Search

Dibenzo[a,l]pyrene (DB[a,l]P) is the most potent carcinogenic polycyclic aromatic hydrocarbon that has been identified in the environment. Earlier studies in our laboratory indicated that more than 80% of the DB[a,l]P-DNA adducts formed in vitro were depurinating adducts and that most of the stable adducts were formed from diol epoxide intermediates. To complete the profile of both stable and depurinating adducts of DB[a,l]P, we have synthesized standard adducts by reacting 3'-dAMP or 3'-dGMP with either (+/-)-anti- or (+/-)-syn-dibenzo[a,l]pyrene 11,12-dihydrodiol 13, 14-epoxide (DB[a,l]PDE). The adducts were separated by HPLC with an ion-pair column and were identified by fluorescence line-narrowing spectroscopy (FLNS). A total of six pairs of stereoisomers along with another stable DB[a,l]PDE-DNA adduct were successfully isolated and identified. Pairs of (+/-)-trans and (+/-)-cis isomers were expected to be formed from the reaction of anti-DB[a,l]PDE with either dAMP or dGMP. While we were able to identify two pairs of stereoisomeric (+/-)-syn-DB[a,l]PDE-dAMP (cis and trans) and two pairs of stereoisomeric (+/-)-anti-DB[a,l]PDE-dAMP (cis and trans) adducts, identification of all the stereoisomers of dGMP adducts proved to be impossible. A pair of (+/-)-syn-trans-DB[a,l]PDE-dGMP adducts, a pair of (+/-)-anti-cis-DB[a,l]PDE-dGMP adducts, and one syn-cis-DB[a,l]PDE-dGMP adduct were conclusively identified by FLNS. These standard adducts will be used to identify the stable DNA adducts formed by DB[a,l]P and DB[a,l]PDE in vitro and in vivo.

(+/-)-anti-Dibenzo[a,l]pyrene-11,12-dihydrodiol 13,14-epoxide {(+/-)-anti-DB[a,l]PDE} was reacted with deoxyguanosine (dG) in dimethylformamide at 100 degrees C for 30 min, and two sets of adducts were isolated: a mixture of (+/-)-anti-cis- & -trans-N(2)dG (43%) and a mixture of (+/-)-anti-cis- & -trans-N7Gua (45%). Both are mixtures of four stereoisomers that cannot be separated by HPLC. Similarly, (+/-)-syn-DB[a,l]PDE was reacted with dG under the same conditions, and (+/-)-syn-cis- & -trans-N(2)dG (38%) and (+/-)-syn-cis- & -trans-N7Gua (59%) were obtained. The structures of the adducts were determined by a combination of NMR and fast atom bombardment mass spectrometry. By reacting (-)-anti-DB[a,l]PDE or (+)-syn-DB[a,l]PDE with dG under the same conditions, however, optically pure N(2)dG and N7Gua isomers were obtained: (-)-anti-cis-N(2)dG (12%), (-)-anti-trans-N(2)dG (17%), (-)-anti-trans-N7Gua (43%), (+)-syn-cis-N(2)dG (7%), (+)-syn-trans-N(2)dG (3%), (+)-syn-cis-N7Gua (36%), and (+)-syn-trans-N7Gua (22%). The structures of the optically pure adducts were assigned by NMR. syn- and anti-DB[a,l]PDE-N(2)dG adducts can be distinguished by fluorescence line-narrowing spectroscopy (FLNS). Moreover, distinction between cis- and trans-stereochemistry of the adducts is also straightforward by FLNS, because the FLN spectra for the four DB[a,l]PDE-N(2)dG adducts, anti-cis, anti-trans, syn-cis, and syn-trans, are spectroscopically unique.

Because the radical cations of polycyclic aromatic hydrocarbons (PAH) are involved in tumor initiation, determination of the structures of biologically formed PAH-DNA adducts is important and relies on comparison of their properties with those of synthesized adducts. One of the possible sites of adduct formation is the N-3 position of Ade, but this depurinating adduct is not obtained by one-electron oxidation of dibenzo[a,l]pyrene (DB[a,l]P) in the presence of deoxyadenosine. Therefore, we turned to electrochemical oxidation of DB[a,l]P in the presence of Ade in dimethylformamide and produced the following adducts: DB[a,l]P-10-N1Ade (47%), DB[a, l]P-10-N3Ade (5%), DB[a,l]P-10-N7Ade (2%), and DB[a,l]P-10-N(6)Ade (6%). In Me(2)SO, this reaction afforded the same four adducts, but in slightly different yields: DB[a,l]P-10-N1Ade (44%), DB[a, l]P-10-N3Ade (9%), DB[a,l]P-10-N7Ade (1%), and DB[a,l]P-10-N(6)Ade (3%). These adducts were purified by reverse-phase HPLC, and the subtle differences between the isomers were revealed by NMR, tandem mass spectrometry, and fluorescence line-narrowing spectroscopy. The relative yields of the N1Ade, N3Ade, and N7Ade adducts reflect the nucleophilicity and steric accessibility of these three nitrogen atoms in Ade.

A thymine-tyrosine adduct, (3-[(1,3-dihydro-2,4-dioxopyrimidin-5-yl)methyl]-L-tyrosine), was synthesized using a simple, single-step condensation between 5-(hydroxymethyl)uracil and L-tyrosine. This approach provides access to useful quantities (mg-g) of analytically pure reference material, and with minor modification, to stable isotope-labeled analogues (isotopomers). With reference material and a suitable internal standard available, isotope-dilution liquid chromatography-electrospray ionization-tandem mass spectrometry (LC/MS/MS) was used to assay the adduct in a model system purged of oxygen, i.e., a gamma-irradiated N2O-saturated aqueous solution of thymine and tyrosine. The convenient synthetic route to standards and the method for quantification reported here will prove useful in assessing the significance of the adduct in biological systems. These studies also highlight the potential for artefactual adduct formation if the appropriate substrates are present under acidic conditions.

This work describes the preparation of the cationic trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) ((AFB)G) adducts at the positions corresponding to G(746) or G(747), within the oligodeoxyribonucleotide d(GGAGGCCT) containing the codon 249 sequence (underlined) of the p53 gene, using DNA triplexes to target adduction at the desired site. This approach enabled the successful preparation and purification of sufficient quantities of d(GGAG(AFB)GCCT) for NMR structural studies, using only standard phosphoramidites. The presence of multiple guanines in this oligodeoxynucleotide precluded the direct reaction of d(GGAGGCCT). d(AGGCCTCC) with aflatoxin epoxide as a method for producing large quantities of site-specific adducts for physical studies. Of the multiple potential alkylation sites at guanine N7 in d(GGAGGCCT). d(AGGCCTCC), it was found that sites G(2) and G(5) exhibited approximately equal reactivity with aflatoxin B(1)-exo-8,9-epoxide; the reactivity at site G(4) was reduced by approximately a factor of 2 as compared to that at G(2) or G(5). To successfully prepare the site-specific adducts, the p53 oligodeoxyribonucleotide was annealed with either the blocking strand d(CTCCATTTTCCT) or d(CCTCCATTTTCCTC) to form the corresponding partial triplexes which targeted AFB(1) adduction either to G(4) or to G(5). Piperidine cleavage, followed by heating, confirmed that in each instance, the product corresponded to the lone guanine not protected from adduction by the partial DNA triplex. The adducted oligodeoxyribonucleotides were examined with regard to purity by capillary electrophoresis. The primary advantage of this modified triple helix methodology is that it requires only standard phosphoramidites; thus, it is applicable to large-scale preparations that are necessary for NMR structural studies or other physical measurements.

19F NMR spectroscopy was used to probe the conformation of a DNA adduct derived from the carcinogen 7-fluoro-N-acetyl-2-aminofluorene (FAAF) in three structural contexts: as a monomer and incorporated into single- and double-stranded DNA. The 19F NMR spectrum of dG-C8-FAAF [N-(deoxyguanosin-8-yl)-N-acetyl-7-fluoro-2-aminofluorene] in methanol at -30 degrees C exhibited four interconvertible signals in a 11:52:26:11 ratio. Dynamic NMR analysis indicated that the four torsional isomers arise from restricted rotation about the amide (gamma) (14.4 kcal/mol) and the guanyl-nitrogen (alpha) bonds. The conformational heterogeneity persisted in a single strand FAAF-12-mer, d(CTTCTTG[FAAF]ACCTC), whose 19F NMR spectrum at 22 degrees C and pH 7.0 gave only two signals in a 40:60 ratio, instead of four. The two 19F signals followed a two-site exchange with the rotation barrier of 14.7 kcal/mol about the amide (gamma') bond. A similar conformational theme was observed in the FAAF-12-mer duplex, d(CTTCTTG[FAAF]ACCTC).d(GAGGTCAAGAAG), which revealed two 19F resonances in a 41:59 ratio at 22 degrees C and pH 7.0. According to solvent-induced isotope and magnetic anisotropy effects, the two duplex conformers adopt exclusively a base displacement structure, being different only in their relative acetyl group orientations, cis (gamma' approximately 180 degrees) or trans (gamma' approximately 0 degrees ). Dynamic NMR data indicated that the two conformers do not exchange over a wide range of temperatures. This contrasts with the nonacetylated counterpart, which exhibits an equilibrium between the "B-type" and "stacked" conformers [Zhou, L., et al. (1997) J. Am. Chem. Soc. 119, 5384-5389]. The exclusive stacked nature of the AAF adducts may provide insight into why AAF adducts are more mutagenic and prone to repair than the nonacetylated AF adducts.

