Search

Purpose: To discuss problems associated with the implantation of two Morcher iris diaphragm models. Methods: We describe the history, intraoperative complications, and postoperative complications of 5 patients with specific Morcher iris implants. Results: We implanted Morcher 50D devices in 1 patient and Morcher 96S devices in 4 patients. Complications included postoperative rotation, device mis-sizing, difficult intraoperative rotation, zonular dehiscence, and intraoperative hemorrhage. Conclusion: Artificial iris implantation has a steep learning curve. With widespread availability on the horizon in the United States, the sharing of surgical experiences is key to achieving the best outcomes for patients.

Nonsense mutations leading to premature stop codons are common occurring in approximately 12% of all human genetic diseases. Thus, pharmacological nonsense mutation suppression strategies would be beneficial to a large number of patients if the drugs could be targeted to the affected tissues at the appropriate time. Here, we used nonsense suppression to manipulate Pax6 dosage at different developmental times in the eye of the small eye (Pax6Sey/+; G194X) mouse model of aniridia. Efficacy was assessed by functional assays for visual capacity, including electroretinography and optokinetic tracking (OKT), in addition to histological and biochemical studies. Malformation defects in the Pax6Sey/+ postnatal eye responded to topically delivered nonsense suppression in a dose- and time-dependent manner. Elevated levels of Mmp9, a direct downstream target of Pax6 in the cornea, were observed with the different treatment regimens. The lens capsule was particularly sensitive to Pax6 dosage, revealing a potential new role for Pax6 in lens capsule maintenance and development. The remarkable capacity of malformed ocular tissue to respond postnatally to Pax6 dosage in vivo demonstrates that the use of nonsense suppression could be a valuable therapeutic approach for blinding diseases caused by nonsense mutations.

Background: The ITPR1 gene encodes the inositol 1,4,5-trisphosphate (IP 3 ) receptor type 1 (IP 3 R1), a critical player in cerebellar intracellular calcium signaling. Pathogenic missense variants in ITPR1 cause congenital spinocerebellar ataxia type 29 (SCA29), Gillespie syndrome (GLSP), and severe pontine/cerebellar hypoplasia. The pathophysiological basis of the different phenotypes is poorly understood., Objectives: We aimed to identify novel SCA29 and GLSP cases to define core phenotypes, describe the spectrum of missense variation across ITPR1, standardize the ITPR1 variant nomenclature, and investigate disease progression in relation to cerebellar atrophy., Methods: Cases were identified using next-generation sequencing through the Deciphering Developmental Disorders study, the 100,000 Genomes project, and clinical collaborations. ITPR1 alternative splicing in the human cerebellum was investigated by quantitative polymerase chain reaction., Results: We report the largest, multinational case series of 46 patients with 28 unique ITPR1 missense variants. Variants clustered in functional domains of the protein, especially in the N-terminal IP 3 -binding domain, the carbonic anhydrase 8 (CA8)-binding region, and the C-terminal transmembrane channel domain. Variants outside these domains were of questionable clinical significance. Standardized transcript annotation, based on our ITPR1 transcript expression data, greatly facilitated analysis. Genotype-phenotype associations were highly variable. Importantly, while cerebellar atrophy was common, cerebellar volume loss did not correlate with symptom progression., Conclusions: This dataset represents the largest cohort of patients with ITPR1 missense variants, expanding the clinical spectrum of SCA29 and GLSP. Standardized transcript annotation is essential for future reporting. Our findings will aid in diagnostic interpretation in the clinic and guide selection of variants for preclinical studies. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society., (© 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.)

Variants in the inositol 1,4,5-trisphosphate receptor type 1 (ITPR1) gene have been recently identified as a cause of Gillespie's syndrome, a rare inherited condition characterized by bilateral iris hypoplasia, congenital muscle hypotonia, nonprogressive cerebellar ataxia, and intellectual disability. Here, we describe the clinical and genetic findings in a patient who presented with iris hypoplasia, mild gait ataxia, atrophy of the anterior cerebellar vermis but no cognitive deficits. Whole-exome sequencing (WES) uncovered a heterozygous ITPR1 p.Glu2094Lys missense variant, affecting a highly conserved glutamic acid residue for which other amino acid substitutions have already been reported in Gillespie's syndrome patients. Our data expand both the phenotypic and genetic spectrum associated with Gillespie's syndrome and suggest a mutation hotspot on Glu2094. [ABSTRACT FROM AUTHOR]

