Search

Cross-linking ability is possible with the oligonucleotide-tethered, monofunctional trans-Pt(II) complex shown. It was synthesized by a novel solid-phase approach comprising conjugation of immobilized tetrathymidylic acid with a trans-a(2)Pt(II) building unit, ammonolysis, and transformation of the resulting complex (R=1-N-cyclohexylmethylthyminate) into the chloro derivative (R=Cl). a=NH(2)CH(3), T=thymine.

The chloroform-soluble nucleobase derivatives N9-cyclohexylmethyladenine (A) and N1-cyclohexylmethylthymine (T) have been synthesized in order to study hydrogen-bonding interactions between A and the thymidine mimic 2,4-difluorotoluene (F) in CDCl3 at high concentrations. Concentration-dependent 1H NMR experiments show that in the presence of F, A undergoes self-association rather than pairing with F. These results strongly support the assumptions made by Kool with regard to the lack of hydrogen bonding between adenine and 2,4-difluorotoluene.

Elucidation of noncholinesterase protein targets of organophosphates, and nerve agents in particular, may reveal additional mechanisms for their high toxicity as well as clues for novel therapeutic approaches toward intoxications with these agents. Within this framework, we here describe the synthesis of the activity-based probe 3, which contains a phosphonofluoridate moiety, a P-Me moiety, and a biotinylated O-alkyl group, and its use in activity-based protein profiling with two relevant biological samples, that is, rhesus monkey liver and cultured human A549 lung cells. In this way, we have unearthed eight serine hydrolases (fatty acid synthase, acylpeptide hydrolase, dipeptidyl peptidase 9, prolyl oligopeptidase, carboxylesterase, long-chain acyl coenzyme A thioesterase, PAF acetylhydrolase 1b, and esterase D/S-formyl glutathione hydrolase) as targets that are modified by the nerve agent sarin. It is also shown that the newly developed probe 3 might find its way into the development of alternative, less laborious purification protocols for human butyrylcholinesterase, a potent bioscavenger currently under clinical investigation as a prophylactic/therapeutic for nerve agent intoxications. © 2009 American Chemical Society.

Cytosolic and nuclear proteins may be subject to both O-GlcNAcylation and proteasomal degradation. By means of activity-based profiling, we demonstrate that O-GlcNAc serine-containing peptide epoxyketones bind to the proteasome catalytic active sites and thus provide the first clear evidence that proteasomes recognize peptides post-translationally modified with a GlcNAc moiety.

The DNA fragment d(CG)3 was co-crystallized with N-(2-aminoethyl)-1,4-diaminobutane (PA(24)), a chemically synthesized polyamine. The complex crystal contained one polyamine, 3 magnesium cations and one sodium cation per duplex of d(CG)3, and well diffracted the X-ray intensities up to 1.0 Å resolution. The d(CG)3 took a left-handed Z-DNA conformation, and the PA(24) molecule electrostatically interacted with the phosphate groups of the d(CG)3 duplex.

The DNA duplex 5'-d(GCCACAAGCTC).d(GAGCTGGTGGC), which contains a central G.A mismatch has been studied by one and two-dimensional NMR techniques. The duplex corresponds to the sequence 29-39 of the K-ras gene. The mismatch position is that of the first base of the Gly12 codon, a hot spot for mutations. The observed NOEs of the nonexchangeable protons show that both of the bases of the mismatched pair are intrahelical over a wide range of pH. However, the structure of the G.A mispair and the conformation of the central part of the duplex change with pH. This structural change shows a pK of 6.0. At low pH, the G.A bases are base paired with hydrogen bonds between the keto group of the G residue and the amino group of the A residue and, secondly, between the N7 of the G and a proton on N1 of A. This causes the G residue to adopt a syn conformation. On raising the pH, the N1-H proton of the protonated A residue is removed, and the base pair rearranges. In the neutral G.A base pair both residues adopt an anti conformation, and the mismatch is stabilized by hydrogen bonds. Our results on the exchangeable and A(H2) protons of the mismatched pair indicate a shift from a classical face-to-face two hydrogen-bonded structure to a slipped structure stabilized by bifurcated hydrogen bonds. This may be a particular characteristics of this oncogenic sequence in which the G.A error is poorly repaired.

A new method for the construction of pyrophosphates is reported based on the coupling of a sugar phosphate and a nucleoside phosphoramidite. The in situ formed phosphate-phosphite intermediate was subsequently oxidized with tBuOOH. Three UDP-N-acetylglucosamine derivatives were prepared using this one-pot procedure in good yields.