Arylhydrazides, arylhydrazines, and N-alkyl-N-arylnitrosamines are metabolized to arenediazonium ions which yield C8-arylpurine adducts in calf thymus and cellular DNA. The mechanism of adduct formation has not been fully elucidated. C8-Arylguanine adducts likely form from direct aryl radical (Ar*) addition to the C8 position of guanine. However, the amounts of C8-aryladenine adducts measured here are inconsistent with direct radical attack at the C8 position of adenine. An intermediate product, an aryltriazene, is likely formed which then decomposes to the C8-aryladenine adduct. We have demonstrated that N1-aryl-N3-purinyltriazene adducts are formed from a variety of para-substituted arenediazonium ions with adenine. Decomposition of the N1-aryl-N3-purinyltriazene, at high pH and elevated temperatures, has been shown to give C8-aryladenine derivatives, and a free radical mechanism for this process has been proposed. Here we show that this process can occur under physiological conditions and that the C8-aryladenine adduct can be quantitated by HPLC. ESR studies, in which DMPO was used as a spin trap, have been used to demonstrate the intermediacy of aryl radicals during the decomposition of the N1-aryl-N3-purinyltriazenes and to demonstrate that this process also occurs in calf thymus (ct) DNA treated with arenediazonium ions. These results suggest the involvement of an aryl radical in the formation of the observed DNA adducts. Finally, we have found that the treatment of ct DNA with arenediazonium ions produces a significant amount of depurination. Both the formation of C8-arylguanine and C8-aryladenine adducts and the generation of apurinic sites may contribute to the genotoxicity of arylhydrazides, arylhydrazines, N-alkyl-N-arylnitrosamines, and arenediazonium ions.

Polycyclic aromatic hydrocarbons (PAHs) are environmental pollutants which may cause cancer and require metabolic activation to exert their carcinogenic effects. One pathway of activation involves the dihydrodiol dehydrogenase-catalyzed oxidation of non-K region trans-dihydrodiols to yield catechols, which autoxidize to form reactive o-quinones. As a step toward identifying the spectrum of PAH o-quinone-DNA adducts that may form in biological systems, depurinating PAH o-quinone-guanine adducts were synthesized. Naphthalene-1,2-dione, phenanthrene-1,2-dione, and benzo[a]pyrene-7, 8-dione were reacted with 5 equiv of 2'-deoxyguanosine (dGuo) under acidic conditions (1:1 acetic acid/water). The products were purified by reversed-phase HPLC, characterized by a combination of UV spectroscopy, electrospray ionization/tandem mass spectrometry, and high-field proton nuclear magnetic resonance spectroscopy, and identified as 7-(naphthalene-1,2-dion-4-yl)guanine (MH+, m/z 308), 7-(phenanthrene-1,2-dion-4-yl)guanine (MH+, m/z 358), and 7-(benzo[a]pyrene-7,8-dion-10-yl)guanine (MH+, m/z 432), respectively. Reaction at N7 of dGuo leads to cleavage of the glycosidic bond, producing depurinating adducts. Reaction of phenanthrene-1,2-dione with calf thymus DNA led to the formation of the corresponding depurinating adduct. The loss of modified bases in DNA generates apurinic sites which, if unrepaired, can lead to mutations and thus cellular transformation. These synthesized PAH o-quinone-N7-guanine adducts can be used as standards to identify such adducts in vitro and in vivo.

Liquid chromatography (LC) in combination with tandem mass spectrometry (MS/MS) and stable isotope methodology was employed for the analysis of the N7-guanine (Gua) adducts derived from 1,2:3, 4-diepoxybutane (BDO2) a reactive metabolite of 1,3-butadiene (BD). Two diastereomeric forms of N7-(2,3,4-trihydroxybutyl)guanine (THBG) were identified in the livers of both mice and rats. One of the diastereomers [(+/-)-THBG] was formed by reaction of DNA with (+/-)-BDO2, and the other diastereomer (meso-THBG) was formed by reaction of DNA with meso-BDO2. There was significantly more (+/-)-THBG and meso-THBG in the liver DNA of the mice when compared with those of the rats during the 10 days of exposure to BD and the 6 days of postexposure that were monitored. There was a 2-fold excess of (+/-)-THBG over meso-THBG in the rat liver at all the time points. In the mouse liver after 10 days of exposure to BD, the (+/-)-THBG (3.9 adducts/10(6) normal bases) was also present in an almost 2-fold excess over meso-THBG (2.2 adducts/10(6) normal bases). However, 6-days after exposure to BD, (+/-)-THBG (1.2 adducts/10(6) normal bases) and meso-THBG (1.0 adduct/10(6) normal bases) were present in almost equal amounts in the mouse liver. Furthermore, there was an almost 5-fold excess of the two THBG diastereomers in the mouse liver DNA 6 days after exposure to BD when compared with rat liver DNA. The half-lives of (+/-)-THBG and meso-THBG appeared to be slightly longer in mouse liver (4.1 and 5.5 days, respectively) than in rat liver (3.6 and 4.0 days, respectively). The apparent persistence of these adducts in the mouse may contribute to the increased susceptibility of this species to BD-induced carcinogenesis. It is possible that (+/-)-THBG and meso-THBG could have also been derived from the reaction of DNA with the hydrolysis product of BDO2, 1,2-dihydroxy-3,4-epoxybutane (DHEB). Surprisingly, a vast majority of the studies in which the mutagenic and carcinogenic potential of BDO2 have been examined have only employed the commercially available (+/-)-BDO2. In light of the present findings, additional studies will be required to determine the potency of meso-BDO2 and the DHEB that is the precursor to meso-THBG as mutagens and carcinogens.

Acetaldehyde is produced by metabolic oxidation of ethanol after drinking alcoholic beverages. This agent reacts with nucleosides and nucleotides, resulting in the formation of N2-ethyl-guanine residues. N2-ethyl-2'-deoxyguanosine (N2-ethyl-dG) adduct has been detected in the lymphocyte DNA of alcoholic patients [Fang, J. L., and Vaca, C. E. (1997) Carcinogenesis 18, 627-632]. Thus, the nucleotide pool is also expected to be modified by acetaldehyde. N2-Ethyl-2'-deoxyguanosine triphosphate (N2-ethyl-dGTP) was chemically synthesized. The utilization of N2-ethyl-dGTP during DNA synthesis was determined by steady-state kinetic studies. N2-Ethyl-dGTP was efficiently incorporated opposite template dC in reactions catalyzed by mammalian DNA polymerase alpha and delta. When pol alpha was used, the insertion frequency of N2-ethyl-dGTP was 400 times less than that of dGTP, but 320 times higher than that of 7,8-dihydro-8-oxo-2'-deoxyguanosine triphosphate (8-oxo-dGTP), an oxidative damaged nucleotide. Using pol delta, the insertion frequency of N2-ethyl-dGTP was only 37 times less than that of dGTP. The chain extension from dC:N2-ethyl-dG pair occurred much more rapidly: the extension frequencies for pol alpha and pol delta were only 3.8 times and 6.3 times, respectively, lower than that of dC:dG pair. We also found that N2-ethyl-dG can be detected in urine samples obtained from healthy volunteers who had abstained from drinking alcohol for 1 week before urine collection. This indicates that humans are exposed constantly to acetaldehyde even without drinking alcoholic beverages. Incorporation of N2-ethyl-dG adducts into DNA may cause mutations and may be related to the development of alcohol- and acetaldehyde-induced human cancers.

Benzene is a widely known carcinogen and a cause of bone-marrow toxicity and leukaemia in humans. para-Benzoquinone is a stable metabolite of benzene. Its reaction with deoxycytidine, deoxyadenosine and deoxyguanosine produces the major stable exocyclic compounds (3-hydroxy)-1,N4-benzetheno-2'-deoxycytidine, (9-hydroxy)-1,N6-benzetheno-2'-deoxyadenosine and (7-hydroxy)-1,N2-benzetheno-2'-deoxyguanosine, respectively, on a large scale and at high yield. The desired products were identified by fast atom bombardment-mass spectrometry, proton nuclear magnetic resonance and UV spectroscopy. These adducts were converted to the fully protected phosphoramidites and incorporated site-specifically into a series of oligonucleotides. 1,N6-Ethano-2'-deoxyadenosine is one of the exocyclic adducts formed during DNA reaction with the antitumour agent, 1,3-bis(2-chloroethyl)nitrosourea. This compound was synthesized on a large scale with a high yield (62%) and then was converted to the phosphoramidite and incorporated site-specifically into oligonucleotides. The coupling efficiency of the incorporation of all these adducts was high (> or = 93%). After de-protection and purification of these oligomers, enzymatic hydrolysis and analysis by high-performance liquid chromatography confirmed the presence of the adduct in the oligomers. These oligomers are being used to investigate the biochemical and physical properties of these adducts.