Objectives: To report the results obtained from glaucoma drainage device (GDD) implantation in patients with aniridia-related glaucoma and to review the literature. Materials and Methods: We retrospectively reviewed 6 patients who underwent GDD implantation for glaucoma secondary to congenital aniridia between April 2001 and February 2015. Data on age at surgery, gender, laterality, surgeries before GDD implantation, GDD model, concomitant ocular disorders, visual acuity, and intraocular pressure (IOP) values before and at 1 and 12 months after GDD implantation, medications, follow-up period, findings during last visit, complications, and course of disease were collected. Results: Mean age at surgery was 16.00±12.31 years (range 5-37 years). Mean IOP was 33.00±12.11 (range 22-50) mmHg just before the GDD implantation with a mean of 3.5±1.2 medications. Mean IOP 1 month after implantation was 16.33±4.22 (range 12-24) mmHg with a mean of 1.5±0.8 medications; at 12 months, mean IOP was 19.50±4.76 (range 15-26) mmHg with 3.0±0.8 medications. At the last follow-up visit, IOP was 21.16±4.07 (range 16-26) mmHg with a mean of 3.33±0.51 medications. Mean follow-up was 19.16±8.8 (range 12-36) months. Surgical success rates were 83.3%, 66.6%, and 50.0% at 1 month, 12 months, and the last visit, respectively. Conclusion: GDD implantation was effective in controlling aniridic glaucoma with a success rate of 83.3% at 1-month follow-up and 66.6% at 1- year follow-up. Therefore, it should be considered as an initial surgical treatment for aniridic glaucoma; the clinician should be alert for concomitant ocular disorders. [ABSTRACT FROM AUTHOR]

Congenital nystagmus (CN) is a heterogeneous disease that shows variable clinical features. There are a few mutations that are known to cause CN. Among them, a PAX6 mutation is known to cause CN with an extremely high frequency of aniridia. Here, we report on a family with an autosomal dominant PAX6 mutation, c.214G > A (p.Gly72Ser.), who presented with CN in the absence of aniridia. This study describes detailed clinical findings, including videonystagmography and fundus photography findings and emphasizes the importance of screening for the PAX6 gene in patients who present with CN in the absence of aniridia, as this will further elucidate the known phenotypes of PAX6-related diseases. [ABSTRACT FROM AUTHOR]

Purpose. The aims of this study were to examine novel mutations in PITX2 and FOXC1 in Chinese patients with anterior segment dysgenesis (ASD) and to compare the clinical presentations of these mutations with previously reported associated phenotypes. Methods. Twenty-six unrelated patients with different forms of ASD were enrolled from our paediatric and genetic eye clinic. The ocular manifestations of both eyes of each patient were recorded. Genomic DNA was prepared from venous leukocytes. All coding exons of PITX2 and FOXC1 were amplified by polymerase chain reaction (PCR) from genomic DNA and subjected to direct DNA sequencing. Analysis of mutations in control subjects was performed by heteroduplex single-strand conformation polymorphism (SSCP) analysis. Results. Sequence analysis of the PITX2 gene revealed four mutations, including c.475_476delCT (P.L159VfsX39), c.64C > T (P.Q22X), c.296delG (P.R99PfsX56), and c.206G > A (P.R69H). The first three mutations were found to be novel. The c.475_476delCT (P.L159VfsX39) mutation, located at the 3′ end of the PITX2-coding region, was identified in a Chinese Axenfeld-Rieger syndrome (ARS) patient who presented with an unusual severe phenotype of bilateral aniridia. The clinical characteristics, including the severity and manifestations of the patient's phenotype, were compared with reported PITX2-associated aniridia phenotypes of ARS in the literature. Conclusions. These results expand the mutation spectrum of the PITX2 gene in patients with ARS. The PITX2 gene may be responsible for a significant portion of ARS with additional systemic defects in the Chinese population. This is the first reported case of a mutation at the 3′ end of the PITX2-coding region extending the phenotypic consequences to bilateral aniridia. The traits of ARS could display tremendous variability in severity and manifestations due to the dominant-negative effect of PITX2. Our results further emphasize the importance of careful clinical and genetic analysis in determining mutation-disease associations and may lead to a better understanding of the role of PITX2 in ocular development. [ABSTRACT FROM AUTHOR]

