Search

Objective: The aim of this study is to explore the value of EBV DNA monitor in high risk population of nasopharyngeal carcinoma (NPC). Method: A total of 366 cases of NPC at high risk were screened for 15 864 cases by ELISA, and 262 cases were randomly selected from low-risk groups. Fifty-eight nasopharyngeal carcinoma patients were also involved. EBV DNA was detected by PCR in 366 NPC high risk patients and followed up for 1 year. The clinical significance of EBV-DNA in screening NPC was compared. Result: The positive rate of EBV-DNA test was 12.0% in primary screening, EBV-DNA test in primary screening was 3.4% in low-risk population, and EBV-DNA in nasopharyngeal carcinoma was 91.4%, The positive rate of the three groups was statistically significant ( P <0.01); After one year follow-up, a total of 267 cases returned visit. Positive rate of group A with continuous high risk was significantly higher than group B who was high risk at the first time of visit and non high risk at returned visit ( P ＜0.05). Conclusion: Quantitative analysis of plasma EBV DNA in high risk population can supply serological risk assessment. It can elevate the efficiency of screening and has significant application value for NPC high risk population.

Objective: To compare the prevalence of HIV/STD and related health care seeking behaviors among male STD clinic attendees between Xi'an and Xianyang cities. Methods: During June and July 2016, 206 male STD clinic attendees were studied in Xi'an city, with another 221 male STD clinic attendees in Xianyang city. Cross-sectional questionnaire survey was used to collect attendees'behavioral information. Blood samples were collected via HIV/HCV/Syphilis testing. Results: The prevalence rate of HIV infection was 2.4% (5/206) in Xi'an and 0.9% (2/221) in Xianyang, with no statistical significant difference between the two cities. The prevalence rate of syphilis was 4.9% (10/206) in Xi'an, which was significantly lower than 13.6% (30/221) in Xianyang. The proportion of respondents, diagnosed with other sexually transmitted diseases, in Xi'an was higher than that of Xianyang. The proportions of commercial heterosexual sex and sex with temporary sexual partners in the past 3 months were 18.0% (37/206) and 15.5% (32/206) in Xi'an, lower than 46.6% (103/221) and 15.8% (35/221) in Xianyang ( χ (2)=39.70, Р <0.01; χ (2)=0.01, P =0.93) . The proportions of condom use with commercial sex workers or temporary sexual partners in the past 3 months among Xi'an were 37.8% (14/37) and 6.3% (2/32) , lower than 93.1% (95/102) and 57.1% (20/35) in Xianyang ( χ (2)=49.06, Р <0.01; χ (2)=19.63, Р <0.01) . Conclusion: Differences were noticed between Xi'an and Xianyang city in terms of STD and HIV prevalences, behaviors related to commercial sex and use of condoms among the male STD clinic attendees that calling for targeted actions in control of high risk behavlors in both HIV/AIDS and STDs transmission.

Objective: To investigate the value of preoperative dynamic contrast-enhanced MRI in reducing the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma. Methods: Seventy-two patients with early non-mass breast carcinoma received ultrasonographic and mammographic examination and subsequently underwent dynamic contrast-enhanced MRI examination before breast conserving surgery. The control group consisted of 74 patients who had early non-mass breast carcinoma. They only received ultrasonographic and mammographic examination and didn't undergo contrast-enhanced MRI examination. The comparison of the rate of tumor-positive resection margins between two groups was performed. The MRI findings that had the significant influence on the rate of tumor-positive resection margins were analyzed using Logistic regression model. Results: In 28 patients (28/72, 38.9%), dynamic contrast-enhanced MRI could correct or supplement the ultrasonographic and mammographic findings and resulted in the reasonable change of surgical program. The preoperative MRI examination group ( n =30) had lower rate of tumor-positive resection margins than control group for invasive ductal carcinoma (23.3% vs 40.0%, P =0.02), but there was no significant difference (21.4% vs 26.9%, P =0.10) between two groups for ductal carcinoma in situ ( n =28). The preoperative MRI examination group ( n =14) had lower rate of tumor-positive resection margins than control group for the other pathologic types of breast carcinoma (14.3% vs 38.9%, P =0.02). The statistical analysis on the basis of Logistic regression model showed that some main MRI findings, including change surrounding the tumor, distance between tumor and nipple and tumor size, had the significant influence on the rate of tumor-positive resection margins. Conclusion: Preoperative dynamic contrast-enhanced MRI significantly increased the accuracy of resection margins evaluation, and greatly reduced the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma.

The implant prosthesis has been extensively used in clinic recently, and implant failure is appearing. Many factors may cause the failure, and they work together generally. This paper summarizes and analyzes the failure cases related to implant treatment and relevant risk factors of oral implants in Department of Implantation, School of Stomatology, The Fourth Military Medical University during the past six years, in order to improve the success rate of implant prosthesis and provide guidance for clinical application.

Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose.

A cross-sectional cohort study was conducted to investigate whether ghrelin level in obese women predicts the quality of life (QOL). A total of 307 subjects fulfilled the criteria: (1) age between 20 and 65 years old, (2) body mass index ≥27 kg/m 2 (3) waist circumference ≥80 cm were enrolled in the study. All subjects were assigned to one of the plasma ghrelin level categories according to the quartiles. The median of age and BMI of the 307 obese women were 45 ± 18 years and 29.9 ± 4.1 kg/m 2 , respectively. The main outcome evaluated is the associations of plasma ghrelin level and QOL, which were evaluated using multiple linear regression analysis. Results of linear trend test show significant statistical difference in plasma lipoproteins (triglyceride, cholesterol, HDL-cholestero and LDL-cholesterol = and levels of obesity-related hormone peptides, including leptin, adiponectin, insulin among quartiles of ghrelin. Multiple liner regression analysis of serum obesity-related hormone peptide level and QOL using stepwise method shows ghrelin concentration was the only predictor of QOL, including PCS-12 level (β = -0.18, p = 0.001), MCS-12 level (β = -0.14, p = 0.009), WHOQOL-BREF scores: physical (β = -0.13, p = 0.03), psychological (β = -0.16, p = 0.007), social (β = -0.21, p =  < 0.001), and environmental (β = -0.22, p =  <0.001), after adjusting other factors for obese female subjects. This study demonstrated that ghrelin concentration is strongly associated with QOL level among obese women. Hence, ghrelin concentration might be a valuable marker to be monitored in obese women.