32P-Postlabeling is a powerful technique for the detection of DNA adducts; however, quantitation of DNA adducts by this method can result in errors due to differences in hydrolysis and labeling efficiencies between adducted and normal nucleotides. We have synthesized a DNA sample modified with 4-aminobiphenyl to serve as a quantitation standard for 32P-postlabeling and other DNA adduct detection methodologies. [2,2'-3H]-N-Hydroxy-4-aminobiphenyl was reacted with calf thymus DNA at pH 5 to give 62 +/- 0.8 adducts/10(8) nucleotides (mean +/- SD) on the basis of 3H content. HPLC analyses following enzymatic hydrolysis to nucleosides indicated one major adduct, N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-4-ABP). The adduct identity was confirmed by HPLC/electrospray ionization mass spectrometry, which indicated a modification level of 19 +/- 1.7 dG-C8-4-ABP/10(8) nucleotides. 32P-Postlabeling analysis gave a value of 0.84 dG-C8-4-ABP/10(8) nucleotides, while a dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA) indicated levels of 82 +/- 26 and 63 +/- 20 dG-C8-4-ABP/10(8) nucleotides after enzymatic hydrolysis to nucleotides and nucleosides, respectively. The utility of the DNA adduct standard was determined by assessing the level of dG-C8-4-ABP in liver DNA from mice treated with [2,2'-3H]-4-aminobiphenyl. 32P-Postlabeling analyses, based upon measuring the extent of the 32P incorporation, underestimated the levels of dG-C8-4-ABP, while DELFIA, using a G-C8-4-ABP quantitation standard, overestimated the adduct levels. The adduct levels determined by HPLC/electrospray ionization mass spectrometry best reflected those obtained from 3H incorporation. When the 32P-postlabeling analyses and the DELFIA were conducted using the DNA modified in vitro with dG-C8-4-ABP as a quantitation standard, accurate estimations of the extent of in vivo formation of dG-C8-4-ABP were obtained.

Site-specific carcinogen-modified oligonucleotides are often used in site-directed mutagenesis and other biological and biochemical studies of structure-function relationships. Postsynthetic analysis and confirmation of the sites of carcinogen binding in such oligonucleotides is an important step in the characterization of these site-specific carcinogen-DNA adducts. It is shown here that negative ion mode electrospray tandem mass spectrometry methods and collision-induced dissociation offer a rapid and convenient approach for the sequencing of products derived from the reaction of the carcinogenic and mutagenic metabolite of benzo[a]pyrene, the diol epoxide r7,t8-dihydroxy-t9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (anti-BPDE), with the 11-mer oligonucleotide d(CATGCGGCCTAC). The site of reaction of anti-BPDE with either one of the three dG residues in this oligonucleotide can be accurately established by comparing the mass/charge ratios of the observed collision-induced dissociation fragments with calculated values.

Polycyclic aromatic hydrocarbons (PAH) undergo two main pathways of metabolic activation related to the initiation of tumors: one-electron oxidation to give radical cations and monooxygenation to yield bay-region diol epoxides. Synthesis of standard adducts is essential for identifying biologically formed adducts. Until recently, radical cation adducts were synthesized by oxidation of the PAH in an electrochemical apparatus, not readily available in many organic chemistry laboratories. We have developed a convenient and efficient method for synthesizing PAH-nucleoside adducts by using I2 as the oxidant. Adducts of benzo[a]pyrene (BP), dibenzo[a, l]pyrene (DB[a,l]P), and 7,12-dimethylbenz[a]anthracene were synthesized with deoxyguanosine (dG), deoxyadenosine, guanine (Gua), or adenine in either Me2SO or dimethylformamide (DMF) with or without AgClO4. When, for example, the potent carcinogen BP was dissolved in DMF in the presence of 3 equiv of I2, 5 equiv of dG, and 1 equiv of AgClO4, 45% of the BP was converted to BP-6-N7Gua. When BP was placed under the same reaction conditions in the absence of AgClO4, the extent of formation of BP-6-N7Gua decreased to 30%. When the potent carcinogen DB[a,l]P was dissolved in DMF in the presence of 3 equiv of I2, 5 equiv of dG, and 1 equiv of AgClO4, 43% of the DB[a,l]P was converted to DB[a,l]P-10-N7Gua. In the more polar solvent Me2SO under the same reaction conditions, however, the yield of DB[a,l]P-10-N7Gua was only 20%. Synthesis of adducts with the oxidant I2 is more convenient and, in some cases, more efficient than synthesis by electrochemical oxidation. This method simplifies the synthesis of PAH-nucleoside and nucleobase adducts that are essential for studying biologically formed PAH-DNA adducts.

Chlorothioketene has been suggested as a reactive intermediate formed by the cysteine conjugate beta-lyase-mediated cleavage of S-(1,2-dichlorovinyl)-L-cysteine, a minor metabolite of trichloroethene. Halothioketenes are highly reactive, and their intermediate formation may be confirmed by reactions such as cycloadditions and thioacylations of nucleophiles. A precursor of chlorothioketene, S-(1,2-dichlorovinyl)thioacetate, is readly accessible by the reaction of dichloroethyne with thioacetic acid. In presence of base, S-(1,2-dichlorovinyl)thioacetate is cleaved to chlorothioketene. Chlorothioketene is not stable at room temperature and was characterized after transformation to stable products by reaction with compounds such as cyclopentadiene, N,N-diethylamine, and ethanol. In organic solvents, the cleavage of S-(1, 2-dichlorovinyl)thioacetate in the presence of cytosine results in N4-acetylcytosine, N4-(chlorothioacetyl)cytosine, and small amounts of 3-(N4-thioacetyl)cytosine. No reaction products were seen with guanosine, adenosine, and thymidine under identical conditions. When cytosine was reacted with S-(1,2-dichlorovinyl)thioacetate in aqueous solutions, only N4-acetylcytosine was formed. N4-(Chlorothioacetyl)cytosine and 3-(N4-thioacetyl)cytosine were not detected even when using a very sensitive method, derivatization with pentafluorobenzyl bromide and electron capture mass spectrometry with a detection limit of 50 fmol/microliter of injection volume. Aqueous solutions of DNA cleave S-(1, 2-dichlorovinyl)thioacetate to give N4-acetyldeoxycytidine in DNA, but chlorothioketene adducts of deoxynucleosides were also not detected in these experiments. These results confirm the electrophilic reactivity of chlorothioketene toward nucleophilic groups of DNA constituents in inert solvents but also demonstrate that the formation of DNA adducts under physiological conditions likely is not efficient. Therefore, DNA adducts may not represent useful biomarkers of exposure and biochemical effects for trichloroethene.

Malondialdehyde (MDA) is a major lipid peroxidation product that is mutagenic and tumorigenic. The MDA-modified DNA adduct, 3-(2-deoxy-beta-D-erythro-pentofuranosyl)pyrimido[1, 2-alpha]purin-10(3H)-one (M1G), has been detected in human tissues and may be a marker of human cancer risk. In this paper, we describe an improved 32P-postlabeling/HPLC method for sensitive detection and quantitation of this MDA-modified 2'-deoxyribonucleotide adduct. Specific improvements include (i) unequivocal structural identification of the postlabeling products, both the 3', 5'-bisphosphate of M1G (MDA-3',5'-dGDP) and the 5'-monophosphate of M1G (MDA-5'-dGMP); (ii) efficient separation of the 32P-postlabeling products by HPLC; and (iii) the incorporation of a synthetically prepared MDA-modified DNA (or the 3'-monophosphate of M1G) with a known modification level as an internal standard. This improved quantitative methodology provides high intra- and inter-assay reproducibility and has been applied to the analysis of this adduct in rodent and human samples.

The authors have developed a method for rapid detection of polymerase chain reaction (PCR) amplicons based on surface immobilized PNA-DNA hybrid probes ('molecular beacons') that undergo a fluorescent-linked conformational change in the presence of a complementary DNA target. Amplicons can be detected by simply adding a PCR reaction to a microtitre-well containing the previously immobilized probe, and reading the generated fluorescence. No further transfers or washing steps are involved. The authors demonstrate the specificity of the method for the detection of ribosomal DNA from Entamoeba histolytica.

In reactions between styrene oxide and the ring nitrogen at the 1-position of deoxyadenosine, the epoxide is opened at both the alpha- (benzylic) and beta-carbons. The 1-substituted nucleosides formed are unstable and subsequently undergo either Dimroth rearrangement to give N6-substituted deoxyadenosines or deamination to give 1-substituted deoxyinosines. alphaN6-Substituted compounds are also formed from direct reaction at the exocyclic nitrogen. Kinetic experiments revealed that relative rates of deamination of 1-substituted deoxyadenosine-styrene oxides and 1-substituted adenosine-styrene oxides were similar. However, the rate of Dimroth rearrangement in beta1-substituted adenosine-styrene oxides was approximately 2.3-fold greater than that of beta1-substituted deoxyadenosine-styrene oxides and approximately 1.5-fold greater in alpha1-substituted adenosine-styrene oxides relative to alpha1-substituted deoxyadenosine-styrene oxides. Analysis of the products formed from reactions of styrene oxide with [3H]deoxyadenosine and [3H]deoxyadenosine incorporated into native and denatured DNA showed that the double-helical DNA structure reduced the levels of adducts formed 5-fold relative to denatured DNA but did not present a complete barrier to formation of either N6-substituted deoxyadenosine- or 1-substituted deoxyinosine-styrene oxide adducts in native DNA. Additionally, in denatured and native DNA the product distributions were altered in favor of formation of beta1-substituted deoxyinosine-styrene oxide adducts with respect to reactions of the nucleoside. The ratio of retained to inverted configuration of alphaN6-substituted products was higher in DNA than in nucleoside reactions. These experiments indicate that in addition to the N6-position, the ring nitrogen at the 1-position of deoxyadenosine is available, to some extent, for reaction in native DNA. In styrene oxide-DNA reactions, formation of 1-substituted adenines can lead to deaminated products where both Watson-Crick hydrogen-bonding sites are disrupted.