Purpose: Congenital aniridia is a kind of panocular disorder characterized by the absence of the iris in both eyes. Paired box 6 (PAX6) gene mutations have been identified as the most common cause of congenital aniridia. The aim of this study was to reveal the genetic defect in PAX6 in a Chinese family with congenital aniridia. Methods: Twelve individuals from a three-generation Chinese family were recruited. All the family members underwent comprehensive ophthalmologic examinations. The entire coding region of PAX6 was amplified by polymerase chain reaction, followed by direct Sanger sequencing. Possible structural and functional changes of protein were predicted by bioinformatic analysis using SIFT and Polyohen-2. Results: Among all the 12 members, four were clinically diagnosed with congenital aniridia. A novel heterozygous mutation c.275G>A (p.R92Q) in exon 6 of PAX6 was identified in all the patients, but not in the unaffected individuals or 1186 healthy subjects. This missense mutation is a G-A transition, converting Arginine (R) to Glutamine (Q) at amino acid 92. The substitution of amino acid in the PAX6 protein changed the local charge density and was predicted to damage the normal protein function. Conclusions: Our study identified a novel mutation of PAX6 responsible for congenital aniridia in a Chinese family, which may contribute to understanding the molecular basis and clinical diagnosis of congenital aniridia. [ABSTRACT FROM AUTHOR]

Copyright of Der Ophthalmologe is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6. Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression. Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD). Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. [ABSTRACT FROM AUTHOR]

Aims: Analyze cosegregation of aniridia and diabetes to identify genetic criteria for detection and early treatment of diabetes-susceptible aniridia patients.Methods: We assessed a two-generation family: three individuals with aniridia, two previously diagnosed as type 2 diabetes. One individual with aniridia, with unknown diabetes status, was evaluated by oral glucose tolerance test. Genetic analysis of aniridia-associated genes was performed on all available family members. Candidate genes were functionally tested by gene silencing in MIN6 pancreatic β-cells.Results: A 25 year old male with aniridia had a diabetic oral glucose tolerance test despite a normal fasting blood glucose. A 484-630 kb deletion ∼120 kb distal to PAIRED BOX 6 (PAX6) showed dominant cosegregation with aniridia and diabetes in all affected family members. The deleted region contains regulatory elements for PAX6 expression and four additional coding regions. Knockdown of two of the deleted genes (Dnajc24 or Immp1l) with Pax6 impaired glucose-stimulated insulin secretion.Conclusions: We demonstrate dominant cosegregation of diabetes and aniridia with a deletion distal to PAX6, which is clinically distinct from the mild glucose intolerance previously reported with PAX6 coding mutations. Asymptomatic aniridia individuals appear at risk of diabetes (and its complications) and could benefit from earlier diagnosis and treatment. [ABSTRACT FROM AUTHOR]

Abstract PAX6-related Aniridia is a sight-threatening disease involving progression of secondary glaucoma and aniridia related keratopathy (ARK). Change or loss of limbal epithelial progenitors causes epithelial surface defects. We analyzed the effect of PAX6 on mRNA expression changes with a two-step approach, as follows. First, we sequenced mRNA from limbal epithelial cells isolated from controls and aniridia patients. Second, we confirmed the bioinformatics and literature-based result list for a small interfering RNA (siRNA)-based primary aniridia cell model (PAX6 knockdown). With this approach, we expected that the genes directly influenced by PAX6 would be distinguishable from those affected secondarily by the ARK disease state. Therefore, epithelial cells were isolated from the limbus region of two patients with aniridia and cultured in keratinocyte serum-free medium. Normal control cells were obtained from the limbus region of corneal donors. For the siRNA-based aniridia cell model, cells were transfected with Lipofectamine and 5 nM siRNA against PAX6 or control treatment. All cells were lysed to yield DNA, RNA, and protein. Reduction of PAX6 protein was assessed by western blot. Aniridia and control Poly-A–enriched RNA libraries were subjected to next-generation sequencing. The differential analysis was a combination of quantification with RSEM and differential tests with edgeR. Gene lists were filtered by comparison to NCBI GEO datasets, annotated with DAVID, and manually annotated using a literature search. Based on the resulting filtered gene list, qPCR primers were purchased, and candidate genes (TP63 , ABCG2 , ADH7 , ALDH1A1 , PITX1 , DKK1 , DSG1 , KRT12 , KRT3 , KRT13 , SPINK6 , SPINK7 , CTSV , SERPINB1) were verified by qPCR on the siRNA-based aniridia cell model. We identified genes that might be regulated by PAX6 and showed that SPINK7 mRNA, which codes for a protease inhibitor, is downregulated in patients as well as in our primary aniridia cell model. ALDH1A1 and AHD7 mRNA levels were reduced in limbal epithelial cells of aniridia patients, and both transcripts were downregulated by PAX6 knockdown in our cell model. This siRNA-based aniridia cell model is a valuable tool for confirming identified PAX6-affected genes that might promote ARK pathogenesis. The model recapitulated expression changes for SPINK7 , ADH7 , and ALDH1A1 that were also observed in patient samples. These results provide evidence that PAX6 might drive corneal epithelial differentiation by direct or indirect control of retinoic acid signaling processes through ADH7 and ALDH1A1. Highlights • PAX6 has an important influence on the differentiation process of limbal epithelial (stem) cells. • PAX6 siRNA model recapitulates differentiation defects of aniridia limbal epithelial cells. • Retinoic acid signaling components are potentially PAX6 related. • SPINK protease inhibitors are downregulated in aniridia limbal epithelial cells. [ABSTRACT FROM AUTHOR]

