terminal hydrophilic domain exposed to the periplasm, and that PrtD has six transmembrane segments with its N-terminus and its C-terminal hydrophilic domain in the cytoplasm.

Twenty of the twenty-two MudII1734 insertions impairing the chrysobactin iron-assimilation system of Erwinia chrysanthemi 3937 were localized to a 50 kbp genomic insert contained in the R-prime plasmid, R'4 (Enard et al., 1988). Using the conjugative plasmid pULB110 (RP4::mini-Mu) and the generalized transducing phage phi EC2, we located this iron-transport region and the two unlinked mutations on the chromosome linkage map. Chrysobactin is a catechol-type siderophore and, as we have previously observed with the entA locus of Escherichia coli, the E. chrysanthemi-derived R'4 was found to complement E. coli entB and entE mutations. A 2.9 kb EcoRi and a 4.8 kb BamHI fragment in the R'4 sharing homology with the E. coli entCEBAP15 operon DNA were subcloned. These fragments were used as DNA/DNA hybridization probes to screen a wild-type gene library, yielding a recombinant cosmid (pEC7) able to complement mutations disrupting the 2,3-dihydroxybenzoic acid biosynthetic pathway in both Erwinia and Escherichia spp. as well as the E. coli entE mutation. Physical mapping of the genomic MudII1734 insertions corresponding to these mutations led to the identification of a cluster of genes confined to a DNA sequence of about 10 kb required for both biosynthetic and receptor functions.