We have previously developed an in vitro system that allows quantitative evaluation of the fidelity of transcription during synthesis on a natural template in the presence of all four nucleotides. Here, we have employed this system using a TAA ochre codon reversion assay to examine the fidelity of transcription by T7 RNA polymerase past an adenine residue adducted at the N6-position with (-)-anti-trans- or (+)-anti-trans-benzo[a]pyrene diol epoxide (BPDE). T7 RNAP was capable of transcribing past either BPDE isomer to generate full-length run-off transcripts. The extent of bypass was found to be 32% for the (-)-anti-trans-isomer and 18% for the (+)-anti-trans-isomer. Transcription past both adducts was highly mutagenic. The reversion frequency of bypass synthesis of the (-)-anti-trans-isomer was elevated 11,000-fold and that of the (+)-anti-trans-isomer 6000-fold, relative to the reversion frequency of transcription on unadducted template. Adenine was misinserted preferentially, followed by guanine, opposite the adenine adducted with either BPDE isomer. Although base substitution errors were by far the most frequent mutation on the adducted template, three- and six-base deletions were also observed. These results suggest that transcriptional errors, particularly with regard to damage bypass, may contribute to the mutational burden of the cell.

We have measured the formation and persistence of benzo[a]pyrene (BaP)-DNA adducts in the liver of two closely related species of fish, the brown bullhead (Ameriurus nebulosus) and the channel catfish (Ictalurus punctatus) using the 32P-postlabeling method. Liver microsomal ethoxyresorufin-O-deethylase (EROD) activity, arylhydrocarbon hydroxylase (AHH) activity, and in vitro microsome-mediated DNA binding were all significantly higher in the channel catfish. In an in vivo time-course experiment, fish were either induced with beta NF followed by a single BaP i.p. injection (20 mg/kg) or treated with corn oil. BaP-DNA adducts and EROD activity in liver were analyzed 1, 3, 7, 14, and 45 days after the BaP dosage. As in the in vitro experiments, EROD activities in channel catfish were significantly higher at most time points than in bullhead liver (p < 0.05). However, in contrast to the in vitro data, the BaP-DNA adduct profile revealed significantly higher levels of adducts in the bullhead than the channel catfish throughout the time course (p < 0.05). Prior induction with beta NF did not significantly affect the level or type of adduct binding to DNA in either species. Further characterization of the major adduct by HPLC confirmed it to be the anti-BPDE-dGuo adduct. Analysis of tissue distribution of [14C]BaP in the two species suggested similar absorption and initial distribution, but slower elimination from the liver of bullhead than the catfish. The BaP-adduct profiles were consistent with the relative species susceptibility to polycyclic aromatic hydrocarbon-induced liver neoplasia. EROD activities, however, were negatively associated with adduct levels following in vivo exposure.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Oxidative damage to DNA is an established source of genomic instability. In this paper, we describe the synthesis and characterization of several pyrimidine deoxynucleoside oxidation damage products, enriched with stable isotopes. These products include the 2'-deoxynucleoside derivatives of 5-(hydroxymethyl)uracil, 5-formyluracil, 5-hydroxyuracil, 5-(hydroxymethyl)cytosine, 5-formylcytosine, and 5-hydroxycytosine. The common precursor is 2'-deoxy-2"-deutero[1,3-15N]uridine. Additional stable isotopes are added during functional group conversions. Characterization of these derivatives includes mass spectrometry and 1H and 15N NMR spectroscopy. Proton and nitrogen NMR studies reported here allow an examination of the influence of the modification on sugar conformation and tautomeric equilibrium, properties likely to be important in understanding the biological consequences of these DNA damage products.

Like other polycyclic aromatic hydrocarbons, certain metabolites of benz[a]anthracene have been implicated as potent carcinogens. These effects are thought to be caused by the covalent binding of these species to nucleophilic groups on the bases of DNA. To address the molecular mechanisms by which these molecules induce mutations, this study employed oligonucleotides containing four site-specific N6 adenine-benz[a]anthracene diol epoxide adducts. Using a prokaryotic in vivo replication system, we have shown that both non-bay region anti-trans-benz[a]anthracene adducts are essentially nonmutagenic. In contrast, the bay region anti-trans-benz[a]anthracene lesions do induce point mutations at the adduct site. The mutagenic frequency of these bay region lesions is dependent on the stereochemistry about the adduct-forming bond, as well as the strain of Escherichia coli in which they are replicated. The ability of the bacterial replication machinery to bypass the lesions does not correlate with the differences observed in their mutagenesis. While both non-bay region adducts are readily bypassed in vivo, the bay region adducts are both blocking to approximately the same degree. In vitro studies of the interactions of E. coli DNA polymerase III with these adducts have also been undertaken to further dissect the relationship between adduct structure and biological activity.

Aryl radicals and arenediazonium ions are suspected to react with cellular DNA, resulting in C8-arylguanine adducts. 8-Phenyl-2'-deoxyguanosine (8-PhdG) was synthesized as a model adduct by reacting dG with benzenediazonium chloride and incorporated into oligodeoxynucleotides using phosphoramidite techniques. A site-specifically modified oligodeoxynucleotide containing a single 8-PhdG was then used as a template for primer extension reactions catalyzed by the intact (exo+) or 3'-->5' exonuclease-free (exo-) Klenow fragment of Escherichia coli DNA polymerase I and mammalian DNA polymerase alpha (pol alpha). Although primer extensions catalyzed by the Klenow fragments were retarded at the position of 8-PhdG, most of the primer extension passed the lesion to form the fully extended products. In contrast, primer extensions catalyzed by pol alpha were strongly blocked opposite the lesion. The fully extended products formed during DNA synthesis were analyzed to quantify the miscoding specificities of 8-PhdG. The exo- Klenow fragment incorporated primarily dCMP, the correct base, opposite 8-PhdG, along with small amounts of incorporation of dAMP. Two-base deletions were also observed. In contrast, the exo+ Klenow fragment incorporated dCMP opposite the lesion. When pol alpha was used, 8-PhdG promoted small amounts of misincorporation of dAMP and dGMP as well as one- and two-base deletions. The duplex containing 8-PhdG.dG was thermally and thermodynamically more stable than dG.dG. The duplex containing 8-PhdG.dA was thermodynamically more stable than dG.dA. We conclude that 8-PhdG is a weak miscoding lesion, capable of generating G-->T and G-->C transversions and deletions in cells.

The thiazole orange dye 1,1'-(4,4,8,8-tetramethyl-4,8-diazaundecamethylene)-bis[4-[3-methy l-2, 3-dihydro(benzo-1,3-thiazole)-2-methylidene]]quinolinium tetraiodide (TOTO) binds to double-stranded DNA (dsDNA) in a sequence selective bisintercalation. Each chromophore is sandwiched between two base pairs in a (5'-CpT-3'):(5'-ApG-3') site, and the linker spans over two base pairs in the minor groove. The binding of analogs of TOTO in which the linker has been modified is examined. The aim of the study is to utilize the sequence selectivity of the TOTO chromophores to enhance and/or alter the overall selectivity of the binding. One- and two-dimensional 1H-NMR investigations of complexes between TOTO analogs and various dsDNA oligonucleotides are reported. The following analogs were synthesized and used: 1,1'-(4,4,8,8-tetramethyl-4,8-diazadodecamethylene) -bis[4-[3-methyl-2,3-dihydro- (benzo-1,3-thiazole)-2-methylidene]]quinolinium tetraiodide (TOTO10), 1,1'-(5,5,9,9-tetramethyl-5,9-diazatridecamethylene)-bis[4-[3-meth yl-2, 3-dihydro(benzo-1,3-thiazole)-2-methylidene]]quinolinium tetraiodide (TOTO11), and 1,1'-(6,6,10,10-tetramethyl-6,10-diazapentadecamethylene)-bis[4-[3 -methyl-2, 3-dihydro(benzo-1,3-thiazole)-2-methylidene]]quinolinium tetraiodide (TOTO13). The results show that with a longer linker the dyes can bisintercalate into two (5'-CpT-3'):(5'-ApG-3') sites separated by one or two base pairs. Bisintercalation in two such "isolated" binding sites yields non-nearest-neighbor bisintercalation in which the linker spans over more than two base pairs. The investigations also showed that an exact length of the linker is not crucial for the site selectivity since TOTO, TOTO10, and TOTO11 are almost equally suitable in binding selectively to the (5'CTAG-3')2 sequence. Fluorescence measurements show that TOTO10, TOTO11, and TOTO13 have higher fluorescence quantum yields than TOTO when bound to d(CGCTAGCG)2. This indicates that the length of the linker in TOTO may not be the optimum one in terms of using the dye as a fluorescence marker.

Double- and tetrawalled molecular umbrella-spermine conjugates (I and II) have been synthesized, and their binding to calf thymus DNA (CT-DNA), poly[d(AT)], and poly[d(GC)] compared with that of a single-walled analogue (III). At moderate salt concentrations (8 mM NaCl), I and II show significantly greater affinity toward each DNA, relative to III; at high salt concentrations (150 mM NaCl), strong binding of I and II (but not III) was maintained toward poly[d(GC)]. Examination of the influence of I-III on the melting behavior of poly[d(AT)] has provided strong evidence that the binding of I and II reflects highly cooperative interactions among DNA-bound conjugates and that the DNA duplex serves as a nucleation site for umbrella aggregation. The implications of these findings for the rational design of novel drug conjugates that operate at the nuclear level, and also novel transfection agents, are briefly discussed.

