Search

All organisms produce an intracellular Zn 2+ -dependent enzyme, phosphomannose isomerase (PMI) or mannose-6 phosphate isomerase, that catalyzes the reversible conversion of mannose-6-phosphate and fructose-6-phosphate during sugar metabolism and polysaccharide biosynthesis. Unexpectedly, we discovered an additional PMI function in Borrelia burgdorferi , the pathogen of Lyme disease, where the enzyme is localized on the cell surface and binds to collagen IV-a host extracellular matrix component predominantly found in the skin. The AlphaFold 3-based structural model of B. burgdorferi PMI (BbPMI) retains the active site with tetrahedrally-coordinated Zn 2+ seen in other PMIs of known structure, residing in an elongated crevice. Ligand docking shows that the crevice can accommodate the tip trisaccharide moiety of a glycosylated asparagine residue on the collagen IV 7S domain. Low doses of a well-known PMI benzoisothiazolone inhibitor impair the growth of diverse strains of B. burgdorferi in culture, but not other tested Gram-negative or Gram-positive pathogens. Borrelia cells are even more susceptible to several other structurally related benzoisothiazolone analogs. The passive transfer of anti-BbPMI antibodies in ticks can impact spirochete transmission to mice, while the treatment of collagen IV-containing murine skin with PMI inhibitors impairs spirochete infectivity. Taken together, these results highlight a newly discovered role for BbPMI in mediating host-pathogen interactions during the spirochete infectivity process. In turn, this discovery offers an opportunity for the development of a novel therapeutic strategy to combat Lyme disease by preventing the BbPMI interaction with its host receptor, collagen IV., Importance: All organisms produce an intracellular enzyme, phosphomannose isomerase (PMI), that converts specific sugars during metabolism. Unexpectedly, we discovered an additional PMI function in Borrelia burgdorferi , the Lyme disease pathogen, where the enzyme is localized on the cell surface and binds to collagen IV-a host extracellular molecule mainly found in the skin. Low doses of PMI chemical inhibitors impair the growth of diverse strains of B. burgdorferi in culture, but not other tested bacterial pathogens. The passive transfer of anti-BbPMI antibodies in ticks can impact B. burgdorferi transmission to mice, while the treatment of collagen IV-containing murine skin with PMI inhibitors impairs infectivity. Taken together, these results highlight a newly discovered role for BbPMI in mediating host-pathogen interactions during infection. In turn, this discovery offers an opportunity for the development of a novel therapeutic strategy to combat Lyme disease by preventing BbPMI function and interaction with host collagen IV.

The valid assessment of vocabulary development in dual-language-learning infants is critical to developmental science. We developed the Dual Language Learners English-Spanish (DLL-ES) Inventories to measure vocabularies of U.S. English-Spanish DLLs. The inventories provide translation equivalents for all Spanish and English items on Communicative Development Inventory (CDI) short forms; extended inventories based on CDI long forms; and Spanish language-variety options. Item-Response Theory analyses applied to Wordbank and Web-CDI data (n = 2603, 12-18 months; n = 6722, 16-36 months; half female; 1% Asian, 3% Black, 2% Hispanic, 30% White, 64% unknown) showed near-perfect associations between DLL-ES and CDI long-form scores. Interviews with 10 Hispanic mothers of 18- to 24-month-olds (2 White, 1 Black, 7 multi-racial; 6 female) provide a proof of concept for the value of the DLL-ES for assessing the vocabularies of DLLs., (© 2024 International Congress of Infant Studies.)

Importance: Lyme disease is a major tick-borne infection caused by a bacterial pathogen called Borrelia burgdorferi , which is transmitted by ticks and affects hundreds of thousands of people every year. These bacterial pathogens are distinct from other genera of microbes because of their distinct features and ability to transmit a multi-system infection to a range of vertebrates, including humans. Progress in understanding the infection biology of Lyme disease, and thus advancements towards its prevention, are hindered by an incomplete understanding of the microbiology of B. burgdorferi , partly due to the occurrence of many unique borrelial proteins that are structurally unrelated to proteins of known functions yet are indispensable for pathogen survival. We herein report the use of diverse technologies to examine the structure and function of a unique B. burgdorferi protein, annotated as BB0238-an essential virulence determinant. We show that the protein is structurally organized into two distinct domains, is involved in multiplex protein-protein interactions, and facilitates tick-to-mouse pathogen transmission by aiding microbial evasion of early host cellular immunity. We believe that our findings will further enrich our understanding of the microbiology of B. burgdorferi, potentially impacting the future development of novel prevention strategies against a widespread tick-transmitted infection., Competing Interests: The authors declare no conflict of interest.

The CASP14 experiment demonstrated the extraordinary structure modeling capabilities of artificial intelligence (AI) methods. That result has ignited a fierce debate about what these methods are actually doing. One of the criticisms has been that the AI does not have any sense of the underlying physics but is merely performing pattern recognition. Here, we address that issue by analyzing the extent to which the methods identify rare structural motifs. The rationale underlying the approach is that a pattern recognition machine tends to choose the more frequently occurring motifs, whereas some sense of subtle energetic factors is required to choose infrequently occurring ones. To reduce the possibility of bias from related experimental structures and to minimize the effect of experimental errors, we examined only CASP14 target protein crystal structures determined to a resolution limit better than 2 Å, which lacked significant amino acid sequence homology to proteins of known structure. In those experimental structures and in the corresponding models, we track cis peptides, π-helices, 3 10 -helices, and other small 3D motifs that occur in the PDB database at a frequency of lower than 1% of total amino acid residues. The best-performing AI method, AlphaFold2, captured these uncommon structural elements exquisitely well. All discrepancies appeared to be a consequence of crystal environment effects. We propose that the neural network learned a protein structure potential of mean force, enabling it to correctly identify situations where unusual structural features represent the lowest local free energy because of subtle influences from the atomic environment.

The rise of multi-drug-resistant bacteria that cannot be treated with traditional antibiotics has prompted the search for alternatives to combat bacterial infections. Endolysins, which are bacteriophage-derived peptidoglycan hydrolases, are attractive tools in this fight. Several studies have already demonstrated the efficacy of endolysins in targeting bacterial infections. Endolysins encoded by bacteriophages that infect Gram-positive bacteria typically possess an N-terminal catalytic domain and a C-terminal cell-wall binding domain (CWBD). In this study, we have uncovered the molecular mechanisms that underlie formation of a homodimer of Cpl-1, an endolysin that targets Streptococcus pneumoniae . Here, we use site-directed mutagenesis, analytical size exclusion chromatography, and analytical ultracentrifugation to disprove a previous suggestion that three residues at the N-terminus of the CWBD are involved in the formation of a Cpl-1 dimer in the presence of choline in solution. We conclusively show that the C-terminal tail region of Cpl-1 is involved in formation of the dimer. Alanine scanning mutagenesis generated various tail mutant constructs that allowed identification of key residues that mediate Cpl-1 dimer formation. Finally, our results allowed identification of a consensus sequence (FxxEPDGLIT) required for choline-dependent dimer formation─a sequence that occurs frequently in pneumococcal autolysins and endolysins. These findings shed light on the mechanisms of Cpl-1 and related enzymes and can be used to inform future engineering efforts for their therapeutic development against S. pneumoniae .