Stable isotope labeling (SIL) in combination with liquid chromatography-mass spectrometry is one of the most widely used quantitative analytical methods due to its sensitivity and ability to deal with extremely complex biological samples. However, SIL methods for metabolite analysis are still often limited in terms of multiplexing, the chromatographic properties of the derivatized analytes, or their ionization efficiency. Here we describe a new family of reagents for the SIL of primary amine-containing compounds based on pentafluorophenyl-activated esters of (13)C-containing poly(ethylene glycol) chains (PEG) that addresses these shortcomings. A sequential buildup of the PEG chain allowed the introduction of various numbers of (13)C atoms opening extended multiplexing possibilities. The PEG derivatives of rather hydrophilic molecules such as amino acids and glutathione were successfully retained on a standard C(18) reversed-phase column, and their identification was facilitated based on m/z values and retention times using extracted ion chromatograms. The mass increase due to PEG derivatization moved low molecular weight metabolite signals out of the often noisy, low m/z region of the mass spectra, which resulted in enhanced overall sensitivity and selectivity. Furthermore, elution at increased retention times resulted in efficient electrospray ionization due to the higher acetonitrile content in the mobile phase. The method was successfully applied to the quantification of intracellular amino acids and glutathione in a cellular model of human lung epithelium exposed to cigarette smoke-induced oxidative stress. It was shown that the concentration of most amino acids increased upon exposure of A549 cells to gas-phase cigarette smoke with respect to air control and cigarette smoke extract and that free thiol-containing species (e.g., glutathione) decreased although disulfide bond formation was not increased. These labeling reagents should also prove useful for the labeling of peptides and other compounds containing primary amine functionalities.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (author) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If author is substituted with d(TCTCCTCCTTC) (en), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and author (h : author) but not by h and en, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h : author is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (Δɛ=80 m −1 cm−1 at 242 nm and a stronger one (Δɛ=210 m −1 cm−1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py : Pu : Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h : s1 is accompanied by an average change in enthalpy (less the protonation contribution) of −73(±5) kcal/mol of triplex, which corresponds to −6·6(±0·4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Cyclic ribodiguanylic acid, c-(GpGp), is the endogenous effector regulator of cellulose synthase. Its three-dimensional structure from two different crystal forms (tetragonal and trigonal) has been determined by X-ray diffraction analysis at 1 A resolution. In both crystal forms, two independent c-(GpGp) molecules associate with each other to form a self-intercalated dimer. A hydrated cobalt ion is found to coordinate to two N7 atoms of adjacent guanines, forcing these two guanines to destack with a large dihedral angle (32°), in the dimer of the tetragonal form. This metal coordination mechanism may be relevant to that of the anticancer drug cisplatin. Moreover, c-(GpGp) exhibits unusual spectral properties not seen in any other cyclic dinucleotide. It interacts with planar organic intercalator molecules in ways similar to double helical DNA. We propose a cage-like model consisting of a tetrameric c-(GpGp) aggregate in which a large cavity (‘host’) is generated to afford a binding site for certain planar intercalators (‘guests’).

Purpose: Targeted intervention in calcineurin/NFAT signaling is an effective strategy in the treatment of vascular smooth muscle cell (vSMC) hyperplasia and restenosis. We have recently shown that VIVIT, a novel peptide inhibitor of NFAT, is more selective and less toxic than cyclosporine A (CsA) and holds promise in antirestenotic therapy. However, its suboptimal pharmacological features preclude direct clinical use. In this study, we sought to overcome these setbacks by stepwise optimization of VIVIT. Methods and Results: In the first stage stepwise truncation and alanine scan studies were performed to establish the critical importance of the HPVIVIT motif for NFAT inhibition. In order to create a non-toxic bipartite compound that simultaneously targets two recently identified NFAT docking sites on calcineurin, the HPVIVIT motif was conjugated to a maleimide derivative via a series of flexible spacers of 8–28 Å. One of the conjugates, maleimide conjugated HPVIVIT or MCV, was 10,000 more potent in inhibiting NFAT (IC50=1.9 nM) than the parent peptide. MCV was able to abrogate ionomycin induced nuclear translocation of NFAT1-GFP at 100 nM and this effect persisted for >36h. Moreover, it profoundly inhibited platelet-derived growth factor-BB stimulated vSMC proliferation at concentrations as low as 10 nM (P=0.04; ~80%). MCV (100 nM) selectively disrupted calcineurin NFAT interaction in a GST pull-down assay but did not affect that of other binding partners (AKAP-79/Cain). It was at least equally potent as CsA in inhibiting ionomycin induced NFAT dephosphorylation in COS-1 cells. Unlike CsA however, MCV appeared to be non-toxic and did not impair the activity of calcineurin phosphatase. Moreover, in contrast to CsA MCV did not affect mitogen-activated protein kinase activity after PMA stimulation in COS-1 cells at concentrations up to 10 μM nor did it influence NFκB activity. Finally, CsA prevented nuclear accumulation of calcineurin, which remained unaffected by MCV1 (1 μM). Conclusion : The potency, chemical features and superior selectivity of the bipartite NFAT inhibitor MCV render this compound an excellent lead in the treatment of inflammatory disorders implicating NFAT activation, including myocardiac hypertrophy and restenosis.

