Search

The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.

Cucumber mosaic virus (CMV; Cucumovirus, Bromoviridae ) is an omnipresent virus characterized by a large host range and high genetic variability. Using high-throughput sequencing, we have characterized near complete genomes of 14 Slovak CMV variants from different plant hosts. Of these, three variants originated from the Papaveraceae species (oilseed poppy, common poppy and great celandine), previously poorly described as CMV natural hosts. Based on a BLAST search and phylogenetic analysis, the Slovak CMV isolates can be divided into two genetically different Groups, Ia and II, respectively. The SL50V variant, characterized by a divergent RNA2 sequence, potentially represents a reassortant variant. In four samples (T101, SL50V, CP2, MVU2-21), the presence of satellite CMV RNA was identified along with CMV. Although mechanically transmitted to experimental cucumber plants, the role of satellite RNA in the symptomatology observed could not be established due to a complex infection of original hosts with different viruses.

In this work, we present a ballistocardiographic (BCG) system for the determination of heart and breath rates and activity of a user lying in bed. Our primary goal was to simplify the analog and digital processing usually required in these kinds of systems while retaining high performance. A novel sensing approach is proposed consisting of a white LED facing a digital light detector. This detector provides precise measurements of the variations of the light intensity of the incident light due to the vibrations of the bed produced by the subject's breathing, heartbeat, or activity. Four small springs, acting as a bandpass filter, connect the boards where the LED and the detector are mounted. Owing to the mechanical bandpass filtering caused by the compressed springs, the proposed system generates a BCG signal that reflects the main frequencies of the heartbeat, breathing, and movement of the lying subject. Without requiring any analog signal processing, this device continuously transmits the measurements to a microcontroller through a two-wire communication protocol, where they are processed to provide an estimation of the parameters of interest in configurable time intervals. The final information of interest is wirelessly sent to the user's smartphone by means of a Bluetooth connection. For evaluation purposes, the proposed system has been compared with typical BCG systems showing excellent performance for different subject positions. Moreover, applied postprocessing methods have shown good behavior for information separation from a single-channel signal. Therefore, the determination of the heart rate, breathing rate, and activity of the patient is achieved through a highly simplified signal processing without any need for analog signal conditioning.

The use of high throughput sequencing (HTS) for the analysis of Spanish olive trees showing leaf yellowing discoloration, defoliation, and/or decline has provided new insights into the olive viruses present in Spain and has opened discussions about the pros and cons of these technologies for diagnostic purposes. In this study, we report for the first time in Spanish orchards the presence of olive leaf yellowing-associated virus (OLYaV), for which the second full coding sequence has been determined. This virus has also been detected in a putative vector, the psyllid Euphyllura olivina . In addition, the presence in Spain of Olea europaea geminivirus (OEGV), recently reported in Italy, has been confirmed, and the full-length sequence of two isolates was obtained by HTS and Sanger sequencing. These results, as well as the detection of other viral sequences related to olive latent virus 3 (OLV-3) and olive viral satellite RNA, raises questions on the biological significance of the findings, about the requirement of standardization on the interpretation of HTS results, and the necessity of additional tests to confirm the relevance of the HTS detection of viral sequences.

Loquat ( Eriobotrya japonica ) is an important crop in Spain. To date, only one viral species, apple stem pitting virus (ASPV), has been detected in Spanish loquat orchards. In this study, the presence of additional viruses infecting this crop in Spain was investigated. RT-PCR and high-throughput sequencing (HTS) of symptomatic loquat plants led to first-time detection and characterization of apple stem grooving virus (ASGV), also known as citrus tatter leaf virus (CTLV), and apple chlorotic leaf spot virus (ACLSV) from Spain with description of nearly complete genomic sequences. The frequency of ACLSV infection was the highest, with over 30% of the samples testing positive and were also detected as coinfections with ASGV and ASPV, although most of the samples infected were symptomless. Studies on all the full-length sequences available in the databases were performed in order to establish the phylogenetic relationships of the Spanish isolates of these two viral species. Moreover, apple hammerhead viroid (AHVd) was also detected to infect loquat, the first host different from apple reported for this viroid to date.