Objective: This study was aimed to explore the role of long noncoding RNA (lncRNA) AB073614 and its potential mechanisms in the glioma development., Materials and Methods: Expression levels of lncRNA AB073614 in glioma tissues and glioma cell lines were evaluated by quantitative real-time PCR (qRT-PCR). MTT assays were conducted to explore the impact of AB073614 down-regulation on the proliferation of human glioma cells. The effects of AB073614 knockdown on cell proliferation and migration were evaluated by in vitro assays. EMT-related molecular markers expression level was detected by qRT-PCR assay and Western blot analysis., Results: We confirmed that AB073614 was significantly upregulated in glioma tissues and cell lines (p < 0.01). In vitro studies demonstrated that knockdown of AB073614 inhibits U251 cell proliferation and migration. Moreover, knockdown of AB073614 could inhibit epithelial-mesenchymal transition (EMT) phenotype in glioma cells., Conclusions: AB073614 functions as a tumor promoter in glioma. This finding may provide a therapeutic approach for future treatment of glioma.

Lymphangioleiomyomatosis (LAM) is a rare multisystem disease occurring almost exclusively in premenopausal women and characterized by cystic lung destruction, abdominal tumors (renal angiomyolipomas (AML)), and involvement of the axial lymphatics (adenopathy, lymphangioleiomyomas). Serum vascular endothelial growth factor-D (VEGF-D), a lymphangiogenic factor, has been recently considered as a novel marker for LAM. Herein we report the diagnostic and differential diagnostic value of serum VEGF-D in LAM patients and evaluate the change of serum VEGF-D levels before and after treatment with sirolimus. The study group included 66 patients with LAM (47 definite LAM and 19 probable LAM based on European Respiratory Society guidelines), 14 patients with other polycystic lung diseases, and 20 healthy female controls. Serum VEGF-D levels were quantified by enzyme-linked immunoassay (ELISA). Serum VEGF-D levels were significantly increased in definite LAM patients compared with healthy controls (3890.3±373.3 pg/ml vs. 413.3±33.2 pg/ml, p<0.05). The optimal cutoff point for LAM diagnosis was 692.5 pg/ml with sensitivity of 97.9% and specificity of 100%. In probable LAM patients, serum VEGF-D levels were all greater than 692.5 pg/ml. Serum VEGF-D levels were significantly increased in definite LAM patients who had chylothorax compared with those without chylothorax (5153.9±598.3 pg/ml vs. 2869.8±372.8 pg/ml, p<0.05). But serum VEGF-D levels in LAM patients with/without pneumothorax, AML, and lymphangioleiomyomas were not significantly changed. Serum VEGF-D levels in definite LAM patients and patients with other cystic lung diseases were 3890.3±373.3 pg/ml and 412.6±27.5 pg/ml, respectively (p <0.05). We determined an optimal cutoff value of 688.5pg/ml, resulting in sensitivity of 97.9% and specificity of 100%. Following a median of 12-month treatment with sirolimus, serum VEGF-D levels decreased from 3135.0±909.4 pg/ml to 1731.8±621.2 pg/ml and symptoms improved. Our study found that serum VEGF-D levels were significantly higher in LAM patients compared with healthy controls and patients with other polycystic lung diseases and that the levels were further increased when complicated by chylothorax. Serum VEGF-D levels may be useful for diagnosis and differential diagnosis with high specificity and sensitivity as well as for following treatment response with sirolimus.

To date, no study has investigated the association between CYP1A2-163C/A polymorphism and bladder cancer risk in a Chinese population. Here, we extracted genomic DNA from peripheral white blood cells, and differentiated CYP1A2 alleles by polymerase chain reaction-based restriction fragment length polymorphism methods. Differences in genotype frequencies between the cases and controls were evaluated using a chi-square test. The odds ratio (OR) and its 95% confidence interval (CI) were calculated using an unconditional logistic regression model. This revealed that the -163A allele was present at a significantly increased frequency in bladder cancer patients compared to healthy controls (44.10 vs 22.25%, P < 0.001). The prevalence of CC genotype, CA genotype, and AA genotype was 34.91, 41.98, and 23.11% in bladder cancer patients, and 64.00, 27.50, and 8.5% in the controls, respectively. Therefore, significant differences in the frequencies of -163 genotypes were found between bladder cancer patients and controls (P < 0.001). We found that the AA genotype was significantly associated with increased bladder cancer risk (OR = 3.72; 95%CI = 1.55-7.16; P = 0.02), and the -163A carriers were at increased risk of bladder cancer in a multivariate COX regression model (OR = 4.89, 95%CI = 2.78-10.87, P = 0.01). We conclude that the CYP1A2-163C/A polymorphism is associated with increased susceptibility to bladder cancer in the Chinese population.

At present, dental implant technology with high chewing efficiency and good appearance in esthetics has been widely used. However, some problems may be found in the follow-up procedure of implant prostheses, and one of them is food impaction. This article discussed the causes of food impaction in the posterior region with implant prostheses and provided treatment strategies to this biological complication.

Objective: We tested whether injection of contrast medium via right or left arm would affect venous artifacts on head and neck multislice spiral computed tomography (CT) angiography., Patients and Methods: 326 patients were enrolled. Each patient was injected with 10 ml of contrast medium at 5 ml/sec. Time of peak contrast value plus an additional 1 sec was defined as delay time. Another 40 ml of contrast medium were injected with the same injection speed. The scanning area ranged from the aortic arch to the top of the head. Left and right forearms were used for intravenous injections of contrast medium in, respectively, 151 and 175 patients. Comparative analyses of image quality included determining contrast medium residues remaining in the superior vena cava, brachiocephalic vein, or subclavian vein, and comparisons of quality of three-dimensional CT angiography., Results: In 75% of head and neck angiographies, the delay time of the common carotid artery ranged from 16 to 22 sec. In 60% of the images, the quality was graded as excellent, with the left arm injection resulting in delay time of > 23 sec and the right arm delay time of > 18 sec. The CT imaging quality after contrast injections via left or right arms was statistically significant (p < 0.05). The image quality after right arm injection was better than after left arm injection., Conclusions: Intravenous injection of contrast medium via right arm reduces artifacts from contrast medium residues and improves the image quality of head and neck CT angiography.

Although a number of studies have shown that chemical hybridizing agents (CHAs) affect anther growth and regulate cell-cycle progression, little is known about the molecular and cellular mechanisms involved. Proliferating cell nuclear antigen (PCNA) is an essential factor in DNA replication, and in many other processes in eukaryotic cells. In this study, the open reading frame of TaPCNA, the PCNA in wheat (Triticum aestivum L.), was cloned by reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis revealed that this gene was 792-bp long and encoded a protein with 234 amino acids. Alignment of the TaPCNA-predicted sequence revealed a high degree of identity with PCNAs from other plant species. A subcellular localization assay indicated that TaPCNA was localized in the nucleus. The TaPCNA was cloned into the prokaryotic expression plasmid pET32a, and the recombinant plasmid was transformed into BL21 (DE3). TaPCNA expression was induced by 0.5 mM isopropyl-beta-D-thiogalactopyranoside and verified using sodium dodecyl sulfate polyacrylamide gel electrophoresis and western blot assays, which indicated that the fusion protein was successfully expressed. The gene involved in the G1-to-S transition, Histone H4, was downregulated by 1376- CIMS, which is a chemically induced male sterility line. However, a semi-quantitative RT-PCR revealed that TaPCNA expression was upregulated in 1376-CIMS. Our results suggest that CHAs (SQ-1) induce DNA damage in wheat anthers. DNA damage results in either the delay or arrest of cell-cycle progression, which affects anther development. This study will help to elucidate the mechanisms of SQ-1-induced male sterility.

A facile fabrication of flower-shaped porphyrin Janus colloids with oriented arrangement was demonstrated based on the interfacial assembly and water droplet template. The as-fabricated colloidal crystals from flower-shaped Janus particles show a special optical signal produced from the hierarchical structures.

Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 μm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 10 4 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009.

SFTS virus (SFTSV) is a novel bunyavirus that causes severe fever with thrombocytopenia syndrome (SFTS), an emerging infectious disease that occurred in China in recent years, with an average case fatality rate of 10-12%. Intervention in the early clinical stage is the most effective measure to reduce the mortality rate of disease. To elucidate the natural course of and immune mechanisms associated with the pathogenesis of SFTSV, 59 laboratory-confirmed SFTS patients in the acute phase, who were hospitalized between October 2010 and September 2011, were enrolled in this study, and the patients sera were dynamically collected and tested for SFTSV viral RNA load, 34 cytokines or chemokines and other related laboratory parameters. All clinical diagnostic factors in the acute phase of SFTS were evaluated and assessed. The study showed that the severity of the disease in 11 (18.6%) patients was associated with abdominal pain (p 0.007; OR = 21.95; 95% CI, 2.32-208.11) and gingival bleeding (p 0.001; OR=122.11; 95% CI, 6.41-2328). The IP-10, TNF-α, IL-6, IL-10, granzyme B and HSP70 levels were higher over the 7-8 days in severe cases, accompanied by altered AST, CK and LDH levels. HSP70 (p 0.012; OR=8.29; 95% CI, 1.58-43.40) was independently correlated with the severity of the early acute phase of SFTSV infection. The severity of SFTS can be predicted based on the presence of symptoms such as abdominal pain and gingival bleeding and on the level of HSP70 in the acute phase of the disease., (© 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.)

Angular-type pyranocoumarins (APs), the derivatives of khellactone, are widely documented as the main active constituents in Peucedani Radix (Chinese name: Qian-hu). Owing to the natural occurrence of chiral centers, enantiomers of APs are extensively distributed in the original plant, and enantioselective performances have been definitely demonstrated for these enantiomers. In current study, the chemical characterization of the major and minor APs in Peucedani Radix was performed using ultra high performance liquid chromatography coupled with diode array detector and hybrid ion trap-orbitrap mass spectrometry. On the other hand, a heart-cut two-dimensional achiral-chiral liquid chromatography combining triple quadropole-linear ion trap mass spectrometry system (2D LC-MS/MS) was developed for simultaneous enantiospecific quantification of eighteen coumarins, including seven pairs of enantiomers. Eleven APs (1-11) were recruited to propose UV absorption characteristics and electrospray ionization fragmentation patterns of APs. A total of 42 components were categorized into APs based on their UV spectral properties and identified according to the proposed mass fragmentation pathways, while two linear-type furanocoumarins (12-13) were unambiguously assigned by further purification. A Capcell core RP-C18 column was employed in the primary LC dimension to achieve efficient racemic separation for the main chemical constituents (1-9 and 12-13) in Peucedani Radix, while a Chiralpak AD-RH column was utilized in the secondary dimension to contribute enantioselective separation for seven enantiomerically enriched components (1, 3 and 5-9). Collectively, the results provided the chemical evidences for revealing the material basis of the therapeutic effects of Peucedani Radix, and the developed 2D LC-MS/MS system in the present study is expected to be an ideal tool for the quality control of Peucedani Radix as well as a reliable technique for complex matrices containing both achiral and chiral components., (Copyright © 2014. Published by Elsevier B.V.)

Purpose: To perform a systematic review and meta-analysis to define the role of procalcitonin (PCT) in identifying infectious complication in organ transplant recipients., Methods: We searched EMBASE, MEDLINE, the Cochrane database, and reference lists of relevant articles, with no language restrictions, published from inception through May 2013. We selected original research that reported the diagnostic performance of PCT alone or when compared with other biomarkers to diagnose infectious complication among organ transplant recipients. We summarized test performance characteristics with the use of forest plots, hierarchical summary receiver operating characteristic curves, and bivariate random-effects models., Results: We found 7 qualifying studies (studying 1226 episodes of suspected infection with 186 confirmed infectious episodes) from 4 countries. The patients were lung, kidney, liver, and heart transplant recipients. Bivariate pooled sensitivity, specificity, positive likelihood ratios, and negative likelihood ratios for identification of bacterial infections in patients after transplantation were 85% (95% confidence interval [CI], 75%-92%), 81% (95% CI, 72%-88%), 4.41 (95% CI, 2.86-6.81), and 0.18 (95% CI, 0.10-0.33), respectively. Of the 4 studies that reported the experience of liver transplant patients, the pooled sensitivity, specificity, positive likelihood ratios, and negative likelihood ratios were 90% (95% CI, 75%-97%), 85% (95% CI, 77%-91%), 6.12 (95% CI, 3.79-9.88), and 0.11 (95% CI, 0.04-0.32), respectively. There was no evidence of significant heterogeneity., Conclusion: The existing literature suggests reasonable sensitivity and specificity for the PCT test in identifying infection complications among patients undergoing solid organ transplantation. Given the imperfect sensitivity and specificity of the PCT test, medical decisions should be based on both PCT test results and clinical findings., (Copyright © 2014 Elsevier Inc. All rights reserved.)

Aquaporin-1 (AQP1) is the principle water channel in the peripheral nervous system (PNS) and is specifically localized to Schwann cells in the PNS. However, the pathophysiological role of AQP1 in peripheral nerves is poorly understood. Here, we utilized RNA interference by lentiviral transduction to specifically down-regulate AQP1 expression and a lentiviral overexpression protocol to up-regulate AQP1 expression, in primary Schwann cell cultures. AQP1 gene silencing resulted in a cell shrinkage phenotype, while AQP1 gene overexpression caused a cell swelling phenotype, as validated by cell volume determinations. Secondly, we utilized an in vitro hypoxia model in Schwann cells to mimic in vivo facial nerve injury. We demonstrated that AQP1 expression was induced within 8h following hypoxia injury in vitro, and that AQP1 knockdown (KD) caused the cells to resist edema following hypoxia. Finally, we investigated the hypoxic regulation of the AQP1 gene, as well as the involvement of Hypoxia-inducible factor-1α (HIF-1α) in AQP1 modulation and we found that KD of HIF-1α decreased hypoxia-dependent induction of endogenous AQP1 expression at both the mRNA and protein levels. Taken together, these results indicate that (1) AQP1 is an important factor responsible for the fast water transport of cultured Schwann cells and is involved in cell plasticity; (2) AQP1 alterations may be a primary factor in hypoxia-induced peripheral nerve edema; (3) HIF-1α participates in the hypoxic induction of the AQP1 gene; (4) AQP1 inhibition might provide a new therapeutic alternative for the treatment of some forms of peripheral nerve edema., (Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.)

Aims: The innate immune-receptor nucleotide oligomerization domain (NOD) protein recognizes intracellular bacterial peptidoglycan. Activation of the innate immune system contributes to the development and progression of insulin resistance. The present study aimed to determine the presence of NOD1 and NOD2 in human adipose cells as well as to assess their functionality., Methods: Subcutaneous abdominal fat from obese subjects was biopsied and characterized for NOD expression using quantitative real-time PCR (qPCR). Human adipocytes were stimulated with iE-DAP (NOD1-specific ligand), and NOD1, proinflammatory cytokine production and nuclear factor (NF)-κB activation were quantified using qPCR, enzyme-linked immunosorbent assay (Elisa) and luciferase assay. Insulin-stimulated glucose uptake was determined by measuring 2-deoxy-D-[(3)H] glucose uptake. Expression and phosphorylation of IRS-1, Akt and JNK were evaluated using Western blotting., Results: NOD1/NOD2 mRNA expression was induced during adipocyte differentiation and enhanced in human adipose depots. Stimulation of isolated human adipocytes with iE-DAP induced NF-κB p65 nuclear translocation and a marked increase in proinflammatory cytokine production, including MCP-1, IL-6 and IL-8. NOD1 activation weakened insulin signal transduction as revealed by increased JNK and IRS-1 Ser307 phosphorylation, inhibited IRS-1 tyrosine phosphorylation, and reduced insulin-induced phosphorylation of Akt on Ser473 and Thr308 in human adipocytes. Moreover, NOD1 activation reduced insulin-induced glucose uptake, leading to insulin resistance., Conclusion: These results suggest that NOD1 signaling could be one of the links between innate immunity and insulin resistance in human adipocytes. This study provides supporting evidence for NOD1 protein as a component of innate immunity involved in insulin resistance., (Copyright © 2012 Elsevier Masson SAS. All rights reserved.)

Background: Mutations in 6 genes have been identified as being part of the etiology of amelogenesis imperfecta (AI) with various phenotypes in an isolated condition. Among them the FAM83H gene is the major contributor to the etiology of AI with unknown function., Objective: This study aims to determine the phenotypic and molecular characterization of Chinese AI patients and to analyze the structure and function of the FAM83H protein., Methods: We enrolled 6 hypocalcified AI and 3 hypoplastic AI families from the Chinese population. Mutation analysis was performed by amplifying and sequencing all exons including intron-exon borders for FAM83H and ENAM genes. Structural modeling and function analysis on the FAM83H protein were carried out by bioinformatic processing., Results: No obvious anterior open bite was observed in all the investigated individuals. Five mutations (c.906T>G, c.924dupT, c.973C>T, c.1354C>T and c.2029C>T) in the C-terminal of the FAM83H gene were revealed, respectively, in 5 out of 6 hypocalcified AI families, and a splicing mutation c.534 + 1G>A in the ENAM gene was identified in 1 out of 3 hypoplastic AI families. Structural models of the N- and C-terminal regions of FAM83H were generated by homology modeling. The predicted structure of the FAM83H N-terminal shows resemblance to that of glycosyltransferases with GT-A folds, and the predicted structure of the FAM83H C-terminal possesses similarity to type I collagen protein., Conclusions: To our knowledge, this is the first report of AI with specific molecular variations in families of Chinese descent. Our study provides new insights into the structure and function of the FAM83H protein., (Copyright © 2012 S. Karger AG, Basel.)

Tuberculosis caused by Mycobacterium bovis (M. bovis) seriously affects efficiency of animal production with impacts on public health as well. Effective programmes of prevention and eradication of M. bovis infection therefore are urgently needed. Intracellular pathogen resistance gene 1 (Ipr1) is well known to mediate innate immunity to Mycobacterium tuberculosis (MTB), but there are no reports as to whether Ipr1 can enhance the phagocytic ability of macrophage against M. bovis. In this investigation, RAW 264.7 macrophage was transduced with lentiviral vector carrying Ipr1 (named Lenti-Ipr1); transgenic cells were identified by RT-PCR and western blotting. Transgenic positive cells (R-Ipr1) were then infected with an M. bovis virulent strain, with non-transduced cells used as control. When cell proliferation, viability and apoptosis of the two groups were investigated, it was found that infected RAW 264.7 died by necrosis whereas R-Ipr1 underwent apoptosis. Furthermore, the numbers of intracellular bacteria in R-Ipr1 were lower than those in control cells (P < 0.05). To identify the role of Ipr1, we measured the genes of Casp3, Mcl-1 and NOS2A which associated with macrophage activation and apoptosis by real-time quantitative PCR. The results demonstrated that Ipr1 gene expression can enhance anti-M. bovis infection of macrophage. This establishes a basis for the future production of Ipr1-transgenic cattle to strengthen the tuberculosis resistance., (© 2011 The Authors. Scandinavian Journal of Immunology © 2011 Blackwell Publishing Ltd.)

Cherubism is a benign lesion that causes painless symmetrical enlargement of the jaws, usually with a familial tendency. We describe in two Chinese families two cases of the aggressive form of cherubism with extensive swelling on both sides of the mandible, typical microscopic findings, and apparent familial history.

Seven obligately anaerobic, Gram-positive, rod-shaped, spore-forming organisms isolated from human faecal specimens were characterized using phenotypic and molecular taxonomic methods. Strains of the unidentified bacterium used carbohydrates as fermentable substrates, producing acetic acid, isovaleric acid and phenylacetic acid (PAA) as the major products of glucose metabolism, and possessed a G +C content of approximately 29.8 mol%. Comparative 16S rRNA gene sequencing showed that the 7 strains were genetically highly related to each other (displaying >99.5% sequence similarity) and represent a previously unknown sub-line within the Clostridium Cluster XI. The closest described species to the novel bacterium is Clostridium glycolicum, although a 16S rRNA sequence divergence of 4% demonstrates that they represent different species. Genomic DNA-DNA pairing studies confirmed the separateness of the unknown species and C. glycolicum (30.6% similarity between the proposed type strain of the novel species, WAL 16138, and C. glycolicum ATCC 14880(T)). Based on morphologic, phenotypic and phylogenetic evidence, it is therefore proposed that the unknown bacterium be classified as C. bartlettii sp. nov. The type strain of C. bartlettii is WAL 16138(T) (= ATCCBAA-827(T)=CCUG48940(T)).

Aim: To study and compare Great Taper (GT) hand files using a reversed balanced force technique, nickel-titanium (NiTi)flex files with a balanced force technique and stainless steel (SS) K-type files using a step-back technique., Methodology: Forty-eight extracted mandibular premolar teeth with single root canals having curvatures between 15 and 45 degrees were prepared using a modified Bramante model and randomly divided into three groups. The teeth were cross-sectioned at 2, 6 and 10 mm from the working length. Preoperative images of canals at three levels were captured at 20x magnification using a stereomicroscope. Canals in each group were, respectively, prepared to an apical size.10 GT file with 0.2 mm tip diameter, size 30 NiTiflex file and size 30 SS K-file. The GT file was used in a reversed balanced force technique, the NiTiflex file was used in a balanced force technique, and the SS K-file was used in a step-back technique. Postoperative canals were imaged under the conditions same as those for the preoperative canals. The postoperative images were superimposed over the preoperative images using software photoshop 6.0. The ability to maintain the instrument in the central axis of the canal and the deviation from the central canal axis were determined and compared by statistical analysis, along with the assessment of the amount of dentine removed., Results: At apical level, the centering ratio, the distance of transportation and the dentine removed in GT and NiTiflex groups were significantly less than those in SS group (P < 0.01), but no statistical differences were found between the two NiTi groups. At other levels, there were no substantial differences amongst the groups., Conclusions: Compared with SS K-files, GT hand files and NiTiflex files remain better centered and produce significantly less transportation in curved canals.

The objectives of this study were to investigate the potential roles of cortisol and gonadal steroids in the phagocytic activity of peripheral blood leukocytes in two teleosts, tilapia (Oreochromis niloticus x O. aureus) and common carp (Cyprinus carpio). An in vitro microtiter plate assay, measuring incorporation of FITC-latex beads into peripheral blood leukocytes, was developed for the first time in teleosts. Peripheral blood leukocytes were cultured in AL medium with tested compounds in a microfluor black plate at 25 degrees C. FITC-latex beads were further incubated for phagocytosis and engulfed fluorescent intensity in phagocytes was detected fluorometrically. Cortisol suppressed leukocyte phagocytosis in a dose (10(-14) to 10(-4) M)- and time (0.5 to 8 h)-dependent manner in tilapia. The glucocorticoid agonist dexamethasone had a suppressive effect similar to that of cortisol, while cortisone and the mineralocorticoid aldosterone had only a weak effect in tilapia. High doses of estradiol and ethynylestradiol, but not of estrone, suppressed phagocytosis in tilapia. No suppressive effect on phagocytosis was observed with various concentrations of progesterone, testosterone, and 11-ketotestosterone. Triiodothyronine was also inactive on phagocytosis. A combination of estradiol and cortisol potentiatingly suppressed phagocytosis. Actinomycin D and cycloheximide blocked the suppressive effects of cortisol and estradiol. Cortisol had weaker suppressive effects on the phagocytosis of leukocytes in common carp than tilapia. Other steroids had no suppressive action on phagocytosis in common carp. It is concluded that the suppressive effects of cortisol and estradiol on phagocytosis in tilapia are mediated by specific glucocorticoid receptors and estrogen receptors, respectively. Cortisol would play a main and important role on the down-regulation of phagocytic activity. Sexual steroids, such as estradiol, also could interact with cortisol to further suppress immunity in tilapia. Differential responsiveness of the immune system to suppressive effects of steroids, among teleosts species, has been demonstrated., (Copyright 2001 Academic Press.)

TRAIL is a cytokine that induces apoptosis in a wide variety of tumor cells but rarely in normal cells. It contains an extraordinarily elongated loop because of an unique insertion of 12-16 amino acids compared with the other members of tumor necrosis factor family. Biological implication of the frame insertion has not been clarified. We have determined the crystal structure of TRAIL in a complex with the extracellular domain of death receptor DR5 at 2.2 A resolution. The structure reveals extensive contacts between the elongated loop and DR5 in an interaction mode that would not be allowed without the frame insertion. These interactions are missing in the structures of the complex determined by others recently. This observation, along with structure-inspired deletion analysis, identifies the critical role of the frame insertion as a molecular strategy conferring specificity upon the recognition of cognate receptors. The structure also suggests that a built-in flexibility of the tumor necrosis factor receptor family members is likely to play a general and important role in the binding and recognition of tumor necrosis factor family members.

Lysyl oxidase is an essential catalyst for the cross-linking of extracellular collagen and elastin. Abnormalities in lysyl oxidase activity may contribute to the pathogenesis of arterial diseases characterized by abnormal matrix remodeling. This study tested the hypothesis that interferon (IFN)-gamma, a proinflammatory cytokine present in aortic aneurysm and arteriosclerotic plaque rupture, downregulates lysyl oxidase gene expression in rat aortic smooth muscle cells. Steady-state lysyl oxidase mRNA levels decreased in a concentration- and time-dependent manner to 30% of control levels after 24 hours of treatment with IFN-gamma. Cell layer lysyl oxidase activity decreased in parallel with the observed changes in steady-state mRNA. Nuclear runoff studies suggested that transcriptional regulation was responsible for at least 40% of the observed downregulation. mRNA decay studies suggested that IFN-gamma also decreased lysyl oxidase mRNA half-life from 9 to 6 hours. Downregulation of lysyl oxidase by IFN-gamma did not appear to require new protein synthesis. This study documents that IFN-gamma downregulates lysyl oxidase gene expression in rat aortic smooth muscle cells by transcriptional and posttranscriptional mechanisms. If similar regulation occurs in vivo, it is possible that IFN-gamma-mediated changes in lysyl oxidase may contribute to arterial diseases characterized by abnormal extracellular matrix.

The efficacy of a biochemical kit, API50CHL kit, for identification of intestinal and vaginal lactobacilli from humans was evaluated by comparing with the results of DNA-DNA hybridization assay. The results showed that in total only 52 of the 172 strains (30.2%) tested were identified correctly by the kit at species level. Especially all strains of some species, such as Lactobacillus gasseri and Lactobacillus crispatus, were misidentified as Lactobacillus acidophilus by the kit. However, the kit was found to be reliable for identification of Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, and Lactobacillus salivarius. This suggests that the exact identification of Lactobacillus isolates from human stool and vaginal specimens by API50CHL kit is difficult without the support of modern genotypic technique.

Beta-1,3-1,6-glucan, derived from bakers' yeast Saccharomyces cerevisiae, was used in the present study to investigate the extent to which glucan is able to protect spawners from white spot syndrome associated virus (WSSV), and whether this protection (if any) can be passed on to hatchlings via maternal transmission of immunity. Results showed that fewer spawners in the glucan-injected groups showed the clinical symptoms of red body coloration and white spots on the shell during the 15 days between eyestalk ablation and the end of repeated spawning. This suggests that the application of glucan might lead to a slight enhancement of disease resistance in spawners, although the differences were not statistically significant within the confidence limit chosen. Challenge results showed a significant increase in relative percent survival for larvae derived from groups of glucan-injected spawners compared to those derived from groups of untreated spawners. It therefore seems that a maternally transmitted disease resistance induced by glucan, protected the larvae against a WSSV infection. Glucan immersion was not only shown to be effective for nauplii derived from spawners that were not injected with glucan, it also provided additional, cumulative protection for nauplii which already had a maternally transmitted resistance to WSSV. This is the first documented demonstration of a maternal transmission of immunity in invertebrates.

We identified Lactobacillus isolates from Japanese women and newborn infants by a DNA-DNA hybridization method. The predominating lactobacilli were Lactobacillus crispatus and Lactobacillus gasseri in the women's vaginas and the newborns' intestines and L. gasseri and Lactobacillus fermentum in the women's intestines. All L. crispatus strains were exclusively strong H2O2 producers.

The phenoloxidase (PO) activity of hemocyte lysate supernatant (HLS) from both tiger shrimp (Penaeus monodon) and giant freshwater prawn (Macro-branchium rosenbergii) was examined by treating HLS with various factors, such as an increase in temperatures from 25 to 70 degrees C, one of four elicitors (beta-1,3-1,6-glucan, zymosan, heat-killed Vibrio cells, and lipopolysaccharide), trypsin, one of three protease inhibitors (soybean trypsin inhibitor, p-nitrophenyl-p'-guanidinobenzoate, and benzamidine), and one of two divalent cations (Mg2+ and Ca2+). The strongest PO activity in both animals was induced at 37 degrees C, while enzyme activity varied according to the concentration of the elicitors or cations added to the HLS samples. The following optimum concentrations were recorded: lipopolysaccharides at 0.5 mg/ml, both beta-glucan and zymosan at 1 mg/ml, and Vibrio cells at 10(6) cells/ml. In addition, for giant freshwater prawn, PO activity increased when HLS was treated with trypsin and decreased when it was separately treated with three protease inhibitors. However, effects of either trypsin or protease inhibitors did not occur in tiger shrimp. Strongest PO activity occurred in HLS treated with 20 mM of either calcium ion or magnesium ion, and the addition of the two cations led to an increase in enzyme activity; a decrease was noted following the treatment with EDTA. Cytochemical analysis revealed that prophenoloxidase system exists in the granulocytes of both tiger shrimp and giant freshwater prawn.

Aim: To study the significance of monoclonal antibody SC3A expression in gastric carcinoma and precancerous lesions., Methods: Immunohistochemical staining and mucin histochemical staining were performed on paraffin-embedded sections from gastric benign and malignant lesions from 101 patients., Results: SC3A positive rate was 80.3% (57/71) in lesions of gastric carcinoma. The expression of SC3A was not related to the classification, differentiation, metastasis and or survival rates. The positive rate of SC3A in cancers secreting acid mucin (90.2%) or sulphomucin (91.3%) was higher than that in cancers without acid mucin (20.0%) or sulphomucin (60.0%) (P < 0.01). The positive rate of sulphomucin was higher in cases of intestinal metaplasia with cancer (88.9%) than that of cases of intestinal metaplasia with a benign lesion (35.3%) (P < 0.01). Additionally, the positive rate of SC3A with sulphomucin in intestinal metaplasia (60.9%) was higher than that without sulphomucin (31.3%) (P < 0.05)., Conclusion: SC3A monoclonal antibody might be helpful in the diagnosis of gastric cancer and the discernment of histogenesis.

The patient's posture for nerve surgery operation was improved in order to convenient to micro surgery procedure and offer cooperation further better for operators, as well as to decrease possibility of skin injury. The results indicated that emergence of skin injury in improved posture decreased 67.25% compared with that before and complications reduced significantly.

The histopathology of bronchial asthma is associated with structural changes within the airways, including subepithelial fibrosis, as well as chronic eosinophilic inflammation. The mechanisms responsible for this tissue remodeling, and in particular the role of inflammatory cells, remain to be established. Transforming growth factor-beta (TGF-beta) is a potent profibrotic cytokine which may contribute to the thickening of the reticular lamina by the deposition of collagen fibers. To investigate the molecular mechanisms underlying these structural changes, we have investigated the expression of TGF-beta1 mRNA and immunoreactivity within the bronchial mucosa of mild to severe asthmatic individuals and normal control subjects using the techniques of in situ hybridization and immunocytochemistry. As eosinophils are prominent within the asthmatic airway and are known to synthesize pro-inflammatory cytokines, the presence of TGF-beta1 mRNA and immunoreactive protein in eosinophils was also examined. Asthmatic individuals exhibited a greater expression of TGF-beta1 mRNA and immunoreactivity in the airways submucosa than normal control subjects (P < 0.05), and these increases were directly related to the severity of the disorder. The extent of airways fibrosis, as detected histochemically, was also increased in asthmatics compared with normal control subjects (P < 0.005). In asthmatic subjects, the presence of subepithelial fibrosis was associated with the severity of the disease and correlated with the decline in forced expiratory volume in 1 s (r2 = 0.78; P < 0.05). Within the asthmatic airways, EG2-positive eosinophils represented the major source of TGF-beta1 mRNA and immunoreactivity. These results provide evidence that TGF-beta1 may play a role in the fibrotic changes occurring within asthmatic airways and that activated eosinophils are a major source of this cytokine.

Cytokine-mediated immune responses to Mycobacterium tuberculosis infection are important determinants of M. tuberculosis disease development and pathology. However, the distinction between changes in cytokine profile attributable to M. tuberculosis infection and those associated with active pulmonary tuberculosis is unclear. We have compared T cells and their subsets, macrophages, and cytokine messenger RNA (mRNA) profile in the bronchoalveolar lavage (BAL) of patients with active pulmonary tuberculosis with inactive tuberculosis subjects. Ten patients with microbiologically confirmed active pulmonary tuberculosis and 25 subjects with inactive tuberculosis were recruited. Bronchoscopy with BAL was undertaken in all cases and BAL cytospins were examined using the techniques of immunocytochemistry and in situ hybridization. There was a significant increase in the percentage of BAL cells that were CD8+ T cells in active tuberculosis compared with inactive tuberculosis (mean +/- SEM: 7.2 +/- 0.9 versus 2.1 +/- 0.4, p < 0.001), but not CD3+ or CD4+ T cells nor macrophages. There were significant increases in the percentage of BAL cells expressing mRNA for interferon-gamma (IFN-gamma) and interleukin-12 (IL-12) in active versus inactive pulmonary tuberculosis subjects (8.0 +/- 0.6 versus 3.7 +/- 0.4 and 28.4 +/- 2.3 versus 10.2 +/- 1.0, p < 0.001, respectively). There were no significant differences between the active and inactive groups in the number of cells expressing mRNA for IL-2, tumor necrosis factor-alpha (TNF-alpha), IL-4, and IL-5. In conclusion, active pulmonary tuberculosis is associated with increased numbers of CD8+ cells and marked increases in the expression of IL-12 and IFN-gamma mRNA in the BAL, both of which may be useful markers of disease activity.

Non-specific disease resistance induced by yeast cell wall extract, beta-1,3-1,6-glucan, was demonstrated in the tiger shrimp. In this study beta-1,3-1,6-glucan was administered to shrimps by immersion before culturing and orally during the culturing period. Challenge of the treated shrimps with the virulent pathogens, Vibrio vulnificus and viral agents extracted from the white spot syndrome victims, yielded promising results. The tolerance of glucan-treated shrimps was slightly enhanced to stresses including catching, transport and ammonia. The growth and survival rates of treated and untreated shrimps were not significantly different. Therefore, we suggest that beta-1,3-1,6-glucan can be used as an immuno-stimulant of cultured shrimps and may benefit shrimp farmers.

Current evidence suggests that the events subsequent to antigen challenge in allergic asthmatics involve eosinophil activation and the synthesis of proinflammatory cytokines, in particular interleukin 5 (IL-5). However, little is known about how local inflammatory cell infiltration and activation are related to the changes in lung function following allergen exposure. We have developed a novel technique to investigate the local inflammatory events during late-onset allergic bronchoconstriction in lung explants from sensitized Brown-Norway (BN) rats. In this study we tested the hypothesis that the in vitro late airway response involves IL-5 gene activation and recruitment and activation of eosinophils. Explants were prepared from excised lungs of BN rats (n = 9) sensitized 2 wk previously to ovalbumin (OVA). Lungs were inflated with liquid agarose solution (2% wt/vol, 48 ml/kg) following perfusion with cold Ca2+/Mg(2+)-free Hanks' solution, and refrigerated briefly to gel the agarose, and 0.5- to 1.0-mm slices were prepared and cultured overnight at 37 degrees C. Airways were identified and challenged by direct application of OVA (20 micrograms). Cryostat sections of explants were immunostained for major basic protein (MBP) and IL-5 mRNA was detected by a 35S-uridine triphosphate-labeled probe and in situ hybridization. Explants harvested immediately prior to challenge showed little evidence of MBP and IL-5 mRNA expression. Explants harvested at 6 h which exhibited evidence of bronchoconstriction showed strong cell-associated immunostaining for MBP and high expression of IL-5 mRNA in the bronchial mucosa. colocalization studies performed in lung explants demonstrating late-onset airway responses suggested that the majority of IL-5 mRNA expression was not found in MBP-positive cells. When compared with explants from sham-sensitized rats (n = 4), there was a significant increase in MBP-positive and IL-5 mRNA-positive cells per millimeter of basement membrane of the airway. The presence of MBP immunoreactivity and IL-5 gene expression was not observed in explants taken from sensitized BN rats which did not undergo late-onset airway responses, indicating an association between inflammatory cell activation and airway constriction. The increase in MBP-positive cells several hours after OVA suggests activation, local recruitment, and/or differentiation of eosinophils. This study provides direct evidence for a temporal association between IL-5 expression, eosinophil infiltration, and the late response in individual cultured airways.

We studied potential mechanisms of eosinophil accumulation in nonallergic chronic hyperplastic sinusitis with nasal polyposis (CHS/NP). We measured expression of endothelial vascular cell adhesion molecule-1 (VCAM-1), which mediates selective eosinophil transendothelial migration, the cytokines interleukin (IL)-1 beta, TNF-alpha and IL-13 which upregulate VCAM-1 expression, and the chemokine RANTES which mediates lymphocyte, monocyte, and eosinophil chemotaxis in chronic hyperplastic sinusitis with nasal polyposis (CHS/NP) nasal polyps (nonallergic versus allergic) and middle turbinate biopsies from normal controls. By immunohistochemical staining, the density of EG2+ eosinophils was increased in both the nonallergic and allergic CHS/NP subgroups compared to normal controls. VCAM-1 expression was significantly increased in CHS/NP subjects compared to normal controls (P = 0.0005), with the highest intensity seen in nonallergic CHS/NP. By in situ hybridization, the densities of IL-1 beta, TNF-alpha, IL-13, and RANTES mRNA+ cells were all increased in nonallergic CHS/NP compared to normal controls (P = 0.009, 0.0005, 0.0005, and 0.001, respectively). In comparison to allergic CHS/NP, nonallergic CHS/NP had a significantly higher tissue density of TNF-alpha (P = 0.04) and a lower density of IL-13 (P = 0.005) mRNA+ cells. In general, VCAM-1 expression correlated strongly in CHS/NP with the density of TNF-alpha (R = .91, P = 0.0005) but not the density of IL-1 beta, IL-13, or RANTES mRNA+ cells. We conclude that upregulation of VCAM-1 and elaboration of RANTES may contribute to the marked accumulation of eosinophils in nonallergic CHS/NP. TNF-alpha may play a critical role in VCAM-1 upregulation in this nonallergic eosinophilic disorder.

Previous studies in atopic dermatitis (AD) have shown that acute and chronic skin lesions are associated with a TH2-type profile of cytokine expression. IL-12 and IL-13 are recently described cytokines, which possess TH1-and TH2-like actions, respectively. We have used the technique of in situ hybridization to examine the expression of IL-12 and IL-13 messenger RNA in skin biopsy specimens of acute and chronic skin lesions and uninvolved skin from patients with AD. When compared with normal control skin, the acute and chronic skin lesions and unaffected skin from patients with AD had significantly greater numbers of cells that were positive for IL-13 mRNA (p < 0.05). Acute AD skin lesions expressed a higher number of positive cells than those observed in chronic AD skin lesions (p < 0.05) or psoriasis skin lesions (p < 0.05) There was a significant increase in the numbers of IL-12 mRNA-positive cells in chronic skin lesions compared with acute lesions and uninvolved skin from patients with AD (p < 0.05). These data demonstrate that acute AD skin lesions are associated with an increased expression of IL-13 mRNA. In contrast, the relative increase in IL-12 mRNA in chronic AD skin lesions suggests a possible role for IL-12-producing cells in modulating chronic inflammation.

Human immunodeficiency virus type I encodes a regulatory protein, termed Rev, which is associated with the appearance of unspliced and partially spliced viral RNAs in the cytoplasm. Rev is believed to function via interaction with a sequence element in the env region of the viral RNA, termed the Rev-responsive element (RRE). In this study, we use a stably transfected, Rev-producing mouse cell line to show that low, functional levels of Rev are associated with the nuclear scaffold (NS). Immunohistochemical studies localize Rev to the NS. Furthermore, immunoblot analyses demonstrate the presence of Rev in NS preparations isolated from Rev-producing cells and document binding of purified Rev protein to isolated NS or to cloned lamin C in vitro. Results with an in vitro RNA transport assay suggest that Rev is associated with a significant defect in transport of RNAs which lack RRE, whereas transport of RRE-containing transcripts proceeds efficiently. This Rev-induced transport defect appears to be mediated via direct inhibition of NS nucleoside triphosphatase, an enzyme thought to be involved in the nucleocytoplasmic transport process. NS preparations isolated from Rev-producing cells show a significantly lower nucleoside triphosphatase activity than those from control preparations. Addition of Rev protein to isolated NS produces a significant inhibition of NS nucleoside triphosphatase activity, which is specifically reversed by addition of RRE transcripts. These data suggest that a major aspect of Rev function may involve selective modulation of host cell nucleocytoplasmic transport mechanisms via interaction with the NS.

Micronuclei of peripheral blood lymphocytes of 66 smokers and 88 non-smokers in healthy person were determined. The result is that the average presence rate of micronuclei is markedly higher in the former group than in the latter (P less than 0.01). The lymphocytes of micronuclei of peripheral blood in smokers also increased. This shows that there are more chromosome aberrations in the smokers. The practical value of this investigation and the mutagenic mechanism of the smoke and also discussed.

Based on the septocutaneous artery flap concept, the thigh, which is the commonest conventional donor site for split-skin grafts, can also become a donor area for skin flaps. The thigh flap, with its large and long neuro-vascular pedicle, can be used either as a free flap or as an island flap as an alternative to the lower abdominal flap, groin flap, tensor fasciae latae myocutaneous flap, sartorius myocutaneous flap or the gracilis myocutaneous flap. The anatomical basis, operative technique and characteristics of the thigh flap are discussed.