Purpose: To correlate the features of certain types of infantile glaucoma with the progression and the prognosis of the disease, highlighting probable risk factors.Methods: Seventy-six patients with pediatric glaucoma were recruited in this retrospective study. All patients underwent ophthalmological examination in the Department of Ophthalmology of the Saarland University Medical Center from January 2001 to December 2012. Our pediatric patients were classified into four different categories of glaucoma: (1) primary congenital glaucoma (presenting buphthalmus), (2) aniridia-related glaucoma, (3) Peters/Rieger's anomaly-related glaucoma and (4) congenital cataract-related glaucoma. Personal data comprised age, sex, nationality, systemic diseases and gestational age. The best-corrected visual acuity (BCVA), the cup-disk ratio (CDR), the intraocular pressure (IOP), the corneal diameter and thickness, along with the Haab striae and corneal haze, were recorded.Results: The majority of the children were male (58%) and suffered from aniridia-related glaucoma (38%). Children with aniridia exhibited the worst BCVA. The CDR and IOP were significantly higher in children with primary congenital glaucoma, compared to the other groups, at the first visit. Those children also were with the largest corneal diameter and prevalence of Haab striae compared to the rest groups, whereas corneal haze was found more often and was more pronounced in children with Peters/Rieger's syndrome.Conclusions: We concluded that glaucoma was earlier detected in children with primary congenital glaucoma, who exhibited increased corneal diameter and high percentage of Haab striae comparing to the other groups. However, these children responded successfully to any therapeutic intervention, exhibiting better BCVA and IOP values than the rest groups at the second visit. [ABSTRACT FROM AUTHOR]

Congenital aniridia is a rare and severe panocular disease characterized by a complete or partial iris defect clinically detectable at birth. The most common form of aniridia occurring in around 90% of cases is caused by PAX6 haploinsufficiency. The phenotype includes ptosis, nystagmus, corneal limbal insufficiency, glaucoma, cataract, optic nerve, and foveal hypoplasia. Ataluren eye drops aim to restore ocular surface PAX6 haploinsufficiency in aniridia-related keratopathy (ARK). However, there are currently no available forms of the ophthalmic solution. The objective of this study was to assess the physicochemical and microbiological stability of ataluren 1% eye drop in preservative-free low-density polyethylene (LDPE) bottle with an innovative insert that maintains sterility after opening. Because ataluren is a strongly lipophilic compound, the formulation is complex and involves a strategy based on co-solvents in an aqueous phase or an oily formulation capable of totally dissolving the active ingredient. The visual aspect, ataluren quantification by a stability-indicating chromatographic method, and microbiological sterility were analyzed. The oily formulation in castor oil and DMSO (10%) better protects ataluren hydrolysis and oxidative degradation and permits its complete solubilization. Throughout the 60 days period, the oily solution in the LDPE bottle remained clear without any precipitation or color modification, and no drug loss and no microbial development were detected. The demonstrated physical and microbiological stability of ataluren 1% eye drop formulation at 22–25 °C might facilitate clinical research in aniridia.

Actuality. Glaucoma is an expected complication of many congenital eyeball malformations, such as aniridia, microcornea, consequence of mesenchymal dysgenesis with the formation of Frank — Kamenetz or Rieger syndromes, on the background of postoperative aphakia or after implantation of the «artificial iris — IOL» complex in children with congenital aniridia. Antihypertensive drug therapy gives only a partial effect in these cases, but excessive post-operative scarring nullifies results of fistulizing surgery even with antimetabolites and requires, as a rule, of numerous surgical procedures with transient hypotensive effect and following inexorable decrease of visual function.Purpose. To assess the level and duration of the hypotensive effect and nature of the complications of Ahmed valve system implantation with various forms of glaucoma in children.Patients and methods. Retrospective analysis of the effectiveness of implanted Ahmed valve system in 22 children (27 eyes) from 2008 to 2014 was made. 17 of them had previous antiglaucomatous surgery, such as trabeculectomy, cryo- and laser destruction of ciliary body. In 4 patients with congenital aniridia after implantation of the complex «artificial iris — IOL» and in one patient with postoperative aphakia the drainage surgery was the primary intervention and performed on both eyes.Results. As a result of Ahmed valve implantation in 25 cases the IOP compensation was achieved within 15‑17 mmHg by Maklakov, 23 — without additional medication. In 6 % of cases, the formation of fibrous capsule around the base of the drainage was the indication for needling, which was accompanied by a successful activation of the drainage system. In one case, the epithelial ingrowth with occlusion of the capillary was observed in the course of the wound channel, it required the implantation of a second drainage in free quadrant of the eyeball. Reduced visual function after surgery was observed in only one patient as a result of hemorrhagic choroidal detachment, the cause of it can bea post-operative hypotension and absence of forming structures on the background of aphakia and avitria.Conclusion. Thus, the implantation of the Ahmed valve drainage is sufficiently safe and effective method of surgical treatment of glaucoma in children and can be recommended as the operation of choice in such forms as secondary aphakic glaucoma and glaucoma in children with aniridia after implantation of the «artificial iris — IOL complex».

Purpose. Analysis of our experience in optical-reconstructive microsurgery with implantation of an artificial iris-lens diaphragm (ILD) «Reper-NN» in case of aniridia.Material and methods. The clinical analysis of efficiency and technical difficulties of ILD implantation was carried out in 17 eyes with congenital (5 eyes) and post-traumatic (12 eyes) aniridia. The follow-up: 1.5 years.Results. The main complexity of ILD implantation was caused by its larger sizes, and also a monolithic design. All operations passed according to the plan, intra-operative complications managed to be avoided in all cases. One year later the ILD localization was correct, stable, without decentration signs in all eyes. The level of intra-ocular pressure was normal. The photophobia disappeared, the visual acuity improved in 11 eyes.Conclusions. It is necessary to create flexible ILD designs for the implantation through microincisions (2.2-2.5mm), to modernize options of its sizes and haptics. It will allow to minimize both a surgical trauma, and a risk of various complications.

Mutations in PAX6 are involved in several developmental eye disorders. These disorders have considerable phenotypic variability, ranging from panocular forms of congenital aniridia and microphthalmia to isolated anomalies of the anterior or posterior segment. Here, we describe 3 families with variable inter-generational ocular expression of aniridia, iris coloboma, or microphthalmia, and an unusual transmission of PAX6 mutations from an unaffected or mildly affected parent; all of which raised suspicion of gonosomal mosaicism. We first identified two previously known nonsense mutations and one novel likely pathogenic missense variant in PAX6 in probands by means of targeted NGS. The subsequent segregation analysis by Sanger sequencing evidenced the presence of highly probable mosaic events in paternal blood samples. Mosaicism was further confirmed by droplet digital PCR analysis in several somatic tissues of mosaic fathers. Quantification of the mutant allele fraction in parental samples showed a marked deviation from 50%, with a range between 12 and 29% depending on cell type. Gonosomal mosaicsm was definitively confirmed in one of the families thanks to the availability of a sperm sample from the mosaic father. Thus, the recurrence risk in this family was estimated to be about one-third. This is the first report confirming parental PAX6 mosaicism as a cause of disease recurrence in aniridia and other related phenotypes. In addition, we demonstrated that post-zygotic mosaicism is a frequent and underestimated pathogenic mechanism in aniridia, explaining intra-familial phenotypic variability in many cases. Our findings may have substantial implications for genetic counseling in congenital aniridia. Thus, we also highlight the importance of comprehensive genetic screening of parents for new sporadic cases with aniridia or related developmental eye disease to more accurately assess recurrence risk. In conclusion, somatic and/or gonosomal mosaicism should be taken into consideration as a genetic factor to explain not only families with unaffected parents despite multiple affected children but also variable expressivity, apparent de novo cases, and even uncharacterized cases of aniridia and related developmental eye disorders, apparently lacking PAX6 mutations.