Background: The present study seeks to evaluate the change in mental health inequalities in the department of Meta after the signing of Colombia's Peace Agreement in 2016 with the FARC guerrilla group. Using a validated survey instrument composed of 20 questions ('SRQ-20'), we measure changes in mental health inequalities from 2014, before the signing of the agreement, to 2018, after the signing. We then decompose the changes in inequalities to establish which socioeconomic factors explain differences in mental health inequalities over time., Methods: Our study uses information from the Conflicto, Salud y Paz (CONPAS) survey conducted in the department of Meta, Colombia, in 1309 households in 2018, with retrospective information for 2014. To measure inequalities, we calculate the concentration indices for both years. Through the Oaxaca change decomposition method, we disaggregate changes in mental health inequalities into its underlying factors. This method allows us to explain the relationship between changes in mental health inequalities and changes in inequalities in several sociodemographic factors. It also identifies the extent to which these factors help explain the changes in mental health inequalities., Results: Mental health inequalities in Meta were reduced almost by half from 2014 to 2018. In 2018, the population at the lower and middle socioeconomic levels had fewer chances of experiencing mental health disorders in comparison to 2014. The reduction in mental health differences is mostly attributed to reductions in the influence of certain sociodemographic variables, such as residence in rural zones and conflict-affected territories, working in the informal sector, or experiencing internal displacement. However, even though mental health inequalities have diminished, overall mental health outcomes have worsened in these years., Conclusions: The reduction in the contribution of conflict-related variables for explaining mental health inequalities could mean that the negative consequences of conflict on mental health have started to diminish in the short run after the peace agreement. Nevertheless, conflict and the presence of other socioeconomic inequalities still contribute to persistent adverse mental health outcomes in the overall population. Thus, public policy should be oriented towards improving mental health care services in these territories, given the post-accord context.

Loquat ( Eriobotrya japonica ) is a minor but important woody crop cultivated in Asia and Europe. High-throughput sequencing (HTS) analysis of an asymptomatic loquat plant using RNAseq Illumina technology has allowed the detection for the first time of apple stem pitting virus (ASPV), the type species of the genus Foveavirus in the family Betaflexiviridae , infecting this crop. A nearly complete genome of 9303 nts (ASPV-SL61) reconstructed bioinformatically shows the typical genomic structure of this viral species and a highest nucleotide identity (85.9%) with the Chinese ASPV isolate YLX from pear. A close phylogenetic relationship between ASPV-SL61 and ASPV-YLX has been confirmed by the sequence analysis of full-length ASPV genomic sequences available in the databases. In fact, a phylogenetic study based on a partial CP N-terminal sequence previously proposed to be involved in host adaptation has shown that ASPV-SL61 loquat isolate is more closely related to ASPV pear isolates. The presence of ASPV in loquat has been further confirmed by RT-PCR and Sanger sequencing and DAS-ELISA. An incidence of 15% was determined in one of the loquat Spanish growing areas. The sequence analysis of the partial CP sequences amplified by RT-PCR has shown a high level of variability between loquat isolates. To our knowledge, this is the first record of loquat as a natural host of ASPV.