Behavioral flexibility-the ability to tailor motor actions to changing body-environment relations-is critical for functional movement. Navigating the everyday environment requires the ability to generate a wide repertoire of actions, select the appropriate action for the current situation, and implement it quickly and accurately. We used a new, adjustable barrier paradigm to assess flexibility of motor actions in 20 17-month-old (eight girls, 12 boys) and 14 13-month-old (seven girls, eight boys) walking infants and a comparative sample of 14 adults (eight women, six men). Most participants were White, non-Hispanic, and middle class. Participants navigated under barriers normalized to their standing height (overhead, eye, chest, hip, and knee heights). Decreases in barrier height required lower postures for passage. Every participant altered their initial walking posture according to barrier height for every trial, and all but two 13-month-olds found solutions for passage. Compared to infants, adults displayed a wider variety of strategies (squat-walking, half-kneeling, etc.), found more appropriate solutions based on barrier height (ducked at eye height and low crawled at knee height), and implemented their solutions more quickly (within 4 s) and accurately (without bumping their heads against the barrier). Infants frequently crawled even when the barrier height did not warrant a low posture, displayed multiple postural shifts prior to passage and thus took longer to go, and often bumped their heads. Infants' improvements were related to age and walking experience. Thus, development of flexibility likely involves the contributions of multiple domains-motor, perception, and cognition-that facilitate strategy selection and implementation. (PsycInfo Database Record (c) 2022 APA, all rights reserved).

Infants everywhere engage with objects throughout the day, even if the objects of play differ across cultures. Indeed, object play is a universal context for learning. Yet, the characteristics of object play at home remain largely unexamined, especially in infants from non-English-speaking backgrounds. Through frame-by-frame video coding, we documented Hispanic infants' object interactions based on 1-2 h of naturalistic home observations. Infants interacted with a wide variety of toys and household objects in brief bouts that summed to ~60% of their time. As infants transition among objects, they serendipitously generate opportunities for learning that support development across domains., (Copyright © 2022. Published by Elsevier Inc.)

Infants develop in a social context, surrounded by knowledgeable caregivers who scaffold learning through shared engagement with objects. However, researchers have typically examined joint engagement in structured tasks, where caregivers sit near infants and display frequent, prompt, and multimodal behaviors around the objects of infant action. Which features of joint engagement generalize to the real-world? Despite the importance of joint engagement for infant learning, critical assumptions around joint engagement in everyday interaction remain unexamined. We investigated behavioral and temporal features of joint engagement in the home environment, where objects for play abound and dyad proximity fluctuates. Infant manual actions, mother manual and verbal behaviors, and dyad proximity were coded frame-by-frame from 2-h naturalistic recordings of 13- to 23-month-old infants and their mothers (N = 38). Infants experienced rich, highly structured, multimodal mother input around the objects of their actions. Specifically, joint engagement occurred within seconds of infant action and was amplified in the context of interpersonal proximity. Findings validate laboratory-based research on characteristics of joint engagement while highlighting unique properties around the role of mother-infant proximity and temporal structuring of caregiver input over extended time frames. Implications for the social contexts that support infant learning and development are discussed., (© 2022 International Congress of Infant Studies (ICIS).)

Giardiasis is a disease caused by the protist Giardia lamblia. As no human vaccines have been approved so far against it, and resistance to current drugs is spreading, new strategies for combating giardiasis need to be developed. The G. lamblia ribosome may provide a promising therapeutic target due to its distinct sequence differences from ribosomes of most eukaryotes and prokaryotes. Here, we report the cryo-electron microscopy structure of the G. lamblia (WB strain) ribosome determined at 2.75 Å resolution. The ribosomal RNA is the shortest known among eukaryotes, and lacks nearly all the eukaryote-specific ribosomal RNA expansion segments. In contrast, the ribosomal proteins are typically eukaryotic with some species-specific insertions/extensions. Most typical inter-subunit bridges are maintained except for one missing contact site. Unique structural features are located mainly at the ribosome's periphery. These may be exploited as target sites for the design of new compounds that inhibit selectively the parasite's ribosomal activity., (© The Author(s) 2022. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Four tailspike proteins (TSP1-4) of Escherichia coli O157:H7 bacteriophage CBA120 enable infection of multiple hosts. They form a branched complex that attaches to the tail baseplate. Each TSP recognizes a different lipopolysaccharide on the membrane of a different bacterial host. The 335 N-terminal residues of TSP4 promote the assembly of the TSP complex and anchor it to the tail baseplate. The crystal structure of TSP4-N 335 reveals a trimeric protein comprising four domains. The baseplate anchor domain (AD) contains an intertwined triple-stranded β-helix. The ensuing XD1, XD2 and XD3 β-sheet containing domains mediate the binding of TSP1-3 to TSP4. Each of the XD domains adopts the same fold as the respective XD domains of bacteriophage T4 gp10 baseplate protein, known to engage in protein-protein interactions via its XD2 and XD3 domains. The structural similarity suggests that XD2 and XD3 of TSP4 also function in protein-protein interactions. Analytical ultracentrifugation analyses of TSP4-N 335 and of domain deletion proteins showed how TSP4-N 335 promotes the formation of the TSP quaternary complex. TSP1 and TSP2 bind directly to TSP4 whereas TSP3 binding requires a pre-formed TSP4-N 335 :TSP2 complex. A 3-dimensional model of the bacteriophage CBA120 TSP complex has been developed based on the structural and ultracentrifuge information., (© 2022. The Author(s).)

Object play yields enormous benefits for infant development. However, little is known about natural play at home where most object interactions occur. We conducted frame-by-frame video analyses of spontaneous activity in two 2-h home visits with 13-month-old crawling infants and 13-, 18-, and 23-month-old walking infants (N = 40; 21 boys; 75% White). Regardless of age, for every infant and time scale, across 10,015 object bouts, object interactions were short (median = 9.8 s) and varied (transitions among dozens of toys and non-toys) but consumed most of infants' time. We suggest that infant exuberant object play-immense amounts of brief, time-distributed, variable interactions with objects-may be conducive to learning object properties and functions, motor skill acquisition, and growth in cognitive, social, and language domains., (© 2021 The Authors. Child Development © 2021 Society for Research in Child Development.)

Critical assessment of structure prediction (CASP) conducts community experiments to determine the state of the art in computing protein structure from amino acid sequence. The process relies on the experimental community providing information about not yet public or about to be solved structures, for use as targets. For some targets, the experimental structure is not solved in time for use in CASP. Calculated structure accuracy improved dramatically in this round, implying that models should now be much more useful for resolving many sorts of experimental difficulties. To test this, selected models for seven unsolved targets were provided to the experimental groups. These models were from the AlphaFold2 group, who overall submitted the most accurate predictions in CASP14. Four targets were solved with the aid of the models, and, additionally, the structure of an already solved target was improved. An a posteriori analysis showed that, in some cases, models from other groups would also be effective. This paper provides accounts of the successful application of models to structure determination, including molecular replacement for X-ray crystallography, backbone tracing and sequence positioning in a cryo-electron microscopy structure, and correction of local features. The results suggest that, in future, there will be greatly increased synergy between computational and experimental approaches to structure determination., (© 2021 Wiley Periodicals LLC.)

Video data are uniquely suited for research reuse and for documenting research methods and findings. However, curation of video data is a serious hurdle for researchers in the social and behavioral sciences, where behavioral video data are obtained session by session and data sharing is not the norm. To eliminate the onerous burden of post hoc curation at the time of publication (or later), we describe best practices in active data curation-where data are curated and uploaded immediately after each data collection to allow instantaneous sharing with one button press at any time. Indeed, we recommend that researchers adopt "hyperactive" data curation where they openly share every step of their research process. The necessary infrastructure and tools are provided by Databrary-a secure, web-based data library designed for active curation and sharing of personally identifiable video data and associated metadata. We provide a case study of hyperactive curation of video data from the Play and Learning Across a Year (PLAY) project, where dozens of researchers developed a common protocol to collect, annotate, and actively curate video data of infants and mothers during natural activity in their homes at research sites across North America. PLAY relies on scalable standardized workflows to facilitate collaborative research, assure data quality, and prepare the corpus for sharing and reuse throughout the entire research process.

Giardiasis, caused by the intestinal parasite Giardia lamblia , is a severe diarrheal disease, endemic in poverty-stricken regions of the world, and also a common infection in developed countries. The available therapeutic options are associated with adverse effects, and G. lamblia resistance to the standard-of-care drugs is spreading. Fumagillin, an antimicrosporidiosis drug, is a therapeutic agent with potential for the treatment of giardiasis. However, it exhibits considerable, albeit reversible, toxicity when used to treat immunocompromised microsporidiosis patients. Fumagillin is also a highly unstable compound. To address these liabilities, we designed and synthesized stable fumagillol derivatives with lower levels of permeation across polarized epithelial Caco-2 cells and better potency against G. lamblia trophozoites than fumagillin. Metronidazole-resistant G. lamblia strains were also susceptible to the new fumagillol derivatives. In addition, these compounds were more potent against the amebiasis-causing parasite Entamoeba histolytica than fumagillin. Two compounds exhibited better thermal and acid stability than fumagillin, which should prolong the drug shelf life and reduce compound degradation in the stomach. Studies with a mouse model of giardiasis with the most stable compound, 4-(((((3 R ,4 S ,5 S ,6 R )-5-methoxy-4-((2 R ,3 R )-2-methyl-3-(3-methylbut-2-en-1-yl)oxiran-2-yl)-1-oxaspiro[2.5]octan-6-yl)oxy)carbonyl)amino)benzoic acid (compound 9), revealed that it had better efficacy (effective dose [ED]) than fumagillin at both the fully curative dose (the 100% ED) of 6.6 mg/kg of body weight and a 50% ED of 0.064 mg/kg. Plasma pharmacokinetics revealed the slow absorption of compound 9 through the gut, consistent with the in vitro characterization in Caco-2 cells. An acute-dose study yielded a maximum tolerated dose (MTD) of 1,500 mg/kg, 227-fold higher than the fully curative dose. Thus, along with improved stability, compound 9 also exhibited an excellent therapeutic window., (Copyright © 2020 Padia et al.)

The genome of Escherichia coli O157:H7 bacteriophage vB_EcoM_CBA120 encodes four distinct tailspike proteins (TSPs). The four TSPs, TSP1-4, attach to the phage baseplate forming a branched structure. We report the 1.9 Å resolution crystal structure of TSP2 (ORF211), the TSP that confers phage specificity towards E. coli O157:H7. The structure shows that the N-terminal 168 residues involved in TSPs complex assembly are disordered in the absence of partner proteins. The ensuing head domain contains only the first of two fold modules seen in other phage vB_EcoM_CBA120 TSPs. The catalytic site resides in a cleft at the interface between adjacent trimer subunits, where Asp506, Glu568, and Asp571 are located in close proximity. Replacement of Asp506 and Asp571 for alanine residues abolishes enzyme activity, thus identifying the acid/base catalytic machinery. However, activity remains intact when Asp506 and Asp571 are mutated into asparagine residues. Analysis of additional site-directed mutants in the background of the D506N:D571N mutant suggests engagement of an alternative catalytic apparatus comprising Glu568 and Tyr623. Finally, we demonstrate the catalytic role of two interacting glutamate residues of TSP1, located in a cleft between two trimer subunits, Glu456 and Glu483, underscoring the diversity of the catalytic apparatus employed by phage vB_EcoM_CBA120 TSPs.

We investigated the real-time cascade of postural, visual, and manual actions for object prehension in 38 6- to 12-month-old infants (all independent sitters) and eight adults. Participants' task was to retrieve a target as they spun past it at different speeds on a motorized chair. A head-mounted eye tracker recorded visual actions and video captured postural and manual actions. Prehension played out in a coordinated sequence of postural-visual-manual behaviors starting with turning the head and trunk to bring the toy into view, which in turn instigated the start of the reach. Visually fixating the toy to locate its position guided the hand for toy contact and retrieval. Prehension performance decreased at faster speeds, but quick planning and implementation of actions predicted better performance., (© 2019 Society for Research in Child Development.)

Purpose: Gasdermin B (GSDMB) overexpression/amplification occurs in about 60% of HER2 breast cancers, where it promotes cell migration, resistance to anti-HER2 therapies, and poor clinical outcome. Thus, we tackle GSDMB cytoplasmic overexpression as a new therapeutic target in HER2 breast cancers., Experimental Design: We have developed a new targeted nanomedicine based on hyaluronic acid-biocompatible nanocapsules, which allow the intracellular delivery of a specific anti-GSDMB antibody into HER2 breast cancer cells both in vitro and in vivo ., Results: Using different models of HER2 breast cancer cells, we show that anti-GSDMB antibody loaded to nanocapsules has significant and specific effects on GSDMB-overexpressing cancer cells' behavior in ways such as (i) lowering the in vitro cell migration induced by GSDMB; (ii) enhancing the sensitivity to trastuzumab; (iii) reducing tumor growth by increasing apoptotic rate in orthotopic breast cancer xenografts; and (iv) diminishing lung metastasis in MDA-MB-231-HER2 cells in vivo . Moreover, at a mechanistic level, we have shown that AbGB increases GSDMB binding to sulfatides and consequently decreases migratory cell behavior and may upregulate the potential intrinsic procell death activity of GSDMB., Conclusions: Our findings portray the first evidence of the effectiveness and specificity of an antibody-based nanomedicine that targets an intracellular oncoprotein. We have proved that intracellular-delivered anti-GSDMB reduces diverse protumor GSDMB functions (migration, metastasis, and resistance to therapy) in an efficient and specific way, thus providing a new targeted therapeutic strategy in aggressive HER2 cancers with poor prognosis., (©2019 American Association for Cancer Research.)

Bacteriophage tailspike proteins mediate virion absorption through reversible primary receptor binding, followed by lipopolysaccharide or exopolysaccharide degradation. The Escherichia coli O157:H7 bacteriophage CBA120 genome encodes four distinct tailspike proteins, annotated as ORFs 210 through 213. Previously, we reported the crystal structure of ORF210 (TSP1). Here we describe the crystal structure of ORF212 (TSP3) determined at 1.85 Å resolution. As observed with other tailspike proteins, TSP3 assembles into a trimer. Each subunit of TSP3 has an N-terminal head domain that is structurally similar to that of TSP1, consistent with their high amino acid sequence identity. In contrast, despite sharing a β-helix fold, the overall structure of the C-terminal catalytic domain of TSP3 is quite different when compared to TSP1. The TSP3 structure suggests that the glycosidase active site resides in a cleft at the interface between two adjacent subunits where three acidic residues, Glu362 and Asp383 on one subunit, and Asp426 on a second subunit, are located in close proximity. Comparing the glycosidase activity of wild-type TSP3 to various point mutants revealed that catalysis requires the carboxyl groups of Glu362 and Asp426, and not of Asp383, confirming the enzyme employs two carboxyl groups to degrade lippopolysaccharide using an acid/base mechanism.

Background: The Israeli Newborn Hearing Screening Program (NHSP) began operating nationally in January 2010. The program includes the Otoacoustic Emissions (OAE) test for all newborns and Automated Auditory Brainstem Response (A-ABR) test for failed OAE and infants at risk for auditory neuropathy spectrum disorders. NHSP targets are diagnosis of hearing impairment by age three months and initiation of habilitation by six months., Objectives: (1) Review NHSP coverage; (2) Assess NHSP impact on age at diagnosis for hearing impairment and age at initiation of habilitation; (3) Identify contributing factors and barriers to NHSP success., Methods: (1) Analysis of screening coverage and referral rates for the NHSP; (2) Analysis of demographic data, results of coverage, age at diagnosis and initiation of habilitation for hearing impaired infants pre-implementation and post-implementation of NHSP from 10 habilitation centers; (3) Telephone interviews with parents whose infants failed the screening and were referred for further testing., Results: The NHSP coverage was 98.7% (95.1 to 100%) for approximately 179,000 live births per year for 2014-2016 and average referral rates were under 3%. After three years of program implementation, median age at diagnosis was 3.7 months compared to 9.5 months prior to NHSP. The median age at initiation of habilitation after three years of NHSP was 9.4 months compared to 19.0 prior to NHSP. Parents (84% of 483 sampled) with infants aged 4-6 months participated in the telephone survey. While 84% of parents reported receiving a verbal explanation of the screening results, more than half of the parents reported not receiving written material. Parental report of understanding the test results and a heightened level of concern over the failed screen were associated with timely follow-up., Conclusions: The findings indicate high screening coverage. The program reduced ages at diagnosis and initiation of habilitation for hearing impaired infants. Further steps needed to streamline the NHSP are improving communication among caregivers to parents to reduce anxiety; increasing efficiency in transferring information between service providers using advanced technology while ensuring continuum of care; reducing wait time for follow-up testing in order to meet program objectives. Establishment of a routine monitoring system is underway.

The functional and biological significance of the selected CASP12 targets are described by the authors of the structures. The crystallographers discuss the most interesting structural features of the target proteins and assess whether these features were correctly reproduced in the predictions submitted to the CASP12 experiment., (© 2017 Wiley Periodicals, Inc.)

Two Borrelia burgdorferi interacting proteins, BB0238 and BB0323, play distinct roles in pathogen biology and infectivity although a significance of their interaction remained enigmatic. Here we identified the polypeptide segment essential for BB0238-BB0323 interaction and examined how it supports spirochete infectivity. We show that the interaction region in BB0323 requires amino acid residues 22-200, suggesting that the binding encompasses discontinuous protein segments. In contrast, the interaction region in BB0238 spans only 11 amino acids, residues 120-130. A deletion of these 11 amino acids neither alters the overall secondary structure of the protein, nor affects its stability or oligomerization property, however, it reduces the post-translational stability of the binding partner, BB0323. Mutant B. burgdorferi isolates producing BB0238 lacking the 11-amino acid interaction region were able to persist in ticks but failed to transmit to mice or to establish infection. These results suggest that BB0238-BB0323 interaction is critical for post-translational stability of BB0323, and that this interaction is important for mammalian infectivity and transmission of B. burgdorferi. We show that saturation or inhibition of BB0238-BB0323 interaction could be studied in a luciferase assay, which could be amenable for future identification of small molecule inhibitors to combat B. burgdorferi infection.

The exact function of human gasdermin-B (GSDMB), which regulates differentiation and growth of epithelial cells, is yet to be elucidated. In human epidermal growth factor receptor 2 (HER2)-positive breast cancer, GSDMB gene amplification and protein overexpression indicate a poor response to HER2-targeted therapy. Genome-wide association studies revealed a correlation between GSDMB SNPs and an increased susceptibility to Crohn's disease, ulcerative colitis, and asthma. The N- and C-terminal domains of all gasdermins possess lipid-binding and regulatory activities, respectively. Inflammatory caspases cleave gasdermin-D in the interdomain linker but not GSDMB. The cleaved N-terminal domain binds phosphoinositides and cardiolipin, forms membrane-disrupting pores, and executes pyroptosis. We show that both full-length GSDMB and the N-terminal domain bind to nitrocellulose membranes immobilized with phosphoinositides or sulfatide, but not with cardiolipin. In addition, the GSDMB N-terminal domain binds liposomes containing sulfatide. The crystal structure of the GSDMB C-terminal domain reveals the structural impact of the amino acids encoded by SNPs that are linked to asthma and inflammatory bowel disease (IBD). A loop that carries the polymorphism amino acids corresponding to healthy individuals (Gly299:Pro306) exhibits high conformational flexibility, whereas the loop carrying amino acids found in individuals with increased disease risk (Arg299:Ser306) exhibits a well-defined conformation and higher positive surface charge. Apoptotic executioner caspase-3, -6, and -7, but not the inflammatory caspases, cleave GSDMB at 88 DNVD 91 within the N-terminal domain. Selective sulfatide binding may indicate possible function for GSDMB in the cellular sulfatide transport.

Giardiasis is a severe intestinal parasitic disease caused by Giardia lamblia, which inflicts many people in poor regions and is the most common parasitic infection in the United States. Current standard care drugs are associated with undesirable side effects, treatment failures, and an increasing incidence of drug resistance. As follow-up to a high-throughput screening of an approved drug library, which identified compounds lethal to G. lamblia trophozoites, we have determined the minimum lethal concentrations of 28 drugs and advanced 10 of them to in vivo studies in mice. The results were compared to treatment with the standard care drug, metronidazole, in order to identify drugs with equal or better anti-Giardia activities. Three drugs, fumagillin, carbadox, and tioxidazole, were identified. These compounds were also potent against metronidazole-resistant human G. lamblia isolates (assemblages A and B), as determined in in vitro assays. Of these three compounds, fumagillin is currently an orphan drug used within the European Union to treat microsporidiosis in immunocompromised individuals, whereas carbadox and tioxidazole are used in veterinary medicine. A dose-dependent study of fumagillin in a giardiasis mouse model revealed that the effective dose of fumagillin was ∼ 100-fold lower than the metronidazole dose. Therefore, fumagillin may be advanced to further studies as an alternative treatment for giardiasis when metronidazole fails., (Copyright © 2014, American Society for Microbiology. All Rights Reserved.)

Recepteur d'origine nantais (RON) receptor tyrosine kinase and its ligand, serum macrophage-stimulating protein (MSP), play important roles in inflammation, cell growth, migration, and epithelial to mesenchymal transition during tumor development. The binding of mature MSPαβ (disulfide-linked α- and β-chains) to RON ectodomain modulates receptor dimerization, followed by autophosphorylation of tyrosines in the cytoplasmic receptor kinase domains. Receptor recognition is mediated by binding of MSP β-chain (MSPβ) to the RON Sema. Here we report the structure of RON Sema-PSI-IPT1 (SPI1) domains in complex with MSPβ at 3.0 Å resolution. The MSPβ serine protease-like β-barrel uses the degenerate serine protease active site to recognize blades 2, 3, and 4 of the β-propeller fold of RON Sema. Despite the sequence homology between RON and MET receptor tyrosine kinase and between MSP and hepatocyte growth factor, it is well established that there is no cross-reactivity between the two receptor-ligand systems. Comparison of the structure of RON SPI1 in complex with MSPβ and that of MET receptor tyrosine kinase Sema-PSI in complex with hepatocyte growth factor β-chain reveals the receptor-ligand selectivity determinants. Analytical ultracentrifugation studies of the SPI1-MSPβ interaction confirm the formation of a 1:1 complex. SPI1 and MSPαβ also associate primarily as a 1:1 complex with a binding affinity similar to that of SPI1-MSPβ. In addition, the SPI1-MSPαβ ultracentrifuge studies reveal a low abundance 2:2 complex with ∼ 10-fold lower binding affinity compared with the 1:1 species. These results support the hypothesis that the α-chain of MSPαβ mediates RON dimerization., (© 2014 by The American Society for Biochemistry and Molecular Biology, Inc.)

Carbamate kinase from Giardia lamblia is an essential enzyme for the survival of the organism. The enzyme catalyzes the final step in the arginine dihydrolase pathway converting ADP and carbamoyl phosphate to ATP and carbamate. We previously reported that disulfiram, a drug used to treat chronic alcoholism, inhibits G. lamblia CK and kills G. lamblia trophozoites in vitro at submicromolar IC50 values. Here, we examine the structural basis for G. lamblia CK inhibition of disulfiram and its analog, thiram, their activities against both metronidazole-susceptible and metronidazole-resistant G. lamblia isolates, and their efficacy in a mouse model of giardiasis. The crystal structure of G. lamblia CK soaked with disulfiram revealed that the compound thiocarbamoylated Cys-242, a residue located at the edge of the active site. The modified Cys-242 prevents a conformational transition of a loop adjacent to the ADP/ATP binding site, which is required for the stacking of Tyr-245 side chain against the adenine moiety, an interaction seen in the structure of G. lamblia CK in complex with AMP-PNP. Mass spectrometry coupled with trypsin digestion confirmed the selective covalent thiocarbamoylation of Cys-242 in solution. The Giardia viability studies in the metronidazole-resistant strain and the G. lamblia CK irreversible inactivation mechanism show that the thiuram compounds can circumvent the resistance mechanism that renders metronidazole ineffectiveness in drug resistance cases of giardiasis. Together, the studies suggest that G. lamblia CK is an attractive drug target for development of novel antigiardial therapies and that disulfiram, an FDA-approved drug, is a promising candidate for drug repurposing.

Bacteriophage tailspike proteins act as primary receptors, often possessing endoglycosidase activity toward bacterial lipopolysaccharides or other exopolysaccharides, which enable phage absorption and subsequent DNA injection into the host. Phage CBA120, a contractile long-tailed Viunalikevirus phage infects the virulent Escherichia coli O157:H7. This phage encodes four putative tailspike proteins exhibiting little amino acid sequence identity, whose biological roles and substrate specificities are unknown. Here we focus on the first tailspike, TSP1, encoded by the orf210 gene. We have discovered that TSP1 is resistant to protease degradation, exhibits high thermal stability, but does not cleave the O157 antigen. An immune-dot blot has shown that TSP1 binds strongly to non-O157:H7 E. coli cells and more weakly to K. pneumoniae cells, but exhibits little binding to E. coli O157:H7 strains. To facilitate structure-function studies, we have determined the crystal structure of TSP1 to a resolution limit of 1.8 Å. Similar to other tailspikes proteins, TSP1 assembles into elongated homotrimers. The receptor binding region of each subunit adopts a right-handed parallel β helix, reminiscent yet not identical to several known tailspike structures. The structure of the N-terminal domain that binds to the virion particle has not been seen previously. Potential endoglycosidase catalytic sites at the three subunit interfaces contain two adjacent glutamic acids, unlike any catalytic machinery observed in other tailspikes. To identify potential sugar binding sites, the crystal structures of TSP1 in complexes with glucose, α-maltose, or α-lactose were determined. These structures revealed that each sugar binds in a different location and none of the environments appears consistent with an endoglycosidase catalytic site. Such sites may serve to bind sugar units of a yet to be identified bacterial exopolysaccharide.

For the last two decades, CASP has assessed the state of the art in techniques for protein structure prediction and identified areas which required further development. CASP would not have been possible without the prediction targets provided by the experimental structural biology community. In the latest experiment, CASP10, more than 100 structures were suggested as prediction targets, some of which appeared to be extraordinarily difficult for modeling. In this article, authors of some of the most challenging targets discuss which specific scientific question motivated the experimental structure determination of the target protein, which structural features were especially interesting from a structural or functional perspective, and to what extent these features were correctly reproduced in the predictions submitted to CASP10. Specifically, the following targets will be presented: the acid-gated urea channel, a difficult to predict transmembrane protein from the important human pathogen Helicobacter pylori; the structure of human interleukin (IL)-34, a recently discovered helical cytokine; the structure of a functionally uncharacterized enzyme OrfY from Thermoproteus tenax formed by a gene duplication and a novel fold; an ORFan domain of mimivirus sulfhydryl oxidase R596; the fiber protein gene product 17 from bacteriophage T7; the bacteriophage CBA-120 tailspike protein; a virus coat protein from metagenomic samples of the marine environment; and finally, an unprecedented class of structure prediction targets based on engineered disulfide-rich small proteins., (Copyright © 2013 The Authors. Wiley Periodicals, Inc.)

The parasite Giardia lamblia utilizes the L-arginine dihydrolase pathway to generate ATP from L-arginine. Carbamate kinase (CK) catalyzes the last step in this pathway, converting ADP and carbamoyl phosphate to ATP and ammonium carbamate. Because the L-arginine pathway is essential for G. lamblia survival and absent in high eukaryotes including humans, the enzyme is a potential target for drug development. We have determined two crystal structures of G. lamblia CK (glCK) with bound ligands. One structure, in complex with a nonhydrolyzable ATP analog, adenosine 5'-adenylyl-β,γ-imidodiphosphate (AMP-PNP), was determined at 2.6 Å resolution. The second structure, in complex with citric acid bound in the postulated carbamoyl phosphate binding site, was determined in two slightly different states at 2.1 and 2.4 Å resolution. These structures reveal conformational flexibility of an auxiliary domain (amino acid residues 123-170), which exhibits open or closed conformations or structural disorder, depending on the bound ligand. The structures also reveal a smaller conformational change in a region associated the AMP-PNP adenine binding site. The protein residues involved in binding, together with a model of the transition state, suggest that catalysis follows an in-line, predominantly dissociative, phosphotransfer reaction mechanism, and that closure of the flexible auxiliary domain is required to protect the transition state from bulk solvent.

Human THEM4 (hTHEM4) is comprised of a catalytically active hotdog-fold acyl-CoA thioesterase domain and an N-terminal domain of unknown fold and function. hTHEM4 has been linked to Akt1 regulation and cell apoptosis. Herein, we report the X-ray structure of hHTEM4 bound with undecan-2-one-CoA. Structure guided mutagenesis was carried out to confirm the catalytic residues. The N-terminal domain is shown to be partially comprised of irregular and flexible secondary structure, reminiscent of a protein-binding domain. We demonstrate direct hTHEM4-Akt1 binding by immunoprecipitation and by inhibition of Akt1 kinase activity, thus providing independent evidence that hTHEM4 is an Akt1 negative regulator.

We show that changes in the nucleotide sequence alter the DNA conformation in the crystal structures of p63 DNA-binding domain (p63DBD) bound to its response element. The conformation of a 22-bp canonical response element containing an AT spacer between the two half-sites is unaltered compared with that containing a TA spacer, exhibiting superhelical trajectory. In contrast, a GC spacers abolishes the DNA superhelical trajectory and exhibits less bent DNA, suggesting that increased GC content accompanies increased double helix rigidity. A 19-bp DNA, representing an AT-rich response element with overlapping half-sites, maintains superhelical trajectory and reveals two interacting p63DBD dimers crossing one another at 120°. p63DBD binding assays to response elements of increasing length complement the structural studies. We propose that DNA deformation may affect promoter activity, that the ability of p63DBD to bind to superhelical DNA suggests that it is capable of binding to nucleosomes, and that overlapping response elements may provide a mechanism to distinguish between p63 and p53 promoters.

The human pathogen Giardia lamblia is an anaerobic protozoan parasite that causes giardiasis, one of the most common diarrheal diseases worldwide. Although several drugs are available for the treatment of giardisis, resistance to these drugs has been reported and is likely to increase. The Giardia carbamate kinase (glCK) plays an essential role in Giardia metabolism and has no homologs in humans, making it an attractive candidate for anti-Giardia drug development. We have developed a luminescent enzyme coupled assay to measure the activity of glCK by quantitating the amount of ATP produced by the enzyme. This assay is homogeneous and has been miniaturized into a 1536-well plate format. A pilot screen against 4,096 known compounds using this assay yielded a signal-to-basal ratio of 11.5 fold and Z' factor of 0.8 with a hit rate of 0.9 % of inhibitors of glCK. Therefore, this Giardia lamblia carbamate kinase assay is useful for high throughput screening of large compound collection for identification of the inhibitors for drug development.

Aim: To evaluate the reliability and validity of the PEDI in Hebrew (PEDI-H) in children with cerebral palsy (CP) using health care professionals' (HCP) and mothers' evaluations., Methods: The sample comprised 73 participants (40 males, 33 females) with CP. Two modes of PEDI-H administration were used: interview of the mothers by a social worker and HCP evaluation. PEDI-H reliability was examined by two modes: 1) internal consistency via Cronbach's alpha and 2) overall absolute agreement within subject reliability via intraclass correlation coefficient (ICC). Discriminative validity using collapsed strata of the Gross Motor Functional Classification System (GMFCS) (area under the curve=AUC) were examined for each of the PEDI-H sub-domains., Results: Participants' mean age was 8 years 8 months (standard deviation (SD) 2 years 10 months). The reliability of mothers' PEDI-H was good-to-excellent (Cronbach's alpha=0.889-0.964, ICC=0.845-0.938). The HCPs' reliability was excellent (Cronbach's alpha and ICCs > 0.90). The PEDI-H was also reliable in children with mild, moderate, and severe CP (GMFCS=I+II, III and IV+V, respectively), in younger (6-7 years) and older children (8-12 years), and in children with various CP distribution. Mothers and HCPs had low accuracy in Social-Function domains (AUC=0.538-0.686) and moderate-to-high accuracy in Mobility and Self-Care domains (AUC=0.887-0.967). PEDI-H was able to distinguish between children with various CP severities., Conclusion: The PEDI-H has good psychometric properties when administered by mothers and HCPs and can be used in older children with CP.

Human RON (Recepteur d'Origine Nantais) receptor tyrosine kinase is a cell surface receptor for Macrophage Stimulating Protein (MSP). RON mediates signal transduction pathways that regulate cell adhesion, invasion, motility and apoptosis processes. Elevated levels of RON and its alternatively spliced variants are implicated in the progression and metastasis of tumor cells. The binding of MSP α/β heterodimer to the extracellular region of RON receptor induces receptor dimerization and activation by autophosphorylation of the intracellular kinase domains. The ectodomain of RON, containing the ligand recognition and dimerization domains, is composed of a semaphorin (Sema), Plexins-Semaphorins-Integrins domain (PSI), and four Immunoglobulins-Plexins-Transcription factor (IPT) domains. High affinity association between MSP and RON is mediated by the interaction between MSP β-chain and RON Sema, although RON activation requires intact RON and MSP proteins. Here, we report the structure of RON Sema-PSI domains at 1.85 Å resolution. RON Sema domain adopts a seven-bladed β-propeller fold, followed by disulfide bond rich, cysteine-knot PSI motif. Comparison with the homologous Met receptor tyrosine kinase reveals that RON Sema-PSI contains distinguishing secondary structural features. These define the receptors' exclusive selectivity towards their respective ligands, RON for MSP and Met for HGF. The RON Sema-PSI crystal packing generates a homodimer with interface formed by the Sema domain. Mapping of the dimer interface using the RON homology to Met, MSP homology to Hepatocyte Growth Factor (HGF), and the structure of the Met/HGF complex shows the dimer interface overlapping with the putative MSPβ binding site. The crystallographically determined RON Sema-PSI homodimer may represent the dimer assembly that occurs during ligand-independent receptor activation and/or the inhibition of the constitutive activity of RONΔ160 splice variant by the soluble RON splice variant, RONΔ85.

Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

Inhibitors of the Giardia lamblia fructose 1,6-bisphosphate aldolase (GlFBPA), which transforms fructose 1,6-bisphosphate (FBP) to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, were designed based on 3-hydroxy-2-pyridone and 1,2-dihydroxypyridine scaffolds that position two negatively charged tetrahedral groups for interaction with substrate phosphate binding residues, a hydrogen bond donor to the catalytic Asp83, and a Zn(2+) binding group. The inhibition activities for the GlFBPA catalyzed reaction of FBP of the prepared alkyl phosphonate/phosphate substituted 3-hydroxy-2-pyridinones and a dihydroxypyridine were determined. The 3-hydroxy-2-pyridone inhibitor 8 was found to bind to GlFBPA with an affinity (K(i)=14μM) that is comparable to that of FBP (K(m)=2μM) or its inert analog TBP (K(i)=1μM). The X-ray structure of the GlFBPA-inhibitor 8 complex (2.3Å) shows that 8 binds to the active site in the manner predicted by in silico docking with the exception of coordination with Zn(2+). The observed distances and orientation of the pyridone ring O=C-C-OH relative to Zn(2+) are not consistent with a strong interaction. To determine if Zn(2+)coordination occurs in the GlFBPA-inhibitor 8 complex in solution, EXAFS spectra were measured. A four coordinate geometry comprised of the three enzyme histidine ligands and an oxygen atom from the pyridone ring O=C-C-OH was indicated. Analysis of the Zn(2+) coordination geometries in recently reported structures of class II FBPAs suggests that strong Zn(2+) coordination is reserved for the enediolate-like transition state, accounting for minimal contribution of Zn(2+) coordination to binding of 8 to GlFBPA., (Copyright © 2010 Elsevier Inc. All rights reserved.)

The human pathogen Giardia lamblia is an anaerobic protozoan parasite that causes giardiasis, one of the most common diarrheal diseases worldwide. Although several drugs are available for the treatment of giardiasis, drug resistance has been reported and is likely to increase, and recurrent infections are common. The search for new drugs that can overcome the drug-resistant strains of Giardia is an unmet medical need. New drug screen methods can facilitate the drug discovery process and aid with the identification of new drug targets. Using a bioluminescent ATP content assay, we have developed a phenotypic drug screen method to identify compounds that act against the actively growing trophozoite stage of the parasite. This assay is homogeneous, robust, and suitable for high-throughput screening of large compound collections. A screen of 4,096 pharmacologically active small molecules and approved drugs revealed 43 compounds with selective anti-Giardia properties, including 32 previously reported and 11 novel anti-Giardia agents. The most potent novel compound was fumagillin, which showed 50% inhibitory concentrations of 10 nM against the WB isolate and 2 nM against the GS isolate.

High throughput genome wide associations studies (GWAS) are now identifying a large number of genome loci related to risk of common human disease. Each such locus presents a challenge in identifying the relevant underlying mechanism. Here we report the experimental characterization of a proposed causal single nucleotide polymorphism (SNP) in a locus related to risk of Crohn's disease and ulcerative colitis. The SNP lies in the MST1 gene encoding Macrophage Stimulating Protein (MSP), and results in an R689C amino acid substitution within the β-chain of MSP (MSPβ). MSP binding to the RON receptor tyrosine kinase activates signaling pathways involved in the inflammatory response. We have purified wild-type and mutant MSPβ proteins and compared biochemical and biophysical properties that might impact the MSP/RON signaling pathway. Surface plasmon resonance (SPR) binding studies showed that MSPβ R689C affinity to RON is approximately 10-fold lower than that of the wild-type MSPβ and differential scanning fluorimetry (DSF) showed that the thermal stability of the mutant MSPβ was slightly lower than that of wild-type MSPβ, by 1.6 K. The substitution was found not to impair the specific Arg483-Val484 peptide bond cleavage by matriptase-1, required for MSP activation, and mass spectrometry of tryptic fragments of the mutated protein showed that the free thiol introduced by the R689C mutation did not form an aberrant disulfide bond. Together, the studies indicate that the missense SNP impairs MSP function by reducing its affinity to RON and perhaps through a secondary effect on in vivo concentration arising from reduced thermodynamic stability, resulting in down-regulation of the MSP/RON signaling pathway.

Oxalacetate acetylhydrolase (OAH), a member of the phosphoenolpyruvate mutase/isocitrate lyase superfamily, catalyzes the hydrolysis of oxalacetate to oxalic acid and acetate. This study shows that knock-out of the oah gene in Cryphonectria parasitica, the chestnut blight fungus, reduces the ability of the fungus to form cankers on chestnut trees, suggesting that OAH plays a key role in virulence. OAH was produced in Escherichia coli and purified, and its catalytic rates were determined. Oxalacetate is the main OAH substrate, but the enzyme also acts as a lyase of (2R,3S)-dimethyl malate with approximately 1000-fold lower efficacy. The crystal structure of OAH was determined alone, in complex with a mechanism-based inhibitor, 3,3-difluorooxalacetate (DFOA), and in complex with the reaction product, oxalate, to a resolution limit of 1.30, 1.55, and 1.65 A, respectively. OAH assembles into a dimer of dimers with each subunit exhibiting an (alpha/beta)(8) barrel fold and each pair swapping the 8th alpha-helix. An active site "gating loop" exhibits conformational disorder in the ligand-free structure. To obtain the structures of the OAH.ligand complexes, the ligand-free OAH crystals were soaked briefly with DFOA or oxalacetate. DFOA binding leads to ordering of the gating loop in a conformation that sequesters the ligand from the solvent. DFOA binds in a gem-diol form analogous to the oxalacetate intermediate/transition state. Oxalate binds in a planar conformation, but the gating loop is largely disordered. Comparison between the OAH structure and that of the closely related enzyme, 2,3-dimethylmalate lyase, suggests potential determinants of substrate preference.

Carbamate kinase catalyzes the reversible conversion of carbamoyl phosphate and ADP to ATP and ammonium carbamate, which is hydrolyzed to ammonia and carbonate. The three-dimensional structure of carbamate kinase from the human parasite Giardia lamblia (glCK) has been determined at 3 A resolution. The crystals belonged to the monoclinic space group P2(1), with unit-cell parameters a = 69.77, b = 85.41, c = 102.1 A, beta = 106.8 degrees . The structure was refined to a final R factor of 0.227. The essentiality of glCK together with its absence in humans makes the enzyme an attractive candidate for anti-Giardia drug development. Steady-state kinetic rate constants have been determined. The k(cat) for ATP formation is 319 +/- 9 s(-1). The K(m) values for carbamoyl phosphate and ADP are 85 +/- 6 and 70 +/- 5 microM, respectively. The structure suggests that three invariant lysine residues (Lys131, Lys216 and Lys278) may be involved in the binding of substrates and phosphoryl transfer. The structure of glCK reveals that a glycerol molecule binds in the likely carbamoyl phosphate-binding site.

Glycocyamine kinase (GK), a member of the phosphagen kinase family, catalyzes the Mg(2+)-dependent reversible phosphoryl group transfer of the N-phosphoryl group of phosphoglycocyamine to ADP to yield glycocyamine and ATP. This reaction helps to maintain the energy homeostasis of the cell in some multicelullar organisms that encounter high and variable energy turnover. GK from the marine worm Namalycastis sp. is heterodimeric, with two homologous polypeptide chains, alpha and beta, derived from a common pre-mRNA by mutually exclusive N-terminal alternative exons. The N-terminal exon of GKbeta encodes a peptide that is different in sequence and is 16 amino acids longer than that encoded by the N-terminal exon of GKalpha. The crystal structures of recombinant GKalphabeta and GKbetabeta from Namalycastis sp. were determined at 2.6 and 2.4 A resolution, respectively. In addition, the structure of the GKbetabeta was determined at 2.3 A resolution in complex with a transition state analogue, Mg(2+)-ADP-NO(3)(-)-glycocyamine. Consistent with the sequence homology, the GK subunits adopt the same overall fold as that of other phosphagen kinases of known structure (the homodimeric creatine kinase (CK) and the monomeric arginine kinase (AK)). As with CK, the GK N-termini mediate the dimer interface. In both heterodimeric and homodimeric GK forms, the conformations of the two N-termini are asymmetric, and the asymmetry is different than that reported previously for the homodimeric CKs from several organisms. The entire polypeptide chains of GKalphabeta are structurally defined, and the longer N-terminus of the beta subunit is anchored at the dimer interface. In GKbetabeta the 24 N-terminal residues of one subunit and 11 N-terminal residues of the second subunit are disordered. This observation is consistent with a proposal that the GKalphabeta amino acids involved in the interface formation were optimized once a heterodimer emerged as the physiological form of the enzyme. As a consequence, the homodimer interface (either solely alpha or solely beta chains) has been corrupted. In the unbound state, GK exhibits an open conformation analogous to that observed with ligand-free CK or AK. Upon binding the transition state analogue, both subunits of GK undergo the same closure motion that clasps the transition state analogue, in contrast to the transition state analogue complexes of CK, where the corresponding transition state analogue occupies only one subunit, which undergoes domain closure. The active site environments of the GK, CK, and AK at the bound states reveal the structural determinants of substrate specificity. Despite the equivalent binding in both active sites of the GK dimer, the conformational asymmetry of the N-termini is retained. Thus, the coupling between the structural asymmetry and negative cooperativity previously proposed for CK is not supported in the case of GK.

Word retrieval was assessed in 207 normally developing Hebrew-speaking children aged 8-17 through four tasks: picture naming, phonemic fluency, semantic fluency, and homophone meaning generation (HMGT). Scores on all tests correlated positively and significantly with participant age. Yet, age effects and the correlation between age and test scores were weakest for the naming test and strongest for the HMGT. We discuss the nature of the word search involved in each task and suggest that the more executive demands required by a test the steeper the slope of performance increase on this test.

Giardia lamblia arginine deiminase (GlAD), the topic of this paper, belongs to the hydrolase branch of the guanidine-modifying enzyme superfamily, whose members employ Cys-mediated nucleophilic catalysis to promote deimination of l-arginine and its naturally occurring derivatives. G. lamblia is the causative agent in the human disease giardiasis. The results of RNAi/antisense RNA gene-silencing studies reported herein indicate that GlAD is essential for G. lamblia trophozoite survival and thus, a potential target for the development of therapeutic agents for the treatment of giardiasis. The homodimeric recombinant protein was prepared in Escherichia coli for in-depth biochemical characterization. The 2-domain GlAD monomer consists of a N-terminal domain that shares an active site structure (depicted by an insilico model) and kinetic properties (determined by steady-state and transient state kinetic analysis) with its bacterial AD counterparts, and a C-terminal domain of unknown fold and function. GlAD was found to be active over a wide pH range and to accept l-arginine, l-arginine ethyl ester, N(alpha)-benzoyl-l-arginine, and N(omega)-amino-l-arginine as substrates but not agmatine, l-homoarginine, N(alpha)-benzoyl-l-arginine ethyl ester or a variety of arginine-containing peptides. The intermediacy of a Cys424-alkylthiouronium ion covalent enzyme adduct was demonstrated and the rate constants for formation (k(1)=80s(-1)) and hydrolysis (k(2)=35s(-1)) of the intermediate were determined. The comparatively lower value of the steady-state rate constant (k(cat)=2.6s(-1)), suggests that a step following citrulline formation is rate-limiting. Inhibition of GlAD using Cys directed agents was briefly explored. S-Nitroso-l-homocysteine was shown to be an active site directed, irreversible inhibitor whereas N(omega)-cyano-l-arginine did not inhibit GlAD but instead proved to be an active site directed, irreversible inhibitor of the Bacillus cereus AD.