Search

Dua Hammash,1,2 Mona Mahfood,3 Ghalia Khoder,4 Munazza Ahmed,1,2 Abdelaziz Tlili,3 Rifat Hamoudi,2,5,6 Rania Harati1,2 1Department of Pharmacy Practice and Pharmacotherapeutics, College of Pharmacy, University of Sharjah, Sharjah, United Arab Emirates; 2Sharjah Institute for Medical Research, University of Sharjah, Sharjah, United Arab Emirates; 3Department of Applied Biology, College of Sciences, University of Sharjah, Sharjah, United Arab Emirates; 4Department of Pharmaceutics and Pharmaceutical Technologies, College of Pharmacy, University of Sharjah, Sharjah, United Arab Emirates; 5Clinical Sciences Department, College of Medicine, University of Sharjah, Sharjah, United Arab Emirates; 6Division of Surgery and Interventional Science, University College London, London, UKCorrespondence: Rania Harati, Department of Pharmacy Practice and Pharmacotherapeutics, College of Pharmacy, University of Sharjah, Sharjah, United Arab Emirates, Tel +971 6 505 7438, Fax +971 6 558 5812, Email rharati@sharjah.ac.aeBackground: Most breast cancer-related deaths result from metastasis. Understanding the molecular basis of metastasis is needed for the development of effective targeted and preventive strategies. Matrix metalloproteinase-1 (MMP1) plays an important role in brain metastasis (BM) of triple-negative breast cancer (TNBC) by promoting extravasation of cancer cells across the brain endothelium (BE). MMP1 expression is controlled by endogenous microRNAs. Preliminary bioinformatics analysis has revealed that miR-623, known to target the 3ʹUTR of MMP1, is significantly downregulated in brain metastatic tumors compared to primary BC tumors. However, the involvement of miR-623 in MMP1 upregulation in breast cancer brain metastatic cells (BCBMC) remains unexplored. Here, we investigated the role of miR-623 in MMP1 regulation and its impact on the extravasation of TNBC cells through the BE in vitro.Materials and Methods: A loss-and-gain of function method was employed to address the effect of miR-623 modulation on MMP1 expression. MMP1 regulation by miR-623 was investigated by real-time PCR, western blot, luciferase and transwell migration assays using an in vitro human BE model.Results: Our results confirmed that brain metastatic TNBC cells express lower levels of miR-623 compared with cells having low propensity to spread toward the brain. miR-623 binds to the 3′-untranslated region of MMP1 transcript and downregulates its expression. Restoring miR-623 expression significantly decreased MMP1 expression, preserved the endothelial barrier integrity, and attenuated transmigration of BCBMC through the BE.Conclusion: Our study elucidates, for the first time, the crucial role of miR-623 as MMP1 direct regulator in BCBMC and sheds light on miR-623 as a novel therapeutic target that can be exploited to predict and prevent brain metastasis in TNBC. Importantly, the presents study helps in unraveling a brain metastasis-specific microRNA signature in TNBC that can be used as a guide to personalized metastasis prediction and preventive approach with better therapeutic outcome.Keywords: brain metastasis, triple-negative breast cancer, brain endothelium, brain endothelial junctions, matrix metalloproteinase-1, microRNA-623, personalized preventive therapy, targeted prevention, metastasis prediction, precision medicine, primary and secondary care

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE; OMIM 603041) is a rare inherited metabolic disorder mostly caused by mutations in TYMP gene encoding thymidine phosphorylase (TP) protein that affects the mitochondrial nucleotide metabolism. TP, functionally active as a homodimer, is involved in the salvage pathway of pyrimidine nucleosides. MNGIE-like syndrome having an overlapping phenotype of MNGIE was also described and has been associated with mutations in POLG and RRM2B genes. In the present study, we report the molecular investigation of a consanguineous family including two patients with clinical features suggestive of MNGIE syndrome. Bioinformatics analyses were carried out in addition to mtDNA deletion screening and copy number quantification in the blood of the two patients. Whole exome sequencing and Sanger sequencing analyses revealed the segregation in the affected family a novel mutation c.1205TA (p.L402Q) within the exon 9 of the TYMP gene. In addition, mtDNA analysis revealed the absence of mtDNA deletions and a decrease of the copy number in the blood of the two patients of the studied family. The p.Leu402Gln mutation was located in a conserved amino acid within the α/β domain of the TP protein and several software supported its pathogenicity. In addition, and based on docking and molecular dynamic simulation analyses, results revealed that L402Q caused a conformational change in TP mutated structure and could therefore alter its flexibility and stability. These changes prevent also the formation of stable homodimer leading to non-functional protein with partial or complete loss of its catalytic activity.