Genome organization and phylogenetic relationships of olive leaf yellowing-associated virus (OLYaV) with other members of the Closteroviridae family were determined. The complete coding sequence of OLYaV was obtained by high throughput sequencing of total RNA from a 35-year-old olive tree (cv. Zarzaleña) from Brazil, showing olive leaf yellowing disease and deformations in the wood. This represents the first report of OLYaV in this country. A genomic sequence of 16,700 nt containing 11 open reading frames (ORFs) was recovered, representing the complete virus coding capacity. The knowledge of the nucleotide sequence of the genome including the gene that codes the coat protein will facilitate the development of diagnostic tests, which are limited so far to PCR-based methods targeting the HSP70h gene. Interestingly, a thaumatin-like protein (ORF2), previously reported in other unassigned viruses in the Closteroviridae family, persimmon virus B and actidinia virus 1, was identified in the OLYaV genome. Phylogenetic analysis of shared proteins (ORF1a, ORF1b, HSP70h, HSP90h and CP) with all members of the Closteroviridae family provides new insight into the taxonomic position of these three closteroviruses and suggests they could represent a new genus in the family.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Grapevine Roditis leaf discoloration-associated virus (GRLDaV) is an emerging grapevine pathogen included in the European and Mediterranean Plant Protection Organization (EPPO) alert list due to its ability to damage grapevine crops and cause production losses. This work aimed to develop a specific and reliable diagnostic tool that would contribute to preventing the spread of this pathogen. Therefore, a TaqMan real-time quantitative PCR was developed. The method was validated according to EPPO guidelines showing a high degree of analytical sensitivity, analytical specificity, selectivity, and repeatability and reproducibility. The sensitivity of this method is much higher than the sensitivity reached by previously reported methods even when tested in crude extracts, which could allow rapid testing by avoiding nucleic acid extraction steps. The method was also able to detect GRLDaV isolates from all the geographic origins reported so far, despite their high degree of genetic diversity. In addition, this new technique has been successfully applied for the quantitative detection of GRLDaV in plant material and two mealybug species, Planococcus citri and Pseudococcus viburni . In conclusion, the methodology developed herein represents a significant contribution to the diagnosis and control of this emerging pathogen in grapevine.

In this work, a freshness colorimetric sensor has been integrated with pork meat packages. The sensor tracks rising CO 2 levels in the package associated with meat spoilage, as CO 2 levels increase with bacterial population. The color of the sensor changes depending on the quantity of bacteria present, therefore it can be correlated with the freshness of meat, in this case pork loin. Detection is achieved by a simple photograph using a smartphone, and analyzing the grey scale from the RGB space color with a custom made app. Only 2 μL of the cocktail (all components are nontoxic) is needed to prepare the sensor, which have been integrated inside meat packages using a variety of support materials prior to sealing. The Smartphone measurements have been validated using a reference method (Checkpoint Analyzer) and the results suggest it can provide the basis for a quick test of the quality of the packaged pork., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2020 Elsevier B.V. All rights reserved.)

A versatile, compact and low-cost analytical platform has been designed, tested and validated to be used in the point-of-care settings. This passive measurement system is powered and complemented by a standard smartphone including a programmed application for measurement configuration and data processing as well as wireless results sharing. Electrochemical and electrochemiluminescence analytical techniques can be configured and realized by this platform that employs standard screen-printed electrodes for the sample managing and off-the-shelf electronic components. The power, electrical and optical signal processing have been studied in depth. The system can harvest energy up to 22.5 mW, set up a voltage in the range of ±1.15 V, and measure potentials in a range of 600 mV with an uncertainty of 1 mV, and current from 2 μA to 0.75 mA with a resolution of 1.1 μA. Moreover, standard tests have been performed to the platform consisting of amperometric, potentiometric, cyclic voltammetry and electrochemiluminescent analytical techniques, showing excellent agreement with a reference instrument. Finally, our design has also been applied to glucose, pH and H 2 O 2 determinations, providing the full analytical parameters which are in very good agreement with the reference instrument results. Ranges (0.065-0.75 M, 0.62-100 mM and 3-9 pH units for glucose, H 2 O 2 and pH, respectively) and limits of detection (0.024 M and 0.03 mM for glucose and H 2 O 2 , respectively) make this low-cost platform (