Celiac disease is an intestinal disease caused by intolerance for gluten, a common protein in food. A life-long gluten-free diet is the only available treatment. As it is well established that the interaction between proline-rich gluten derived peptides and the human HLA-DQ2 molecules induces immune responses that lead to disease development, we have now designed a series of gluten peptides in which proline residues were replaced by azidoprolines. These peptides were found to bind to HLA-DQ2 with an affinity similar to that of the natural gluten peptide. Moreover, some of these peptides were found to be non-immunogenic and block gluten induced immune responses. These can thus serve as lead compounds for the development of HLA-DQ2 blocker peptides.

With the emergence of multidrug resistant (MDR) bacteria, it is imperative to develop new intervention strategies. Current antibiotics typically target pathogen rather than host-specific biochemical pathways. Here we have developed kinase inhibitors that prevent intracellular growth of unrelated pathogens such as Salmonella typhimurium and Mycobacterium tuberculosis. An RNA interference screen of the human kinome using automated microscopy revealed several host kinases capable of inhibiting intracellular growth of S. typhimurium. The kinases identified clustered in one network around AKT1 (also known as PKB). Inhibitors of AKT1 prevent intracellular growth of various bacteria including MDR-M. tuberculosis. AKT1 is activated by the S. typhimurium effector SopB, which promotes intracellular survival by controlling actin dynamics through PAK4, and phagosome-lysosome fusion through the AS160 (also known as TBC1D4)-RAB14 pathway. AKT1 inhibitors counteract the bacterial manipulation of host signalling processes, thus controlling intracellular growth of bacteria. By using a reciprocal chemical genetics approach, we identified kinase inhibitors with antibiotic properties and their host targets, and we determined host signalling networks that are activated by intracellular bacteria for survival.

The synthesis and evaluation of hybrid proteasome inhibitors that contain structural elements of the known inhibitors bortezomib, epoxomicin and peptide vinyl sulfones is described. From the panel of 15 inhibitors some structure activity relationships can be deduced with regard to inhibitory activity in relation to peptide recognition element, inhibitor size and nature of the electrophilic trap. Further, the panel contains one of the most potent peptide-based pan-proteasome inhibitors reported to date.

SummaryThe proteasome is an essential evolutionary conserved protease involved in many regulatory systems. Here, we describe the synthesis and characterization of the activity-based, fluorescent, and cell-permeable inhibitor Bodipy TMR-Ahx3L3VS (MV151), which specifically targets all active subunits of the proteasome and immunoproteasome in living cells, allowing for rapid and sensitive in-gel detection. The inhibition profile of a panel of commonly used proteasome inhibitors could be readily determined by MV151 labeling. Administration of MV151 to mice allowed for in vivo labeling of proteasomes, which correlated with inhibition of proteasomal degradation in the affected tissues. This probe can be used for many applications ranging from clinical profiling of proteasome activity, to biochemical analysis of subunit specificity of inhibitors, and to cell biological analysis of the proteasome function and dynamics in living cells.

This paper describes the synthesis and in-depth characterization of two new porphyrogenic macrocycles 1 and 2, and provides an evaluation of these molecules as photosensitizer agents. By tuning the reaction conditions and starting from readily available 1,9-diformyl-5-phenyldipyrromethane (4) and tripyrrane dicarboxylic acid (3), both the nonaromatic isopentaphyrin 1, composed of a 24 pi-electron macrocycle, and the aromatic pentaphyrin 2, composed of a 22 pi-electron macrocycle, were obtained in good yield and purity. Confocal laser microscopy and cytofluorimetry studies showed that the newly synthesized pentaphyrins penetrate the cell membranes and localize mainly in the cytoplasm. In the absence of light, 1 and 2 exhibit a nonsignificant cytotoxic effect at concentrations up to 3 mug/mL. In contrast, the synthesized pentaphyrins, when delivered to cells at 1.5 or 3 microg/mL and irradiated with white light (8 mW/cm(2)), promoted a strong and dose-dependent phototoxic effect in four different cell lines. FACS and caspase-3/7 activation assays demonstrated that the pentaphyrins cause cell death by apoptosis.