Progressive encephalopathy with brain edema and/or leukoencephalopathy, PEBEL1, is a severe neurometabolic disorder characterized by rapidly progressive neurologic deterioration associated with a febrile illness. PEBEL1 is a lethal encephalopathy caused by NAXE gene mutations. Here we report a 6-month-old boy with mitochondrial encephalomyopathy from a consanguineous family. Molecular analysis was performed using whole-exome sequencing followed by segregation analysis. In addition, in silico prediction tools and molecular dynamic approaches were used to predict the structural effect of the mutation. Furthermore, molecular docking of the substrate NADP in both wild-type and mutated NAXE protein was carried out. Molecular analysis revealed the presence of the novel homozygous mutation c.641 T A (p. Ile214Asn) in the NAXE gene, located at the NAD (P)H hydrate epimerase domain. In addition, bioinformatics analyses and molecular dynamics revealed that p. Ile214Asn mutation could affect the structure, stability, and compactness of the NAXE protein. Moreover, the result of the molecular docking showed that the p. Ile214Asn mutation leads to conformational changes in the catalytic cavity, thus modifying interaction with the substrate and restricting its access. We also compared the phenotype of our patient with those of previously reported cases with PEBEL syndrome. All bioinformatics findings provide evidence that the NAXE variant Asn214 disrupts NAXE protein functionality leading to an insufficient NAD (P)HX repair system and the development of clinical features of PEBEL1 syndrome in our patient. To our knowledge, our case is the 21st case of PEBEL1 patient worldwide and the first case in North Africa.

Graphical abstract, Introduction Hearing impairment (HI) is characterized by complex genetic heterogeneity. The evolution of next generation sequencing, including targeted enrichment panels, has revolutionized HI diagnosis. Objectives In this study, we investigated genetic causes in 22 individuals with non-GJB2 HI. Methods We customized a HaloplexHS kit to include 30 genes known to be associated with autosomal recessive nonsyndromic HI (ARNSHI) and Usher syndrome in North Africa. Results In accordance with the ACMG/AMP guidelines, we report 11 pathogenic variants; as follows; five novel variants including three missense (ESRRB-Tyr295Cys, MYO15A-Phe2089Leu and MYO7A-Tyr560Cys) and two nonsense (USH1C-Gln122Ter and CIB2-Arg104Ter) mutations; two previously reported mutations (OTOF-Glu57Ter and PNPT1-Glu475Gly), but first time identified among Tunisian families; and four other identified mutations namely WHRN-Gly808AspfsX11, SLC22A4-Cys113Tyr and two MYO7A compound heterozygous splice site variants that were previously described in Tunisia. Pathogenic variants in WHRN and CIB2 genes, in patients with convincing phenotype ruling out retinitis pigmentosa, provide strong evidence supporting their association with ARNSHI. Moreover, we shed lights on the pathogenic implication of mutations in PNPT1 gene in auditory function providing new evidence for its association with ARNSHI. Lack of segregation of a previously identified causal mutation OTOA-Val603Phe further supports its classification as variant of unknown significance. Our study reports absence of otoacoustic emission in subjects using bilateral hearing aids for several years indicating the importance of screening genetic alteration in OTOF gene for proper management of those patients. Conclusion In conclusion, our findings do not only expand the spectrum of HI mutations in Tunisian patients, but also improve our knowledge about clinical relevance of HI causing genes and variants.

Extravasation of triple-negative (TN) metastatic breast cancer (BC) cells through the brain endothelium (BE) is a critical step in brain metastasis (BM). During extravasation, metastatic cells induce alteration in the inter-endothelial junctions and transmigrate through the endothelial barrier. Transmigration of metastatic cells is mediated by the upregulation of cyclooxygenase-2 (COX-2) that induces matrix metalloproteinase-1 (MMP-1) capable of degrading inter-endothelial junctional proteins. Despite their important role in BM, the molecular mechanisms upregulating COX-2 and MMP-1 in TNBC cells remain poorly understood. In this study, we unraveled a synergistic effect of a pair of micro-RNAs (miR-26b-5p and miR-101-3p) on COX-2 expression and the brain transmigration ability of BC cells. Using a gain-and-loss of function approach, we modulated levels of miR-26b-5p and miR-101-3p in two TNBC cell lines (the parental MDA-MB-231 and its brain metastatic variant MDA-MB-231-BrM2), and examined the resultant effect on COX-2/MMP-1 expression and the transmigration of cancer cells through the BE. We observed that the dual inhibition of miR-26b-5p and miR-101-3p in BC cells results in higher increase of COX-2/MMP-1 expression and a higher trans-endothelial migration compared to either micro-RNA alone. The dual restoration of both micro-RNAs exerted a synergistic inhibition on COX-2/MMP-1 by targeting COX-2 and potentiated the suppression of trans-endothelial migration compared to single micro-RNA. These findings provide new insights on a synergism between miR-26-5p and miR-101-3p in regulating COX-2 in metastatic TNBC cells and shed light on miR-26-5p and miR-101-3p as prognostic and therapeutic targets that can be exploited to predict or prevent BM.