Recent developments in high-throughput sequencing (HTS), also called next-generation sequencing (NGS), technologies and bioinformatics have drastically changed research on viral pathogens and spurred growing interest in the field of virus diagnostics. However, the reliability of HTS-based virus detection protocols must be evaluated before adopting them for diagnostics. Many different bioinformatics algorithms aimed at detecting viruses in HTS data have been reported but little attention has been paid thus far to their sensitivity and reliability for diagnostic purposes. Therefore, we compared the ability of 21 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 12 plant viruses through a double-blind large-scale performance test using 10 datasets of 21- to 24-nucleotide small RNA (sRNA) sequences from three different infected plants. The sensitivity of virus detection ranged between 35 and 100% among participants, with a marked negative effect when sequence depth decreased. The false-positive detection rate was very low and mainly related to the identification of host genome-integrated viral sequences or misinterpretation of the results. Reproducibility was high (91.6%). This work revealed the key influence of bioinformatics strategies for the sensitive detection of viruses in HTS sRNA datasets and, more specifically (i) the difficulty in detecting viral agents when they are novel or their sRNA abundance is low, (ii) the influence of key parameters at both assembly and annotation steps, (iii) the importance of completeness of reference sequence databases, and (iv) the significant level of scientific expertise needed when interpreting pipeline results. Overall, this work underlines key parameters and proposes recommendations for reliable sRNA-based detection of known and unknown viruses.

High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis.

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

A portable reconfigurable platform for copper (Cu(II)) determination based on luminescent carbon dot (Cdots) quenching is described. The electronic setup consists of a light-emitting diode (LED) as the carbon dot optical exciter and a photodiode as a light-to-current converter integrated in the same instrument. Moreover, the overall analog conditioning is simply performed with one integrated solution, a field-programmable analog array (FPAA), which makes it possible to reconfigure the filter and gain stages in real time. This feature provides adaptability to use the platform as an analytical probe for carbon dots coming from different batches with some variations in luminescence characteristics. The calibration functions obtained that fit a modified Stern-Volmer equation were obtained using luminescence signals from Cdots quenching by Cu(II). The analytical applicability of the reconfigurable portable instrument for Cu(II) using Cdots has been successfully demonstrated in tap water analysis.

Chemical analysis based on colour changes recorded with imaging devices is gaining increasing interest. This is due to its several significant advantages, such as simplicity of use, and the fact that it is easily combinable with portable and widely distributed imaging devices, resulting in friendly analytical procedures in many areas that demand out-of-lab applications for in situ and real-time monitoring. This tutorial review covers computer vision-based analytical (CVAC) procedures and systems from 2005 to 2015, a period of time when 87.5% of the papers on this topic were published. The background regarding colour spaces and recent analytical system architectures of interest in analytical chemistry is presented in the form of a tutorial. Moreover, issues regarding images, such as the influence of illuminants, and the most relevant techniques for processing and analysing digital images are addressed. Some of the most relevant applications are then detailed, highlighting their main characteristics. Finally, our opinion about future perspectives is discussed., (Copyright © 2015 Elsevier B.V. All rights reserved.)

Grapevine Syrah virus-1 (GSyV-1) was identified by small-RNA deep sequencing in Slovak grapevine co-infected by several other viruses. The RT-PCR assays developed in this work substantially improved the virus detection and allowed the identification of GSyV-1 in tested grapevine samples from Slovakia and the Czech Republic at an unexpectedly high rate (ca. 30 %). Subsequently, complete genome sequences of 3 GSyV-1 isolates (2 Slovak and 1 Czech) were determined by Sanger sequencing, showing a typical marafivirus genome organization. Analyses of complete genome sequences showed a higher intra-group diversity among these 3 central European GSyV-1 isolates (differences reaching 7.1 % at the nucleotide level) in comparison to 3 previously characterized North American isolates (only 1.2 % intra-group divergence). A substantially higher divergence among central European isolates and their clustering into two major phylogenetic groups was further confirmed by the partial genome analysis of additional 26 isolates. The CP-centered study did not support the geography-based clustering among central European and American isolates. Nevertheless, the sequence data of the highly variable 5'-proximal portion of the genome obtained for few additional isolates from Slovakia and Czech Republic showed the presence of both, "European-" and "north American-like", GSyV-1 isolates in the analyzed grapevine samples.

Roditis leaf discoloration (RLD), a graft-transmissible disease of grapevine, was first reported in Greece in the 1980s. Even though various native grapevine viruses were identified in the affected vines, the etiology of the disease remained unknown. In the present study, we used an NGS platform for sequencing siRNAs from a twenty-year old Roditis vine showing typical RLD symptoms. Analysis of the NGS data revealed the presence of various known grapevine viruses and viroids as well as a hitherto uncharacterized DNA virus. The circular genome of the new virus was fully reassembled. It is 6988 nts long and includes 4 open reading frames (ORFs). ORF1, ORF2 and ORF4 code for proteins with unknown functions while ORF3 encodes a polyprotein with motifs related to the replication, encapsidation and movement of the virus. Phylogenetic analysis classified the novel virus within the genus Badnavirus, with closest relationship to Fig badnavirus 1. Further studies showed that the new badnavirus is closely related with the RLD disease and the provisional name grapevine Roditis leaf discoloration-associated virus (GRLDaV) is proposed. Our findings extend the number of DNA viruses identified in grapevine, further drawing attention to the potential importance of this virus group on grapevine pathology., (Copyright © 2015 Elsevier B.V. All rights reserved.)

A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys., (Copyright © 2014 Elsevier B.V. All rights reserved.)

The ability to provide a fast, inexpensive and reliable diagnostic for any given viral infection is a key parameter in efforts to fight and control these ubiquitous pathogens. The recent developments of high-throughput sequencing (also called Next Generation Sequencing - NGS) technologies and bioinformatics have drastically changed the research on viral pathogens. It is now raising a growing interest for virus diagnostics. This review provides a snapshot vision on the current use and impact of high throughput sequencing approaches in plant virus characterization. More specifically, this review highlights the potential of these new technologies and their interplay with current protocols in the future of molecular diagnostic of plant viruses. The current limitations that will need to be addressed for a wider adoption of high-throughput sequencing in plant virus diagnostics are thoroughly discussed., (Copyright © 2014 Elsevier B.V. All rights reserved.)

Analysis of complete genome sequences of three Slovak isolates of grapevine Pinot gris virus (GPGV) showed their low heterogeneity (reaching 1.7 %) and a close relationship to the Italian NC_015782 isolate (4.2-4.5 % divergence). Comparison of Slovak and Italian isolates revealed an unusual accumulation of 21 indel mutations in ORF1, resulting in a localized high divergence in the encoded amino acid sequences. An elevated divergence in the 5' extremity of the GPGV genomes is suggestive of a recombination between Slovak isolates and grapevine berry inner necrosis virus. RT-PCR allowed the frequent detection of closely related GPGV isolates in grapevines from Slovakia and the Czech Republic.

Direct systems to process plant materials allowed high-throughput testing of Plum pox virus (PPV) by real-time reverse transcription (RT)-PCR without nucleic acids purification. Crude plant extracts were diluted in buffer or spotted on membranes to be used as templates. Alternatively, immobilized PPV targets were amplified from fresh sections of plant tissues printed or squashed onto the same supports, without extract preparation. Spot real-time RT-PCR was validated as a PPV diagnostic method in samples collected during the dormancy period and showed high sensitivity (93.6%), specificity (98.0%), and post-test probability (97.9%) towards sharka disease. In an analysis of 2919 Prunus samples by spot real-time RT-PCR and DASI-ELISA 90.8% of the results coincided, demonstrating high agreement (k = 0.77 +/- 0.01) between the two techniques. These results validate the use of immobilized PPV targets and spot real-time RT-PCR as screening method for largescale analyses.

Plant pathogenic bacteria, phytoplasmas, viruses and viroids are difficult to control, and preventive measures are essential to minimize the losses they cause each year in different crops. In this context, rapid and accurate methods for detection and diagnosis of these plant pathogens are required to apply treatments, undertake agronomic measures or proceed with eradication practices, particularly for quarantine pathogens. In recent years, there has been an exponential increase in the number of protocols based on nucleic-acid tools being those based on PCR or RT-PCR now routinely applied worldwide. Nucleic acid extraction is still necessary in many cases and in practice inhibition problems are decreasing the theoretical sensitivity of molecular detection. For these reasons, integrated protocols that include the use of molecular techniques as screening methods, followed by confirmation by other techniques supported by different biological principles are advisable. Overall, molecular techniques based on different types of PCR amplification and very especially on real-time PCR are leading to high throughput, faster and more accurate detection methods for the most severe plant pathogens, with important benefits for agriculture. Other technologies, such as isothermal amplification, microarrays, etc. have great potential, but their practical development in plant pathology is still underway. Despite these advances, there are some unsolved problems concerning the detection of many plant pathogens due to their low titre in the plants, their uneven distribution, the existence of latent infections and the lack of validated sampling protocols. Research based on genomic advances and innovative detection methods as well as better knowledge of the pathogens' lifecycle, will facilitate their early and accurate detection, thus improving the sanitary status of cultivated plants in the near future.

A TaqMan real-time RT-PCR was developed to detect and quantify RNA-targets from the non-circulative, non-persistently transmitted Plum pox virus (PPV) in individual fresh or aphids captured previously and squashed on paper. Reliable quantitation ranged from 40 up to 4 x 10(8) copies of control transcripts. This technique was applied successfully to plant material and to individual PPV vector (Myzus persicae) and non-vector of PPV (Aphis nerii) aphid species demonstrating acquisition of viral targets by both vector and non-vector aphids. The number of viruliferous aphids detected by real-time RT-PCR and nested RT-PCR in a single closed tube was similar in parallel assays, nevertheless the sensitivity provided by real-time RT-PCR was 100 times higher than nested RT-PCR and 1000 times higher than DASI-ELISA and conventional RT-PCR. The quantities of PPV-RNA targets detected in a single aphid ranged from 40 to more than 2 x 10(3) units. The combined system (immobilization of targets on paper by squash capture and real-time RT-PCR) allows, for the first time, reliable quantitation of PPV targets acquired by individual aphid species and constitute an excellent tool for understanding better PPV epidemiology.

The aim of this study was to compare the results of radionuclide bone scans of the jaws with data obtained at the nuclear medicine department from a brief and feasible dental history, taking special account of cases with a positive scan and no recent dental events. Ninety-eight patients undergoing radionuclide bone scan as part of their diagnosis in non-dental, oncological and non-oncological diseases were imaged with 99mTc-labelled oxidronate. Superior and inferior halves of the mandible and maxilla (392 quadrants) were regarded as normal or having an abnormally high uptake. A recent (1 year) dental history was also obtained through a brief questionnaire and data were referred to each quadrant of the jaws. The association between the bone scan and dental disease was assessed by means of the chi-squared test. The overall results of scintigraphy and history coincided in 66 patients (46 with abnormal and 20 with normal findings; P = 0.002). Twenty-five patients had a positive scintigram without any known dental disorder. Results of scintigraphy and history coincided in 254 quadrants (78 with abnormal and 176 with normal findings; P < 0.001). Eighty-three quadrants had hot spots in the scintigram without any known dental lesion. It can be concluded that abnormal jaw scintigrams are frequent in patients without known dental disease, and this may indicate silent osteoblastic activity. These observations should be reported to the dentist for several reasons. First, they may reveal asymptomatic dental lesions. Second, the use of oral prostheses and implants is increasing and they require the support of healthy alveolar bone.

Detection of harmful viruses and bacteria in plant material, vectors or natural reservoirs is essential to ensure safe and sustainable agriculture. The techniques available have evolved significantly in the last few years to achieve rapid and reliable detection of pathogens, extraction of the target from the sample being important for optimising detection. For viruses, sample preparation has been simplified by imprinting or squashing plant material or insect vectors onto membranes. To improve the sensitivity of techniques for bacterial detection, a prior enrichment step in liquid or solid medium is advised. Serological and molecular techniques are currently the most appropriate when high numbers of samples need to be analysed. Specific monoclonal and/or recombinant antibodies are available for many plant pathogens and have contributed to the specificity of serological detection. Molecular detection can be optimised through the automatic purification of nucleic acids from pathogens by columns or robotics. New variants of PCR, such as simple or multiplex nested PCR in a single closed tube, co-operative-PCR and real-time monitoring of amplicons or quantitative PCR, allow high sensitivity in the detection of one or several pathogens in a single assay. The latest development in the analysis of nucleic acids is micro-array technology, but it requires generic DNA/RNA extraction and pre-amplification methods to increase detection sensitivity. The advances in research that will result from the sequencing of many plant pathogen genomes, especially now in the era of proteomics, represent a new source of information for the future development of sensitive and specific detection techniques for these microorganisms.

A new and highly sensitive method for the amplification of viral RNA targets from plant material has been developed and patented. This technique called Co-operational amplification (Co-PCR) can be carried out easily in a simple tetraprimer reaction based on the simultaneous action of four primers. The reaction process consists of the simultaneous reverse transcription of two different fragments from the same target, one containing the other; the production of four amplicons by the combination of the two pair of primers, one pair external to other; and the co-operational action of amplicons for the production of the largest fragment. The technique was used successfully, both in metal block and capillary air thermal cyclers for the detection of plant RNA viruses (Cherry leaf roll virus, Strawberry latent ringspot virus, Cucumber mosaic virus, Plum pox virus and Citrus tristeza virus). The sensitivity observed is at least 100 times higher than that achieved with RT-PCR and similar to nested RT-PCR. Colorimetric detection was coupled with this methodology facilitating its introduction for routine indexing programs and for phytosanitary selection of virus-free plant material.

This study investigated the relationship between the circulating levels of the endothelial cell glycoproteins plasminogen activator inhibitor type 1 (PAI-1), tissue plasminogen activator (TPA), and thrombomodulin (TM) and the major vascular risk factors described in dialysis patients. In addition, the role of these endothelial cell products as independent predictors of coronary artery disease (CAD) was analyzed. Levels of TM, TPA antigen (Ag), TPA activity, PAI-1 Ag, PAI-1 activity, TPA/PAI complexes, thrombin-antithrombin complexes, fibrinopeptide A, C-reactive protein (CRP), interleukin-1beta and tumor necrosis factor-alpha, lipids, apoproteins A1 and B, and albumin were measured in a group of 200 nondiabetic dialysis patients and 100 healthy matched volunteers. When compared with healthy controls, dialysis patients showed increased levels of CRP, TM, TPA, and PAI-1 and evidence of increased thrombin-dependent fibrin formation. Increased levels of active PAI-1 were associated to a great extent with major classic vascular risk factors and to a lesser extent with CRP and serum triglycerides. Forty-six patients (23%) had evidence of CAD. Variables associated with CAD in the univariate analysis included age, time on dialysis, male gender, number of packs of cigarettes per year, high BP, fibrinogen, apolipoprotein B, albumin, PAI-1 activity, CRP, thrombin-antithrombin complexes, and fibrinopeptide A. Logistic regression analysis found age, high-density lipoprotein cholesterol, gender, high BP, CRP, time on dialysis, and PAI-1 activity to be independent predictors of CAD. This model classified correctly 85% of patients as having CAD and showed adequate goodness of fit for all risk categories. Our data support a pathogenic link among activated inflammatory response, endothelial injury, and CAD in hemodialysis patients and suggest that assessment of circulating PAI-1 levels could be an additional tool to identify dialysis patients who are at risk for developing atheromatous cardiovascular disease.