Previous work has shown that the major adduct from the (+)-anti diol epoxide of benzo[a]pyrene (B[a]P), which forms at N2-deoxyguanosine [(+)-trans-anti-B[a]P-N2-dG], is capable of inducing either predominantely G --> T mutations ( approximately 95%) in a 5'-TGC-3 sequence context or predominantly G --> A mutations ( approximately 80%) in a 5'-CGT-3' sequence context. This is likely to be attributable to the major adduct being in a different mutagenic conformation in each case. In the next phase of this work, the questions to be addressed are what conformation is associated with what mutation and why? To help define what aspect of adduct structure is important to mutagenesis, the work herein reports on the mutations induced in a single sequence context by four stereoisomers of B[a]P-N2-dG: (+)-trans-, (+)-cis-, (-)-trans-, and (-)-cis-. The (+)-trans- and (-)-cis-adducts show a remarkably similar mutational pattern with G --> A mutations predominating ( approximately 80%). The (-)-trans- and (+)-cis-adducts also show a similar mutational pattern with a more even mixture of G --> T, G --> A, and G --> C mutations. Each of these adducts has an adduct bond and three hydroxyl groups at four consecutive saturated carbons in the B[a]P moiety of the adduct; the stereochemistry at these four positions differs in each of the adducts. The (+)-trans- and (-)-cis-adducts are a pair sharing the S configuration for the adduct bond, although they are a mirror image vis-a-vis the hydroxyl groups. The (-)-trans- and (+)-cis-adducts share the opposite adduct bond stereochemistry (R) but differ in the stereochemistry of their hydroxyl groups. Thus, there is a correlation suggesting that anti-B[a]P-N2-dG adduct mutagenesis is more dependent on the stereochemistry of the adduct bond than on the stereochemistry of the hydroxyl groups.

The carcinogen ethylene dibromide (EDB) is activated by enzymatic conjugation with GSH to form S-(2-bromoethyl)GSH, which reacts with DNA via an episulfonium ion. The major DNA adduct derived from EDB was previously characterized as S-[2-(N7-guanyl)ethyl]GSH, and S-[2-(N2-guanyl)ethyl]GSH and S-[2-(O6-guanyl)ethyl]GSH are minor adducts [Cmarik, J. L., Humphreys, W. G., Bruner, K. L., Lloyd, R. S., Tibbetts, C., and Guengerich, F. P. (1992) J. Biol. Chem. 267, 6672-6679]. S-[2-(N7-Guanyl)ethyl]GSH has been incorporated at the G* site in d(5'-TGCTG*CAAG-3'), a site previously found to show GC to AT transitions following treatment of M13 phage with S-(2-chloroethyl)GSH, and the desired product was separated by HPLC. This was ligated to d(5'-GGTACCGAG-3') to yield d(5'-TGCTG*CAAGGGTACCGAG-3'). S-[2-(N2-Guanyl)ethyl]GSH was incorporated into the G* site of the oligonucleotide in d(5'-TGCTG*CAAGGGTACCGAG-3') by reacting S-(2-aminoethyl)GSH with an oligomer containing 2-fluoro-O6-[(trimethylsilyl)ethoxy]deoxyinosine at the target site. The 5'-(dimethoxytrityl)-N2-(phenoxyacetyl)-N-[(fluorenylmethyl)formyl ] derivative of S-[2-(O6-deoxyguanosyl)-ethyl]GSH dimethyl ester was synthesized by Mitsunobu alkylation of 5'-(dimethoxytrityl)-N2-(phenoxyacetyl)deoxyguanosine with N-[(fluorenylmethyl)formyl]-S-(2-hydroxyethyl)GSH dimethyl ester, modified to form the phosphoramidite derivative, and incorporated at the G* site of d(5'-TGCTG*CAAGGGTACCGAG-3'). The protective groups were removed with 0.10 N NaOH to give the modified oligonucleotide containing S-[2-(O6-guanyl)ethyl]GSH. Although the overall yields were low, the synthesis of a single set of target site oligonucleotides containing these overall yields were low, the synthesis of a single set of target site oligonucleotides containing these three known guanyl adducts allows for in vitro site-specific misincorporation studies.

Peroxisome proliferators are known to modulate the activity of xenobiotic-metabolising enzymes, including glutathione S-transferase (GST) and cytochrome P-450 (CYP). In this study the effect of peroxisome proliferators silvex and di(2-ethylhexyl)phthalate (DEHP) on the formation of (+)-anti-benzo(a)pyrene -7,8-dihydrodiol-9,10-epoxide (BPDE)-DNA adducts from a proximate mutagen and carcinogen (-)-transbenzo(a)pyrene-7,8-dihydrodiol (BPDD) has been investigated. Rat CYP1A1 metabolises BPDD to mutagenic BPDE, which may form DNA adducts or, alternatively, be detoxified by hydrolysis or glutathione conjugation. In this experiment the formation of BPDE-DNA adducts was significantly increased in hepatocytes isolated from all silvex treated rats and two out of four DEHP treated rats (14 day treatment). The activity of CYP1A1 was increased whereas GST was reduced by the peroxisome proliferator silvex. These changes were more significant than those induced by DEHP. We have hypothesised that the formation of BPDE-DNA adducts was primarily due to the increased BPDD activation to BPDE versus reduced detoxication of BPDE. Other hepatic changes induced by the peroxisome proliferators, e.g. peroxisome proliferation per se and increased mitotic activity of the liver could have an effect on the outcome of BPDD exposure.

O6-(Carboxymethyl)-2'-deoxyguanosine (O6-CMdG) is formed in DNA by nitrosated glycine derivatives and appears to be nonrepairable by O6-alkylguanine transferases. O6-CMdG has been synthesized by an unambiguous route involving the introduction of a methyl glycolate moiety at C6 of a 3',5'-bis-O-(methoxyacetyl)dGuo derivative by displacement of a quinuclidinium ion. Methanolysis of the methoxyacetyl groups and calcium hydroxide-mediated hydrolysis of the methyl ester afforded the calcium salt of O6-CMdG in good yield. A similar route was used to synthesize O6-(carboxymethyl)guanosine (O6-CMGuo), which was used to prepare protein conjugates for immunization. Rabbit antisera were prepared, and a quantitative competitive ELISA was developed which showed 50% inhibition at 2 pmol of O6-CMdG/ well. O6-CMGuo was 30 times less cross-reactive (50% inhibition at 60 pmol/well), and normal nucleosides and carboxymethylated purines did not cross-react to any significant extent. The antiserum was also used to prepare reusable immunoaffinity columns which retained O6-CMdG. The binding of O6-CMdG was so strong that conditions used to elute the adduct (1 M trifluoroacetic acid) resulted in partial hydrolysis (becoming quantitative on heating) of the glycosidic bond to give O6-CMguanine which was detected by HPLC with fluorescence detection. DNA treated with azaserine (5 mmol), N-(N'-acetyl-L-prolyl)-N-nitrosoglycine (5 mmol), and potassium diazoacetate (5 mmol) afforded O6-CMdG at levels of 7.3, 393.9, and 496 mumol of O6-CMdG/mol of dG. The antiserum also recognized O6-CMdG in intact DNA.

High performance liquid chromatography (HPLC)/electrospray mass spectrometry methods were developed for the analysis of 1,N2-etheno(epsilon)guanine (Gua) and 5,6,7,9-tetrahydro-7-hydroxy-9-oxoidmidazo[1,2-a]purine (HO-ethanoGua) [the cyclized form of N2-(2-oxoethyl)Gua] and its deoxyribose derivative in DNA. Evidence was provided for the formation of the latter adduct in DNA treated with 2-chlorooxirane, the reactive product formed from the carcinogen vinyl chloride. Measured levels of HO-ethanoGua and HO-ethanodeoxyguanosine were similar, although the assay for the deoxyribosyl derivative has some technical advantages. 3,N4-epsilon-Deoxycytidine was also estimated in 2-chlorooxirane-treated DNA using HPLC with fluorescence detection. Levels of all known adducts formed from vinyl chloride have now been estimated in DNA treated with 2-chlorooxirane and vary in the order N7-(2-oxoethyl)Gua >> 1,N6-epsilon-adenine > HO-ethanoGua > N2,3-epsilon-Gua > 3,N4-epsilon-cytosine > 1,N2-epsilon-Gua. Although in vivo adduct levels may not parallel these due to differential stability and rates of repair, analyses of the adducts in DNA treated with 2-chlorooxirane provide a basis for consideration of the biological effects of these adducts.

It is hypothesized that 7H-dibenzo[c,g]carbazole (DBC) is metabolically activated by one-electron oxidation in accordance with its propensity to be easily oxidized to its radical cation. Iodine oxidation of DBC produces a radical cation that subsequently binds to nucleophilic groups of dG or Ade. Oxidation of DBC in the presence of dG products three adducts: DBC-5-N7Gua, DBC-6-N7Gua, and DBC-6-C8Gua, whereas in the presence of Ade, four adducts are obtained: DBC-5-N7Ade, DBC-5-N3Ade, DBC-5-N1Ade, and DBC-6-N3Ade. Formation of these adducts demonstrates that the DBC radical cation reacts at C-5 or C-6 with the reactive nucleophiles N-7 and C-8 of dG and N-7, N-3, and N-1 of Ade. Formation DNA adducts by DBC was studied by using horesradish peroxidase or 3-methylcholanthrene-induced rat liver microsomes for activation. Identification of the biologically-formed depurinating adducts was achieved by comparison of their retention times on HPLC in two different solvent systems and by matrix-assisted laser desorption ionization (MALDI) mass spectrometry. Quantitation of the adducts formed by rat liver microsomes shows that 96% are depurinating adducts, DBC-5-N7Gua (11%), DBC-6-N7Gua (32%), and DBC-5-N7Ade (53%), and 4% are unidentified stable adducts. Activation of DBC by horseradish peroxidase affords 32% stable unidentified adducts and 68% depurinating adducts: 19% DBC-5-N7Gua, 13% DBC-6-N7Gua, 27% DBC-5-N7Ade, and 9% DBC-5-N3Ade. Thus, activation of DBC by cytochrome P450 predominantly forms depurinating adducts by one-electron oxidation.

p-Benzoquinone (p-BQ) is a stable metabolite of benzene and a number of other drugs and chemicals. 2'-Deoxyguanosine was allowed to react with p-BQ in aqueous solution (pH 4.5, 7.4, and 9.3). At pH 7.4 and 9.3 one major product was found in low yield; at pH 4.5 no product was detected. In nonaqueous conditions (DMF or DMSO, in the presence of K2CO3), an unstable intermediate with two p-BQ moieties was found which slowly converted to the product formed in aqueous solution. These products were isolated by silica gel, column chromatography, or reverse-phase HPLC and characterized by UV, 1H NMR, FAB-MS, and electrospray MS. The major stable product of the reaction of dG with p-BQ is an exocyclic compound. 3"-hydroxy-1,N2-benzetheno-2'-deoxyguanosine (p-BQ-dG). Incorporation of the adduct into oligonucleotides requires the protection of three hydroxyl groups (C7, 5', 3') and the amino group at N5. The exocyclic hydroxyl and the amino group were protected by acylation after protecting the 5'-and the 3'-hydroxyl groups of the sugar moiety by 4,4'-dimethoxytrityl and a cyanoethyl N,N-diisopropylphosphoramidite group, respectively. This is the first time the fully protected phosphoramidite of p-BQ-dG has been prepared and used in the synthesis of site specifically modified oligonucleotides. After deprotection with 1,3-diazabicyclo[5.4.0]undec-7-ene (DBU), in ethanol, oligomers purified by gel electrophoresis and HPLC. Enzymatic hydrolysis and analysis by HPLC confirmed the presence of p-BQ-dG in the oligomers. These oligomers are now under investigation for their biochemical properties.

Cyclopenta[cd]pyrene (CPP) is a ubiquitous environmental pollutant whose 3,4-epoxide (CPPE) is generally regarded as its ultimate carcinogenic metabolite. The present study was undertaken to determine the structures of major DNA adducts formed by CPPE in vitro. Incorporation of specific radiolabeled bases into calf thymus DNA prior to reaction with CPPE demonstrated that the major adducts were formed by guanine, while minor adducts were formed by adenine and cytosine. Unmodified DNA was reacted with [3H]CPPE and the deoxynucleoside adducts obtained were compared chromatographically with the products obtained by reaction of CPPE with 2'-deoxyguanosine (dGuo). Two dGuo adducts from the latter reaction were identified by 1H-NMR, fast atom bombardment mass spectrometry, and circular dichroism as diastereoisomers of cis-3-(deoxyguanosin-N2-yl)-4-hydroxy-3,4-dihydroCPP. Other products that may have included the isomeric trans-N2-dGuo adduct were formed in the reaction. The major adduct fraction in the DNA digest, accounting for over 70% of the total, was chromatographically indistinguishable from the two cis dGuo-N2 adducts. A second DNA adduct fraction was observed, which appeared also to be formed by reaction with guanine as indicated by experiments in which DNA containing [3H]guanine was reacted with unlabeled CPPE. The results confirm that guanine is the major target in DNA for reaction with CPPE and are the first proof of structure for a CPPE-deoxynucleoside adduct.

alpha-Sulfate trans-tamoxifen and alpha-sulfate cis-tamoxifen were synthesized as proposed active metabolites of tamoxifen that react with DNA. alpha-Acetoxytamoxifen was prepared as a model-activated form to produce a reactive carbocation. Calf thymus DNA was reacted with alpha-hydroxytamoxifen or the activated forms of tamoxifen, and tamoxifen-DNA adducts were analyzed by a 32P-postlabeling method. The reactivity of alpha-sulfate trans-tamoxifen to DNA was much higher than that of alpha-hydroxytamoxifen. The formation of tamoxifen-DNA adducts induced by alpha-acetoxytamoxifen and alpha-sulfate cis-tamoxifen was 1100- and 1600-fold, respectively, higher than that of alpha-hydroxytamoxifen. Both alpha-sulfate tamoxifens and alpha-acetoxytamoxifen were highly reactive to 2'-deoxyguanosine. Four reaction products of dG-tamoxifen were isolated by HPLC and characterized by mass- and proton magnetic resonance spectroscopy. Fractions 1 and 2 that eluted first were identified as the epimers of trans form of dG-N2-tamoxifen. Fractions 3 and 4 were identified as the epimers of cis form of dG-N2-tamoxifen. When DNA was reacted with alpha-acetoxytamoxifen in vitro, three isomers of dG-N2-tamoxifen were detected: fraction 2 was the major adduct while fractions 1 and 3 were minor adducts.

Poisson-Boltzmann calculations by Pack and co-workers suggest the presence of regions of increased hydrogen ion density in the grooves of DNA. As an experimental test of this prediction, we have attached proton-sensitive probes, with variable linker lengths, to random-sequence DNA at G sites in the minor groove. The amino groups of beta-alanine, gamma-aminobutyric acid (GABA), and epsilon-aminocaproic acid have been coupled at pH 5, via a formaldehyde link, to the exocyclic amino group of guanine, utilizing a reaction that has been extensively investigated by Hanlon and co-workers. The resulting adducts at pH 5 retained duplex B form but exhibited typical circular dichroism (CD) changes previously shown to be correlated with the presence of a net positive charge in the minor groove. Increases in the solvent pH reversed the CD spectral changes in a manner suggesting deprotonation of the carboxylic acid group of the adduct. These data were used to calculate an apparent pK(a) for the COOH. The pK(a) was increased by 2.4 units for beta-alanine, by 1.7 units for GABA, and by 1.5 units for epsilon-amino caproic acid, relative to their values in the free amino acid. This agrees well with Poisson-Boltzmann calculations and the energy minimization of the structures of the adducts that place the carboxyl groups in acidic domains whose hydrogen ion density is approximately 2 orders of magnitude greater than that of bulk solvent.

Study of DNA adducts formed with aromatic hydrocarbons is part of the strategy to elucidate the mechanisms of tumor initiation by these compounds. 1,2,3,4-Tetrahydro-7,12-dimethylbenz[a]anthracene (THDMBA) is of special interest because it allows discrimination between the pathways of bioactivation by one-electron oxidation and monooxygenation. To study and identify adducts formed biologically, synthetic adducts are needed as reference standards. THDMBA was electrochemically oxidized in the presence of deoxyadenosine (dA), adenine (Ade), deoxyguanosine (dG), or deoxycytidine (dC). In the presence of dA, four adducts were isolated: 7-methyl-1,2,3,4-tetrahydrobenz[a]anthracene-12-CH2-N7Ade (7-MTHBA-12-CH2-N7Ade, 3.6%), 12-MTHBA-7-CH2-N7Ade (4.2%), 7-MTHBA-12-CH2-N6dA (5.8%), and 12-exo-methylene-7-MTHBA-7-N6dA (22.8%); a dehydrogenated product, 7,12-di-exo-methylene-THBA (44.2%), was also obtained. In the presence of Ade, nine adducts were synthesized: 7-MTHBA-12-CH2-N7Ade (1.1%), 12-MTHBA-7-CH2-N7Ade (2.4%), 7-MTHBA-12-CH2-N1Ade (10.2%), 12-MTHBA-7-CH2-N1Ade (13.2%), 7-MTHBA-12CH2-N3Ade (1.7%), 12-MTHBA-7-CH2-N3Ade (1.7%), 7-exo-methylene-12-MTHBA-12-N3Ade (11.2%), 12-exo-methylene-7-MTHBA-7-N3Ade (27.9%), and 12-exo-methylene-7-MTHBA-7-N6Ade (12.1%), as well as the dehydrogenated product 7,12-di-exo-methylene-THBA (16.7%). In the presence of dG, three adducts were produced: 7-MTHBA-12-CH2-N7Gua (24.2%), 12-MTHBA-7-CH2-N7Gua (12.2%), and 7-MTHBA-12-CH2-N2dG (3.7%), as well as the dehydrogenated product 7,12-di-exo-methylene-THBA (38.9%). Anodic oxidation in the presence of dC yielded a large amount of 7,12-di-exo-methylene-THBA (80.4%), but no adducts. The structure of the adducts was elucidated by using UV, NMR, and MS. The N-7 positions in dG, dA, and Ade, the 2-NH2 in dG, and the N-1 position in Ade form exclusively methyl-linked adducts. In contrast, the 6-NH2 group of dA and Ade and the N-3 of Ade prefer to attack the meso-anthracenic positions rather than the methyl groups. The order of reactivity of dG and dA in the formation of methyl-linked THDMBA adducts agrees well with that previously found for 7,12-dimethylbenz[a]anthracene [RamaKrishna et al. (1992) J. Am. Chem. Soc. 114, 1863-1874.

Reactions between formaldehyde and guanosine in the range pH 4-10 gave N2-hydroxymethylguanosine 1, bis-N2-guanosinylmethane 2 and 7-[7-(beta-D-ribofuranosyl)-purin-6(7H)- on-2-yl]-3-(beta-D-ribofuranosyl)-5,6,7,8-tetrahydro-sym-triazino[ 1,2-alpha] purin-10(3H)-one 3a. The latter is a new adduct, the formation of which occurs in neutral solution, is favoured at higher pH and can be rationalised by a sequence of condensations involving two molecules each of guanosine and formaldehyde.

A dialkyl-substituted anthraquinone derivative was synthesized and ligated to a sequence-directing oligodeoxynucleotide to examine its efficiency and specificity for cross-linking to complementary sequences of DNA. The anthraquinone appendage stabilized spontaneous hybridization of the target and probe sequences through non-covalent interactions, as indicated by thermal denaturation studies. Covalent modification of the target was induced by exposure to near UV light (lambda > 335 nm) to generate cross-linked duplexes in yields as great as 45%. Reaction was dependent on the first unpaired nucleotide extended beyond the duplex formed by association of the target and probe. A specificity of C > T > A = G was determined for modification at this position. The overall site and nucleotide selectivity seems to originate from the chemical requirements of cross-linking and does not likely reflect the dominant solution structure of the complex prior to irradiation.

4,4'-Methylenedianiline (MDA) is used as a hardener in the manufacture of plastics and polyurethanes. MDA has been classified as a carcinogen in animals and is a suspected human carcinogen. Assuming that MDA would yield similar DNA adducts to other arylamines, we synthesized the following C-8 guanine adducts: N'-acetyl-N-(deoxyguanosin-8-yl)-MDA, N-(deoxyguanosin-8-yl)-MDA, N-(deoxyguanosin-8-yl)-4MA, and their corresponding 3'-monophosphate derivatives. We developed methods to identify these adducts of MDA in liver DNA using 32P-postlabeling, HPLC, and GC-MS techniques. Liver DNA was obtained from rats treated with radiolabeled MDA (1.11 and 116.5 mumol/kg body weight). The total radioactivity bound to the DNA corresponded to 0.06 and 2.7 adducts per 10(7) nucleotides [covalent binding index (CBI = (mumol of adduct per mol of nucleotide)/(mmol of compound per kg body weight)) of 1.05 and 2.3]. This DNA-binding potency is in the range of weakly genotoxic compounds. The liver DNA was analyzed for the presence of the synthesized adducts by the following methods: (I) HPLC analysis of nucleotides and purines after enzymatic and acid hydrolysis, and (II) 32P-postlabeling after enzymatic hydrolysis. The major adducts found in vivo did not correspond to the synthesized standards. Further work was carried out to determine the structure of the unidentified adducts. It was possible to release MDA and MDA-d4 from DNA of rats dosed with MDA and/or MDA-d4 and from the synthesized adducts using strong base hydrolysis. Liver of two female Wistar rats given 500 mumol/kg MDA-2HCl was hydrolyzed in 0.1 M NaOH overnight at 110 degrees C. GC-MS analysis of the heptafluorobutyric anhydride derivatized dichloromethane extracts detected 428 +/- 40 fmol of MDA/mg of DNA. In the control animals no MDA was found. The experiment was repeated with livers from animals dosed 500 mumol/kg MDA-d4.2DCl. In these rats 488 +/- 19 fmol MDA-d4 was found to be bound at liver DNA. Taking into account a 68% yield of the method, the CBI found in these cases was 0.82 and 1.0, respectively.

Mitomycin C (MMC) is a genotoxic cancer chemotherapeutic agent that reacts principally at the N2 position of guanine to form one of two predominant monoadducts, or a G-G interstrand cross-link at CpG sites, or a G-G intrastrand cross-link at GpG sites. Previous studies of MMC adduction have principally used very short duplex oligonucleotides (5-15 bp) or very long native duplex DNAs. We examined the formation and structural features of the MMC CpG interstrand cross-link on a model 23 bp synthetic oligonucleotide duplex having the (upper strand) sequence 5'-ATAAATACGTATTTATTTATAAA-3'. MMC was reacted with the duplex oligonucleotide in the presence of sodium dithionite at ratios of 6 mM dithionite: 1.5 mM MMC:0.03 mM duplex. The yield of cross-link in the reaction was determined to be approximately 4.8% by denaturing gel electrophoresis, which represented approximately 75% of the total bound MMC. The cross-linked DNA was isolated to greater than 97% purity in a single step by high temperature size exclusion column chromatography. Characterization of the purified product confirmed that the complex contained exclusively the N2G-MMC-N2G cross-link at the single central CpG site. CD spectroscopy demonstrated a negative band at approximately 290-320 nm which has previously been shown to be characteristic of the MMC cross-link. The relative intensity of this band compared to those reported for shorter duplexes suggested that the majority of the duplex is in a normal B-DNA helical configuration. Base-specific chemical footprinting techniques also indicated that there were subtle but distinct structural perturbations principally within the central four to six base pairs containing and adjacent to the cross-link.

It has been shown recently that some analogues of clinically ineffective trans-diamminedichloroplatinum (II) (transplatin) exhibit antitumor activity. This finding has inverted the empirical structure-antitumor activity relationships delineated for platinum(II) complexes, according to which only the cis geometry of leaving ligands in the bifunctional platinum complexes is therapeutically active. As a result, interactions of trans platinum compounds with DNA, which is the main pharmacological target of platinum anticancer drugs, are of great interest. The present paper describes the DNA binding of antitumor trans-[PtCl(2)(E-imino ether)(2)] complex (trans-EE) in a cell-free medium, which has been investigated using three experimental approaches. They involve thiourea as a probe of monofunctional DNA adducts of platinum (II) complexes with two leaving ligands in the trans configuration, ethidium bromide as a probe for distinguishing between monofunctional and bifunctional DNA adducts of platinum complexes and HPLC analysis of the platinated DNA enzymatically digested to nucleosides. The results show that bifunctional trans-EE preferentially forms monofunctional adducts at guanine residues in double-helical DNA even when DNA is incubated with the platinum complex for a relatively long time (48 h at 37 degrees C in 10 mM NaCIO(4). It implies that antitumor trans-EE modifies DNA in a different way than clinically ineffective transplatin, which forms prevalent amount of bifunctional DNA adducts after 48 h. This result has been interpreted to mean that the major adduct of trans-EE, occurring in DNA even after long reaction times, is a monofunctional adduct in which the reactivity of the second leaving group is markedly reduced. It has been suggested that the different properties of the adducts formed on DNA by transplatin and trans-EE are relevant to their distinct clinical efficacy.

5'-d(CCTATAGATATCC) was reacted with each syn-enantiomer of trans-7,8-dihydroxy 9,10-epoxy 7,8,9,10-tetrahydrobenzo[a]pyrene (syn-BPDE). The (-)-enantiomer yielded one dominating adduct, whereas the (+)-enantiomer resulted in two major adducts. As indicated by optical spectroscopic methods, the major adduct derived from both (-)- and (+)-syn-BPDE involves cis addition of the C-10 position of the diol epoxide to the exocyclic amino group of deoxyguanosine [(-)-syn-BPDEc-N2-dG and (+)-syn-BPDEc-N2-dG, respectively], whereas the minor (+)-syn-BPDE adduct is identical to a trans adduct [(+)-syn-BPDEt-N2-dG]. The cis adducts as well as the (+)-syn-BPDEt-N2-dG adduct are chemically stable for several weeks when stored at < or = 4 degrees C in darkness. In duplexes composed of (-)-syn-BPDEc-N2-dG or (+)-syn-BPDEc-N2-dG modified 5'-d(CCTATAGATATCC) and the complement 5'-d(GGATATCTATAGG), the presence of an adduct, in particular the latter, substantially decreased the Tm value relative to the corresponding unmodified duplex. Addition of 5'-d(GGATATCTATAGG) or strands in which dC was replaced with dT, dG, or dA to (-)-syn-BPDEc-N2-dG modified 5'-d(CCTATAGATATCC) decreased the fluorescence intensity in all cases (25-45%). In similar experiments with the (+)-syn-BPDEc-N2-dG adduct, dC or dT opposite the adduct decreased the fluorescence intensity, whereas dA and dG caused an increase. With the (+)-syn-BPDEt-N2-dG adduct, duplex formation had no effect on the intensity with dC or dG opposite the adduct, while an increase could be noted with dT or dA. Acrylamide had no significant effect on the fluorescence intensity of duplexes with cis adducts in contrast to the marked quenching of the fluorescence of (+)-syn-BPDEt-N2-dG oligonucleotide duplexes. In single stranded form, both the cis adducts exhibited absorption and fluorescence excitation maxima at 352-353 nm while the (+)-syn-BPDEt-N2-dG adduct was around 350-351 nm. Addition of the complement or the sequence in which dA replaced dC to the (+)-syn-BPDEt-N2-dG adduct shifted the maxima to 347-349 nm, whereas addition of sequences containing dT or dG opposite the adduct affected the fluorescence maxima but had no effect on absorption maxima. Formation of duplexes with the cis adducts had no or very little effect on the absorption and fluorescence maxima. In conclusion, the results of this study imply an intercalative mode of interaction of the pyrenyl chromophores of the cis adducts and external localization of the (+)-syn-BPDEt-N2-dG adduct.

The mechanism of DNA adduct formation by acroleins substituted with good leaving groups in the beta-position was investigated using [3-2H]-3-(p-nitrophenoxy)acrolein (1). Reaction of 1 with guanosine at acidic pH produced 9-beta-D-ribofuranosylpyrimido[1,2-alpha]purin-10(3H)-one containing equal amounts of deuterium at both carbons 6 and 8, indicating that hydrolysis of 1 to beta-hydroxyacrolein (malondialdehyde) occurred prior to reaction with guanosine. In contrast, reaction of 1 with deoxyguanosine at neutral pH produced 9-(beta-D-2'-deoxyribofuranosyl)pyrimido[1,2-alpha]purin-10(3H)-one with deuterium selectively incorporated at position 8. This indicates that the pyrimido[1,2-alpha]purin-10(3H)-one adduct forms by 1,2-addition of the exocyclic amino group of deoxyguanosine to the aldehyde carbon of 1 followed by cyclization with the ring nitrogen. In concert with these observations, reaction of 1 with p-nitroaniline produced 3-[(p-nitrophenyl)amino]acrolein with deuterium exclusively in the aldehyde carbon. These observations define the chemical steps in DNA adduct formation by acroleins substituted at the beta-position with good leaving groups. In addition, they explain the relatively modest dependence of mutagenicity on leaving group ability in this series of compounds.

We recently reported that co-administration to female mice of tamoxifen or 4-hydroxytamoxifen (4-OH-tamoxifen) with pentachlorophenol (PCP), but not with 2,6-dichloro-4-nitrophenol (DNCP) results in strong intensification of a specific subgroup, termed group I, of tamoxifen-DNA adducts in female mouse liver. As both PCP and DCNP are sulfotransferase inhibitors, we concluded that the intensification of tamoxifen group I adducts is probably not due to inhibition of sulfation by these phenols of a tamoxifen metabolite. Since epoxide derivatives of 4-OH-tamoxifen are potential candidates involved in tamoxifen-induced DNA damage, the hypothesis was developed and tested that PCP inhibits epoxide detoxication. As 4-OH-tamoxifen metabolites were unavailable to us, we employed indirect approaches to test this hypothesis. In the first set of experiments we determined whether PCP would augment DNA adduct formation from the benzo[a]pyrene metabolite, 9-hydroxybenzo[a]pyrene (9-OH-BP), as 9-OH-BP-4,5-epoxide is known to be involved in the metabolic activation of this compound. Female mice were given a single i.p. dose of 9-OH-BP (50 mumol/kg) either alone or in combination with PCP (75 mumol/kg), and hepatic DNA adducts were measured 24 h later by nuclease P1-enhanced bisphosphate 32P-postlabeling. Co-administration of PCP with 9-OH-BP resulted in a statistically significant 1.5- to 1.7-fold increase in 9-OH-BP adduct levels versus 9-OH-BP controls. In order to determine whether PCP inhibits the enzymatic detoxication of epoxides in vitro, in a second set of experiments, the effects of PCP on liver microsomal epoxide hydrolase (mEH) and purified equine liver glutathione S-transferase (GST) activities were studied using, respectively, styrene-7,8-oxide and 1-chloro-2,4-dinitrobenzene (CDNB) as substrates. Incubation of mouse liver microsomes with PCP (10-100 microM) strongly inhibited (by 21-97%) mEH activity in a dose-dependent manner, the IC50 being 35 microM. DCNP was ineffective as a mEH inactivator. PCP also inhibited purified equine liver GST activity, with an IC50 of 23.5 microM. Taken together, the results of this study strongly support the hypothesis that PCP inhibited enzymatic detoxication of epoxides in vivo and in vitro. By this mechanism PCP would lead to enhancement of DNA damage caused by 9-OH-BP, and possibly other drugs and their metabolites, which undergo epoxidation prior to DNA binding.

Benzene is a carcinogen in rodents and a cause of bone marrow toxicity and leukemia in humans. p-Benzoquinone (p-BQ) is one of the stable metabolites of benzene, as well as of a number of drugs and other chemicals. 2'-Deoxycytidine (dC) and 2'-deoxyadenosine (dA) were allowed to react with p-BQ in aqueous solution at pH 7.4 and 4.5. The yields were considerably higher at pH 4.5 than at pH 7.4, as indicated by HPLC analysis. The desired products were isolated by column chromatography on silica gel or cellulose. Identification was done by FAB-MS, 1H NMR, and UV spectroscopy. The reaction of p-BQ with dC and dA at pH 4.5 produced the exocyclic compounds 3-hydroxy-1,N4-benzetheno-2'-deoxycytidine (p-BQ-dC), and 9-hydroxy-1,N6-benzetheno-2'-deoxyadenosine (p-BQ-dA), respectively, in a large scale and high yield. These adducts have been previously made in a microgram scale as the 3'-phosphate for 32P-postlabeling studies of their incidence in DNA. The p-BQ-dC and p-BQ-dA adducts have, in addition to the two hydroxyl groups of deoxyribose, one newly formed hydroxyl group at the C-3 or C-9 of the exocyclic base of each product respectively. Incorporation of these adducts into oligonucleotides as the phosphoramidite requires the protection of all three hydroxyl groups in these compounds. The exocyclic hydroxyl on the base has been successfully protected by acylation after protecting the 5'- and the 3'-hydroxyl groups of the sugar moiety with a 4,4'-dimethoxytrityl group and a cyanoethyl N,N-diisopropylphosphoramidite group, respectively. For the first time, to our knowledge, the fully protected phosphoramidites of p-BQ-dC and p-BQ-dA were prepared and incorporated site-specifically into a series of oligonucleotides. The coupling efficiency was very high (> 98%). However, deprotection of the DNA oligomers with ammonia produced only 50% of the desired oligomers containing the adduct. In contrast, when 10% of 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in methanol at room temperature was used, only the desired oligomers were detected by HPLC. Thus, by deprotecting the oligomers with methoxide ions (DBU/methanol) and avoiding the use of ammonia, a high yield of modified DNA was obtained. After purification of these oligomers by HPLC, they were hydrolyzed enzymatically and analyzed by HPLC, which confirmed the base composition and the incorporation of the adducts. The mass spectroscopic analysis of the DNA oligomers was confirmed by electrospray MS. These oligomers are now under investigation for their biochemical properties.

The antiviral compound 9-(1,3-dihydroxy-2-propoxymethyl)guanine (DHPG, Ganciclovir) is used clinically to treat cytomegaloviral infections in immunocompromised hosts and more recently is being investigated as a chemotherapeutic agent to be used in combination with retroviral gene therapy. Structurally, DHPG, an analog of guanosine, lacks the 2'-deoxyribose carbon atom and is acyclic. It is therefore prochiral at the 4'-deoxyribose carbon, having both pro-R and pro-S isomers. This stereochemistry is critical during biochemical conversions. DHPG retains the equivalent of 3'-hydroxyl and 5'-hydroxyl moieties. These can potentially support not only initial misincorporation of DHPG into DNA but also subsequent nucleotide addition. The mechanism of DHPG antiviral action may thus not strictly be through chain terminations. To investigate the structural and biochemical consequences of incorporation of DHPG into DNA, with particular attention to the relative contributions of the deoxyribose sugar to the overall structure and stability of DNA, we have developed a methodology for the chiral chemical synthesis of DNA oligomers containing DHPG. The stereochemistry of the DHPG phosphoramidite was established by a stereoselective acetyl transfer reaction catalyzed by porcine pancreatic lipase. The DNA resisted enzymatic digestion at DHPG sites. Circular dichroism and copper phenanthroline cleavage studies indicated that the incorporation of DHPG into DNA does not significantly perturb the global B-conformation structure. Detailed thermodynamic investigations into DNA containing DHPG revealed reduced thermal stability, as evidenced by a decrease in melting temperature, with significant alteration of the enthalpy, entropy, and free energy of duplex formation. These data demonstrate that an intact deoxyribose ring significantly contributes to the stability of a DNA duplex.

A new type of 1-nitropyrene--DNA adduct via addition--elimination reaction was synthesized. Treatment of fluorinated 1-nitropyrene with 3'- and 5'-O-protected 2'-deoxyribonucleoside in dimethyl sulfoxide at 140 degrees C afforded N-(1-nitropyren-6-yl or 8-yl)-2'-deoxyribonucleoside. These DNA adducts resulted from addition of the exocyclic amino group of deoxynucleosides to the fluorinated carbon of the fluoro-1-nitropyrene following elimination of fluoride anion. This is the first report that describes the 1-nitropyrene-DNA adducts in which aromatic ring moiety of 1-nitropyrene is covalently linked to the exocyclic amino group of the deoxyribonucleoside. From our findings, we suggest that the addition-elimination reaction may be responsible for the formation mechanism of the putative 1-nitropyrene--DNA adducts in vivo.

DNA adducts of the environmental carcinogen benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE) interact stereospecifically with prokaryotic and eukaryotic polymerases in vitro. Toward understanding the capacity to replicate past different diastereomers of BPDE at specific sites in DNA, six deoxyoligonucleotides, each 33 bases long, were constructed with stereochemically defined BPDE adducts on adenine N6 at position two of the human N-ras codon 61. Four polymerases that were studied under single encounters with the template-primer complex terminated synthesis one base 3' to the lesion with all the adducted templates. When multiple encounters between polymerase and substrate were permitted, each of the polymerases analyzed revealed a unique pattern for a given adducted template. The general replication pattern was encompassed under two categories, reflecting the significance of the R and S configurations of C10 of the pyrenyl ring attached to the single-stranded DNA template. Furthermore, within each of these categories, every polymerase demonstrated distinct quantitative differences in product accumulation at a given site, for the various adducted templates. Among the polymerases utilized in this study, exonuclease-deficient Klenow fragment of polymerase I (exo- KF) exhibited the most efficient translesion synthesis resulting in approximately 16% full-length products with the modified templates bearing adducts with C10-S configuration. In contrast, chain elongation with bacteriophage T4 DNA polymerase bearing an active 3'-->5' exonucleolytic activity was most strongly inhibited by all six BPDE-adducted templates. Misincorporation of A opposite the adduct occurred in all the templates when polymerized with Sequenase, whereas exo- KF preferentially incorporated C opposite the C10-R BPDE adducts and A opposite the C10-S BPDE adducts.