The development of next generation sequencing techniques has facilitated the detection of mutations at an unprecedented rate. These efficient tools have been particularly beneficial for extremely heterogeneous disorders such as autosomal recessive non-syndromic hearing loss, the most common form of genetic deafness. GJB2 mutations are the most common cause of hereditary hearing loss. Amongst them the NM_004004.5: c.506G > A (p.Cys169Tyr) mutation has been associated with varying severity of hearing loss with unclear segregation patterns. In this study, we report a large consanguineous Emirati family with severe to profound hearing loss fully segregating the GJB2 missense mutation p.Cys169Tyr. Whole exome sequencing (WES), in silico, splicing and expression analyses ruled out the implication of any other variants and confirmed the implication of the p.Cys169Tyr mutation in this deafness family. We also show preliminary murine expression analysis that suggests a link between the TMEM59 gene and the hearing process. The present study improves our understanding of the molecular pathogenesis of hearing loss. It also emphasizes the significance of combining next generation sequencing approaches and segregation analyses especially in the diagnosis of disorders characterized by complex genetic heterogeneity.

MEGDEL syndrome is a rare recessive disorder, with about 100 cases reported worldwide, which is defined by 3-methylglutaconic aciduria (MEG), deafness (D), encephalopathy (E) and Leigh-like syndrome (L). When these manifestations were added to hepatopathy (H), the syndrome was labelled as MEGD(H)EL. Mutations in SERAC1 gene encoding a serine active site containing 1 protein were described in patients affected by this syndrome.The present study reports the Whole Exome Sequencing (WES) of the first case of MEGDEHL syndrome in Tunisia in a consanguineous family with three affected children. Bioinformatic analysis was also performed in addition to mtDNA deletion screening and mtDNA copy number quantification in the blood of the indexed case, carried out, respectively by Long-Range PCR and qPCR.The WES revealed a novel homozygous nonsense mutation (c.1379G A; p.W460X) in the SERAC1 gene, which was confirmed by Sanger sequencing. This nonsense mutation was present at a homozygous state in the three affected children and was heterozygous in the parents. In silico analysis using various softwares was performed, and the predictive results supported the pathogenic effect of the identified mutation. Further, long-range PCR and qPCR analyses of the patient's blood excluded any mtDNA deletions or depletions.Sequencing results and bioinformatic tools confirmed that the novel mutation (p.W460X) in the SERAC1 gene causes the severe phenotype in the studied family with MEGDEHL syndrome.

Hearing loss (HL) is the most prevalent sensory disorder whose etiology comes from environmental and/or genetic factors. Approximately 60 % of HL cases are due to mutations in genes responsible for maintaining a normal hearing function. Despite the monogenic inheritance of hereditary hearing loss (HHL), its diagnosis is challenging as both clinical and genetic heterogeneity characterizes it. Through the development of next-generation sequencing (NGS) techniques, the number of identified mutations responsible for HHL has increased exponentially during the last decade. Mutations in the

Background: Autosomal recessive disorders are the most common forms of hereditary diseases in consanguineous populations. Despite their frequencies, the diagnosis of these disorders continues to be a challenging task, given their extreme genetic heterogeneities. However, since the discovery of next-generation sequencing-based techniques, the number of pathogenic mutations linked to autosomal recessive disorders has increased dramatically due to the time and cost-effectiveness of these methods. Succinyl-CoA: 3-ketoacid CoA transferase (SCOT) deficiency is considered as one of these rare autosomal recessive genetic disorders. Aim and Objectives: In the present study, we aimed to identify the responsible mutation in a UAE family with autosomal recessive SCOT deficiency. Materials and Methods: Whole-exome sequencing was performed in the affected individual. Sanger sequencing was used to confirm the existence and the segregation of the novel pathogenic mutation. Real-time polymerase chain reaction (PCR) was used to measure the expression of the OXCT1 gene in the mRNA of affected, carrier and normal individuals. Results: Our analysis revealed a new frameshift mutation. Sanger sequencing confirmed its homozygosity in the patient and its cosegregation with the disease in the studied family. Using real-time PCR, we showed that this new frameshift mutation affects the OXCT1-mRNA by nonsense-mediated mRNA decay (NMD). Conclusion: To the best of our knowledge, this is the first study associating SCOT deficiency with an OXCT1 frameshift mutation in the world. In addition, we report for the first time by studying this new OXCT1 mutation evidence for an NMD effect associated with SCOT mutations.

Background: Nonsyndromic hearing loss (NSHL) is a genetic disorder affecting many populations. Several genes are responsible for NSHL, and their contribution is different amongst ethnic groups. ESPN and ESRRB genes are responsible for the recessive DFNB36 and DFNB35 deafness forms, respectively. Aims and Objectives: In the present study, we aimed to identify the responsible mutations in two different UAE families with autosomal NSHL. Materials and Methods: Whole and clinical exomes sequencing were performed. Potential variants were verified by Sanger sequencing and PCR-RFLP. Bioinformatics tools were used to predict the impact of the new mutations. Results: In two UAE families, whole and clinical exomes sequencing generated several DNA variants. Sanger sequencing, segregation and bioinformatics analyses revealed two new homozygous mutations responsible for deafness. These two novel mutations are ESPN c.2257T>C and ESRRB c.10583 C>A. Conclusion: This study reports for the first time new mutations within ESPN and ESRRB genes responsible for NSHL in the Middle East region.

Palmoplantar keratoderma (PPK) is a heterogenous group of skin disorders characterized by a persistent thickening of the palms of the hands and sometimes soles of the feet. PPK can be classified into many types, including diffuse, transgradient, and focal or striate, where the areas of palmoplantar skin are alternatively thickened. Mutations in four main genes, keratin 9 (KRT9), keratin 1 (KRT1), desmoglein (DSG1), and desmoplakin (DSP), have been associated with PPK. Striate PPK (SPPK) is commonly caused by mutations in DSG1. However, DSP and KRT1 gene mutations have been identified in some cases. In this study, fragment and sequencing analysis were performed for a large Syrian family with dominant SPPK. Segregation analysis showed a linkage with DSG1 gene. Direct Sanger sequencing identified a new mutation c.dup165_168AGCA. This frameshift mutation was heterozygous in all affected family members and absent in all normal individuals.

Hereditary hearing impairment (HI) is a common disease with the highest incidence among sensory defects. Several genes have been identified to affect stereocilia structure causing HI, including the unconventional myosin3A. Interestingly, we noticed that variants in

In this work we present a fast and label-free technique for biomolecules detection. The approach has been proved to be powerful to investigate small DNA mutation. Surface enhanced Raman spectroscopy (SERS) is an outstanding technique for DNA analyses by providing a specific fingerprint of chemical structure with a high sensitivity in a very short acquisition time. Homogeneous decoration of Silicon nanowires (SiNWs) by silver nanoparticles (Ag-NPs) was carried out using pulsed laser deposition (PLD) technique. SiNWs have been synthesized via metal-assisted chemical etching (MACE) method. We investigate in this work the effect of the Ag-NPs nanodecoration conditions through the variation of the laser ablation pulses number (NLAP). Thus, the Ag-NPs decorated SiNWs were used as sensors to detect organic and biomolecules by means of Surface Enhanced Raman Spectroscopy (SERS). By varying the NLAP, we were able to identify the optimal combination of Ag-NPs' size and surface coverage that yields the highest SERS signal. SEM images revealed well-ordered SiNWs (~2.4 μm-long and 30–60 nm diam.) with their uniform decoration by Ag-NP. High resolution-TEM analyses confirmed the effective decoration of the SiNWs by Ag-NPs of which average size is found to increase linearly from ~20 to 50 nm when the NLAP is increased from 500 to 10,000. The Ag-NPs/SiNWs matrix shows significantly higher (150 fold) Raman signal compared to their Ag-NPs-decorated-flat‑silicon counterparts. We found that SERS efficiency is sensitive to the nanoparticles size and reaches its maximum of (1.6 × 106) for the Ag-NPs having the optimal diameter of ~40 nm (obtained at NLP = 5000). The developed sensor proved to be highly sensitive to detect upto pico-molar concentrations of R6G. These Ag-NPs/SiNWs probes were demonstrated to have outstanding potential for label free detection of DNA samples with high sensitivity and reproducibility. It was found that the developed nanohybrid sensor is able to differentiate DNAs with very small genetic sequence difference.

The past 30 years have seen an exponential growth concerning the identification of genes and variants responsible for hereditary hearing loss (HL) worldwide. This has led to a huge gain in our understanding of molecular mechanisms of hearing and deafness, which improved diagnosis for populations with hereditary HL. Many communities around the world, especially in the Middle East and North Africa, have a high prevalence of consanguineous marriages. Congenital monogenic conditions, such as recessive HL, are more common in these populations due to high consanguinity rates. Many studies have shown that high rates of consanguinity, endogamy, and first cousin marriages were observed in the six countries of the Gulf Cooperation Council (GCC). The intent of this study is to investigate the etiology of HL in the GCC region. A deep literature review of genes and variants responsible for HL in this region revealed 89 recessive DNA pathogenic variants reported in 138 cases/familial cases. A total of 21 genes responsible for non-syndromic hearing loss (NSHL) and 17 genes associated with syndromic hearing loss (SHL) were reported in cases from the GCC region. