Search

The endogenous small subunit of the ribulose-1,5-bisphosphate carboxylase gene rbcS and the light-harvesting chlorophyll a/b-binding protein gene (LHCP) of pea are expressed in a light-inducible manner and are active mainly in green chloroplast-containing tissue. Chimeric genes under control of the 5'-flanking sequences of the rbcS ss3.6 or LHCP AB80 genes from pea were used to study the factors relating to the issue-specific and lightinducible expression of these nuclear-encoded genes in transgenic tobacco plants. The results show that plastid development plays a crucial role in the activation of expression of these chimeric genes. Particular members of each of the above gene families respond differently to tissue-specific and environmental factors. Furthermore, the light-inducible expression directed by the 5'-flanking sequence of ss3.6 rbcSgene is not exclusively mediated by phytochrome, but probably is controlledin large part by another photoreceptor.

Chimeric genes comprised of the nopaline synthase promoter and bacterial coding sequences specifying resistance to kanamycin, chloramphenicol or methotrexate, were inserted into the non-oncogenic Ti plasmid vector pGV3850 by recombination (through homologous pBR322 sequences present in the chimeric gene constructs and pGV3850). These co-integrates in Agrobacterium were used to infect single plant protoplasts of Nicotiana by co-cultivation. The resistance traits allowed the selection of transformed calli in tissue culture in the presence of the appropriate antibiotic. Furthermore, as a non-oncogenic Ti plasmid was used for the protoplast transformation, phenotypically normal and fertile plants could be regenerated from the resistant calli. We have shown that these fully differentiated plant tissues exhibit functional expression of resistance traits (Km and Cm). All plants carrying the chimeric genes developed normally, flowered, and set seeds. The inheritance of several of these resistance traits was analyzed and shown to be Mendelian. These results are model experiments to demonstrate that genes of interest can be systematically transferred to the genome of plants using non-oncogenic Ti plasmid derivatives; and that transformed plants are capable of normal growth and differentiation, thus providing a natural environment for the study of gene expression and development of plant cells.

We have investigated the regulatory functions of the 5'-flanking sequences of a chlorophyll a/b-binding protein gene from Pisum sativum, using the neomycin phosphotransferase (II) activity from Tn5 as an enzymatic reporter. We show that 0.4 kb of the upstream flanking sequences of this gene are sufficient for both organ-specific and light-regulated expression of our chimaeric constructs in transformed tobacco plants. In addition, we show that sequences farther upstream have a significant influence on the level of transcription of these constructions.

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.

We have isolated a 1.5-kb plant DNA fragment (called insert 7) from Nicotiana plumbaginifolia DNA that contains a protoplast-specific enhancer-like sequence. The presence of this sequence on a plasmid carrying a chimeric nos-npt-II gene conferring kanamycin resistance to plant cells, produces an overexpression of the npt-II gene during at least eight days after protoplast transformation. This effect on the expression of the nos promoter was independent of the orientation and was observed both on circular and linearized plasmids. On the contrary, insert 7 had no influence when present on another plasmid (in trans) in cotransformation experiments. The overexpression of the nos-npt-II gene due to the presence of insert 7 on the transforming plasmid is correlated with a higher level of synthesis of the corresponding RNA. Insert 7 did not affect the level of expression of the nos-npt-II gene in stably transformed calli, or in regenerated plants. However, the overexpression was again detected in protoplasts prepared from leaves of stably transformed plants. This 1.5-kb plant DNA fragment contains highly repetitive DNA sequences, specific to N. plumbaginifolia. However, the enhancer-like activity is localized on a 600-bp unique sequence of insert 7. Insert 7 had no detectable effect on the transient expression of another gene, the nopaline synthase gene present at a longer distance on the same plasmid.

Chimaeric genes can be constructed which fuse the transit peptide of a small subunit of the chloroplast-located ribulose 1,5-bisphosphate carboxylase with a bacterial protein. The fusion protein is translocated into chloroplasts and cleaved in a similar way to the small subunit polypeptide precursor.