A combinatorial synthesis of oligopeptide analogues and their evaluation as protein:geranylgeranyl transferase inhibitors is presented. The combinatorial strategy is based on the random mutation, in each new generation, of one of any of the four amino acid building blocks of which the most effective compounds of the previous generation are assembled. In this way, a progressive improvement of the average inhibitory activity was observed until the fifth generation. The most active inhibitors were found to inhibit PGGT-1 in the low micromolar range (IC(50): 3.8-8.1 microM).

The synthesis and biological evaluation of platinum(II) amine complexes designed to act as inhibitors of the human cysteine protease cathepsin B, a thiol-dependent enzyme, is described. The complexes, composed of a cathepsin targeting ligand and a platinum(II) moiety with varying degrees of reactivity towards nucleophiles were characterized by physical-analytical methods and a proof of principle was illustrated in a model reaction. In biological tests for inhibitory activity against cathepsin B the presented compounds did not show significant inhibitory activity.

(2-Cyanoethoxy)(N,N-diisopropylamino)(1-(1-thyminyl)-1,2-dideoxy-3-O-(4,4’-dimethoxytrityl)-β-D-erythro-pentofuranuronamido)phosphine 7 was used as a building unit in a stepwise solid phase synthesis of an immobilized decamer employing 5-mercapto-1-methyltetrazole as activation reagent. Decyanoethylation and release of the immobilized decamer from the support with methanolic potassium carbonate furnished modified oligonucleotide 16.

Ca 1 a 2 L analogues, having the central dipeptide a 1 a 2 replaced by a sugar amino acid, were provided at the N-terminal end directly or via a spacer with a lipid. The inhibitory potency toward PGGT-1 of the set of lipophilic Ca 1 a 2 L analogues was improved in comparison with the original analogues, 1 and 2 . The most potent inhibitors, 39 and 40 , were found to inhibit PGGT-1 with an IC 50 -value of 12.7 and 12.3 μM, respectively, which is a 6-fold improvement over the corresponding analogue 1 .

The Lewis X trisaccharide is pivotal in mediating specific cell-cell interactions. Monoclonal antibody 291-2G3-A, which was generated from mice infected with schistosomes, has been shown to recognize the Lewis X trisaccharide. Here we describe the structure of the Fab fragment of 291-2G3-A, with Lewis X, to 1.8 A resolution. The crystallographic analysis revealed that the antigen binding site is a rather shallow binding pocket, and residues from all six complementary determining regions of the antibody contact all sugar residues. The high specificity of the binding pocket does not result in high affinity; the K D determined by isothermal calorimetry is 11 μM. However, this affinity is in the same range as for other sugar-antibody complexes. The detailed understanding of the antibody-Lewis X interaction revealed by the crystal structure may be helpful in the design of better diagnostic tools for schistosomiasis and for studying Lewis X-mediated cell-cell interactions by antibody interference.

Eleven analogues of the C-terminal Ca(1)a(2)X motif found in natural substrates of the prenyl transferases PFT and PGGT-1 were synthesized and evaluated for their inhibition potency and selectivity against PFT and PGGT-1. Replacement of the central dipeptide part a(1)a(2) by a benzylated sugar amino acid resulted in a good and highly selective PFT inhibitor (8, IC(50) = 250 +/- 20 nM). The methyl ester of 8 (13) selectively inhibited protein farnesylation in cultured cells.

The synthesis of ionic support 1 and its application in the preparation of a set of amides and sulfonamides is described. The potential of 1 is further exemplified by its use in a one-pot multistep ionic liquid phase assisted synthesis of tirofiban analogue 2.

Many successful candidate vaccines capable of combating tumours in animal models come to an untimely end because of the costs associated with the approval and production of the GMP-grade materials, which are usually of biological origin, for use in humans. We have used a GMP-compatible method to chemically synthesize a pure synthetic E7 protein of the human papillomavirus type 16 (HPV16-E7). This oncogen-derived protein is constitutively expressed in cervical cancer and its precursors and is thus considered as an excellent target for tumour-specific immunity. Injection of a mixture of the synthetic HPV16-E7 protein and the synthetic adjuvant CpG in mice resulted in strong functional HPV16-specific cytotoxic T-lymphocyte responses as measured by CD8+ MHC class I-tetramer staining, the detection of antigen-specific intracellular IFNgamma production and the ability to protect mice against a challenge with HPV16-E7+ TC-1 tumour cells in both prophylactic and therapeutic vaccination regimens. Our results demonstrate the potential use of pure synthetic vaccines that can be efficiently produced under GMP at low cost, which will stimulate the translation of new vaccination strategies into phase I/II clinical trials.

Since the discovery of peptide nucleic acids (PNAs) as DNA mimics in the early 1990s, a tremendous effort has been directed to their application as antisense and antigene probes. With the aim of further enhancing their properties, PNAs have been conjugated to a variety of effector molecules. Among these, small peptide fragments, often derived from functional proteins, are able to convey their specific properties to the conjugate.

The automated parallel solid-phase synthesis of a 36-member library of peptide-tethered platinum(II) complexes is described. The identity and quality of each product were confirmed by mass spectrometry and (1)H NMR. Subsequently, each compound was screened for in vitro anticancer activity by treating the A2780 (human ovarian carcinoma) cell line with two concentrations of the drugs (100 and 10 microM) in quadruplicate. The reduction of cell proliferation induced by the drugs at these concentrations was determined with the MTT colorimetric assay (MTT = 3-(4',5'-dimethylthiazol-2'-yl)-2,5-diphenyltetrazolium bromide) and compared to cisplatin. Even though no very active library members could be identified, five apparently most active (8[1], 8[4], 8[10], 8[13], and 8[24]) and two inactive complexes (8[33] and 8[34]) were purified using gel permeation chromatography and fully characterized by NMR spectroscopy ((1)H, (195)Pt) and MS. The IC(50) values of these complexes and cisplatin in A2780 cells were subsequently determined using the MTT assay in a conventional manner. All seven complexes have an IC(50) above 100 microM, confirming the results generated by the assay at 100 and 10 microM of the crude reaction products.

The highly functionalized piperidine 5a was synthesized in only 4 steps starting from ribose using a tandem retro‐Michael‐[2 + 3]‐cycloaddition process as the key transformation. The versatility of the tandem retro‐Michael‐[2 + 3]‐cycloaddition was demonstrated by the synthesis of novel piperidines 5b, 5c, 11 and 16.

Diphenylsulfoxide in combination with triflic anhydride provides a very potent thiophilic glycosylation promotor system, capable of activating disarmed thioglycosides. The usefulness of this novel thiophilic activator is illustrated in a successful chemoselective glycosylation sequence in which the donor thioglycoside in the first condensation step may be either armed or disarmed. [reaction: see text]

Chitotriosidase is a chitinase that is massively expressed by lipid-laden tissue macrophages in man. Its enzymatic activity is markedly elevated in serum of patients suffering from lysosomal lipid storage disorders, sarcoidosis, thalassemia, and visceral Leishmaniasis. Monitoring of serum chitotriosidase activity in Gaucher disease patients during progression and therapeutic correction of their disease is useful to obtain insight in changes in body burden on pathological macrophages. However, accurate quantification of chitotriosidase levels by enzyme assay is complicated by apparent substrate inhibition, which prohibits the use of saturating substrate concentrations. We have therefore studied the catalytic features of chitotriosidase in more detail. It is demonstrated that the inhibition of enzyme activity at excess substrate concentration can be fully explained by transglycosylation of substrate molecules. The potential physiological consequences of the ability of chitotriosidase to hydrolyze as well as transglycosylate are discussed. The novel insight in transglycosidase activity of chitotriosidase has led to the design of a new substrate molecule, 4-methylumbelliferyl-(4-deoxy)chitobiose. With this substrate, which is no acceptor for transglycosylation, chitotriosidase shows normal Michaelis-Menten kinetics, resulting in major improvements in sensitivity and reproducibility of enzymatic activity measurements. The novel convenient chitotriosidase enzyme assay should facilitate the accurate monitoring of Gaucher disease patients receiving costly enzyme replacement therapy.

The sequence specificity and intensity of DNA damage induced by six peptide-tethered platinum complexes was compared to cisplatin and Pt(en)Cl(2). DNA damage was investigated in pUC19 plasmid and in intact HeLa cells, and quantitatively analyzed using a Taq DNA polymerase/linear amplification assay. The DNA sequence specificity of the peptide-platinum compounds was found to be very similar to cisplatin and Pt(en)Cl(2), with runs of consecutive guanines being the most intensely damaged sites. The observed reactivity of the peptide-platinum complexes towards plasmid DNA was lower compared to cisplatin and Pt(en)Cl(2), with the glycine-tethered complex 3 and the phenylalanine-tethered complex 4 producing the highest relative damage intensity, followed by (in decreasing order) lysine-tethered (5), arginine-tethered (6), serine-tethered (7) and glutamate-tethered (8). The reactivity of the peptide-platinum complexes towards cellular DNA was also lower compared to cisplatin and Pt(en)Cl(2). For most investigated complexes, the relative damage intensities were found to be similar in cells compared to plasmid DNA, but were greatly reduced for 3 and 4. The lysine-tethered 5 complex produced the highest DNA damage intensity in cells followed by (in decreasing order) 6, 7, 3, 4 and 8.

Four partially protected stereoisomeric cyclopentenetriols 5, 10, 15 and 21 have been prepared by ring-closing metathesis of carbohydrate-derived 1,6-dienes. The presence of a differentiated allylic alcohol in the cyclopentenetriols allows a variety of synthetic transformations, underlining the synthetic use of the prepared cyclopentenetriol derivatives as chiral building blocks.

A method for obtaining potentially anti-tumour active dinuclear platinum coordination compounds via solid-phase inorganic synthesis is described for the first time.

A ring-closing metathesis (RCM) and a ring-opening metathesis (ROM) are combined in a domino process giving access to a variety of aza- and oxacyles, equipped with highly functionalized side chains, starting from readily accessible cyclopentenyl or cycloheptenyl ethers and amines. The role of different protective groups is examined as well as the influence of the relative configuration of stereocenters of the substrate molecules. Substituted 2,5-dihydro-furans and -pyrroles, 1,2,5,6-tetrahydropyranes and -pyridines as well as 2,3,4,7-tetrahydrooxepines are available via this methodology.

A solid-phase approach is described that provides facile access to monofunctionally trans-PtII-modified PNA oligomers of arbitrary sequence for potential use both in antigene and antisense strategies. The approach includes the synthesis of a platinated building block 1 and its subsequent incorporation into three different PNA oligomers 5-7 by solid-phase synthesis. In a model cross-linking reaction one of the latter is found to recognize sequence-specifically a target oligonucleotide 8 and to cross-link to it. The resulting structure is the trans-PtII-cross-linked PNA/DNA duplex 9 as revealed by mass spectrometry in combination with a Maxam-Gilbert sequencing experiment.

Nucleotide excision repair in Escherichia coli involves formation of the UvrB–DNA complex and subsequent DNA incisions on either site of the damage by UvrC. In this paper, we studied the incision of substrates with different damages in varying sequence contexts. We show that there is not always a correlation between the incision efficiency and the stability of the UvrB–DNA complex. Both stable and unstable UvrB–DNA complexes can be efficiently incised. However some lesions that give rise to stable UvrB–DNA complexes do result in a very low incision. We present evidence that this poor incision is due to sterical hindrance of the damage itself. In its C-terminal region UvrC contains two helix–hairpin–helix (HhH) motifs. Mutational analysis shows that these motifs constitute one functional unit, probably folded as one structural unit; the (HhH)2 domain. This (HhH)2 domain was previously shown to be important for the 5′ incision on a substrate containing a (cis-Pt)·GG adduct, but not for 3′ incision. Here we show that, mainly depending on the sequence context of the lesion, the (HhH)2 domain can be important for 3′ and/or 5′ incision. We propose that the (HhH)2 domain stabilises specific DNA structures required for the two incisions, thereby contributing to the flexibility of the UvrABC repair system.

In this study, we present the design and synthesis of an antisense peptide nucleic acid (asPNA) prodrug, which displays an improved biodistribution profile and an equally improved capacity to reduce the levels of target mRNA. The prodrug, K(GalNAc)(2)-asPNA, comprised of a 14-mer sequence complementary to the human microsomal triglyceride transfer protein (huMTP) gene, conjugated to a high-affinity tag for the hepatic asialoglycoprotein receptor (K(GalNAc)(2)). The prodrug was avidly bound and rapidly internalized by HepG2s. After iv injection into mice, K(GalNAc)(2)-asPNA accumulated in the parenchymal liver cells to a much greater extent than nonconjugated PNA (46% +/- 1% vs 3.1% +/- 0.5% of the injected dose, respectively). The prodrug was able to reduce MTP mRNA levels in HepG2 cells by 35-40% (P < 0.02) at 100 nM in an asialoglycoprotein receptor- and sequence-dependent fashion. In conclusion, hepatocyte-targeted PNA prodrugs combine a greatly improved tropism with an enhanced local intracellular availability and activity, making them attractive therapeutics to lower the expression level of hepatic target genes such as MTP.

The transfection ability of nonviral gene therapy vehicles is generally hampered by untimely lysosomal degradation of internalized DNA. In this study we describe the development of a targeted lysosome disruptive element to facilitate the escape of DNA from the lysosomal compartment, thus enhancing the transfection efficacy, in a cell-specific fashion. Two peptides (INF7 and JTS-1) were tested for their capacity to disrupt liposomes. In contrast to JTS-1, INF7 induced rapid cholesterol-independent leakage (EC(50), 1.3 microm). INF7 was therefore selected for coupling to a high affinity ligand for the asialoglycoprotein receptor (ASGPr), K(GalNAc)(2), to im- prove its uptake by parenchymal liver cells. Although the parent peptide disrupted both cholesterol-rich and -poor liposomes, the conjugate, INF7-K(GalNAc)(2), only induced leakage of cholesterol-poor liposomes. Given that endosomal membranes of eukaryotic cells contain5% cholesterol, this implies that the conjugate will display a higher selectivity toward endosomal membranes. Although both INF7 and INF7-K(GalNAc)(2) were found to increase the transfection efficiency on polyplex-mediated gene transfer to parenchymal liver cells by 30-fold, only INF7-K(GalNAc)(2) appeared to do so in an ASGPr-specific manner. In mice, INF7-K(GalNAc)(2) was specifically targeted to the liver, whereas INF7 was distributed evenly over various organs. In summary, we have prepared a nontoxic cell-specific lysosome disruptive element that improves gene delivery to parenchymal liver cells via the ASGPr. Its high cell specificity and preference to lyse intracellular membranes make this conjugate a promising lead in hepatocyte-specific drug/gene delivery protocols.

Elevated levels of glutathione-S-transferase (GST) isoenzymes are found in many tumor cells and are thought to play a role in the onset of multidrug resistance (MDR). To evaluate the contribution of GST to this process, inhibitors are needed. Glutathione (GSH) conjugates, although good GST inhibitors, cannot be used in vivo, because they are eliminated rapidly. In this paper, we describe the synthesis of a series of novel peptidomimetic glutathione analogues that are stabilized against peptidase mediated breakdown. The peptide bonds in GSH were replaced by isosteres, such as the 'reduced' amide (which was prepared using a novel method), N-methylamide, urethane, and methylene linkages. The in vitro evaluation of the compounds focuses on GST inhibition and stability towards gamma-glutamyl-transpeptidase (gammaGT), the main enzyme involved in GSH breakdown. The compounds were conjugated to the model electrophile ethacrynic acid (EA) to resemble GS-EA, an efficient GST inhibitor. All novel GSH-analogues were shown to inhibit rat liver cytosolic GSTs. Furthermore, peptidomimetic changes of the gamma-glutamyl-cysteine amide bond greatly improved stability towards gammaGT. These compounds may therefore be useful in the design of novel in vivo applicable GST inhibitors.

A convenient route for the synthesis of phosphorus diolefinic templates starting from the bifunctional reagent bis(diisopropylamino)vinylphosphine is presented. Ring closing olefin metathesis on this type of diene substrate revealed that the newly developed 4,5-dihydro-imidazol-2-ylidene ruthenium benzylidene complex 4 is in all aspects superior to the previously developed Grubbs’ catalyst 1. © 2000 Elsevier Science Ltd. All rights reserved.

Exogenous triplex-forming oligodeoxynucleotides (TFO) have the capacity to modulate in vivo the expression of individual genes. As the administration of TFO to cells is not without problems, we analyzed the possibility of generating them directly in the cell, using specific expression vectors. We constructed three vectors, mU6-GA, mU6-CA, and mU6-CT, that direct the synthesis in human 293 cells of 76-mer CU, GU, and AG motif TFO (rTFO) potentially capable of binding to a critical poly (R x Y) sequence contained in the promoter of the Ki-ras proto-oncogene. The ability of the CU, GU, and AG motif rTFO to interact with the double helix of the c-Ki-ras target was investigated in vitro by footprinting and band-shift experiments, using both synthetic and endogenously synthesized oligoribonucleotides. The human 293 cells were transfected with DNA mixtures containing a plasmid, which bears the reporter chloramphenicol acetyltransferase (CAT) gene downstream from the c-Ki-ras promoter (pKRS-413), as well as an rTFO-generating vector (mU6-GA, mU6-CA, or mU6-CT). As control, the cells were transfected with DNA mixtures containing vector mU6-C1 or mU6-C2. These generated transcripts unable to form triple helices with the poly (R x Y) sequence of the c-Ki-ras promoter. Intracellular synthesis of the 76-mer CU, GU, and AG rTFO by mU6-GA, mU6-CA, and mU6-CT was checked by Northern blot hybridization. Through beta-gal and CAT ELISA immunoassays, we found that the 293 cells transfected with either mU6-GA, mU6-CA, or mU6-CT showed a significant inhibition of CAT expression compared with cells transfected with control plasmids mU6-C1 or mU6-C2. The results of five separate transient transfection experiments showed that endogenous GU and AG rTFO, generated by mU6-CA and mU6-CT, produce, respectively, 40% (+/- 4% SE) and 47% (+/- 8% SE) CAT inhibition, whereas CU rTFO, generated by mU6-GA, produces 38% (+/- 7% SE) CAT inhibition. In conclusion, this study suggests that it is possible to downregulate the expression of an individual gene through the use of recombinant vectors encoding the information for the intracellular synthesis of short triplex-forming RNA strands.

he deoxy derivatives ethyl 4,5,7-tri-O-benzyl-3-deoxy-α-D-arabino-2-heptulopyranosonate,3,4,6-tri-O-benzyl-2-deoxy-α/β-D-arabino-hexopyranose and 3,4,6-tri-O-benzyl-2-deoxy-D-arabino-hexono-1,5-lactone were prepared from 2,3,5-tri-O-benzyl-D-arabinitol 1,4-sulfate (3b) regioselective nucleophilic ring opening with 2-ethoxycarbonyl-2-lithio-1,3-dithiane ,bis(methylthio)methyllithium , and tris(methylthio)methyllithium , respectively, followed by consecutive hydrolysis of the resulting sulfates and unmasking of the alkylthio functions

DNA from Kinetoplastida contains the unusual modified base β-D-glucosyl(hydroxymethyl))uracil, called J. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes in Trypanosoma brucei. We have now identified a protein in nuclear extracts of bloodstream stage T. brucei that binds specifically to J-containing duplex DNA. J-specific DNA binding was also observed with extracts from the kinetoplastids Crithidia fasciculata and Leishmania tarentolae. We purified the 90 kDa C. fasciculata J-binding protein 50,000-fold and cloned the corresponding gene from C. fasciculata, T. brucei and L. tarentolae. Recombinant proteins expressed in Escherichia coli demonstrated J-specific DNA binding. The J-binding proteins show 43-63% identity and are unlike any known protein. The discovery of a J-binding protein suggests that J, like methylated cytosine in higher eukaryotes, functions via a protein intermediate.

Adenophostin A is the most potent known agonist of D-myo-inositol 1, 4,5-trisphosphate [Ins(1,4,5)P3] receptors. Equilibrium competition binding studies with 3H-Ins(1,4,5)P3 showed that the interaction of a totally synthetic adenophostin A with both hepatic and cerebellar Ins(1,4,5)P3 receptors was indistinguishable from that of the natural product. At pH 8.3, a synthetic analog of adenophostin A (which we named acyclophostin), in which most elements of the ribose ring have been removed, bound with substantially higher affinity (Kd = 2.76 +/- 0.26 nM) than Ins(1,4,5)P3 (Kd = 7.96 +/- 1.02 nM) to the 3H-Ins(1,4,5)P3-binding sites of hepatic membranes. At pH 7, acyclophostin (EC50 = 209 +/- 12 nM) and Ins(1,4,5)P3 (EC50 = 153 +/- 11 nM) stimulated 45Ca++ release to the same maximal extent and from the same intracellular stores of permeabilized hepatocytes. Comparison of the affinities of a range of Ins(1,4,5)P3 and adenophostin analogs with their abilities to stimulate Ca++ release revealed that although all other agonists had similar EC50/Kd ratios, that for acyclophostin was significantly higher. Similar results were obtained with cerebellar membranes, which express almost entirely type 1 InsP3 receptors. When the radioligand binding and functional assays of hepatocytes were performed under identical conditions, the higher EC50/Kd ratio for acyclophostin was retained at pH 8.3, but it was similar to that for Ins(1,4,5)P3 when the assays were performed at pH 7. To directly assess whether acyclophostin was a partial agonist of hepatic Ins(1,4,5)P3 receptors, the kinetics of 45Ca++ efflux from permeabilized hepatocytes was measured with a temporal resolution of 80 ms using rapid superfusion. At pH 7, the kinetics of 45Ca++ release, including the maximal rate of release, evoked by maximal concentrations of acyclophostin or Ins(1,4,5)P3 were indistinguishable. At pH 8.3, however, the maximal rate of 45Ca++ release evoked by a supramaximal concentration of acyclophostin was only 69 +/- 7% of that evoked by Ins(1,4,5)P3. We conclude that acyclophostin is the highest affinity ribose-modified analog of adenophostin so far synthesized, that at high pH it is a partial agonist of inositol trisphosphate receptors, and that it may provide a structure from which to develop high-affinity antagonists of inositol trisphosphate receptors.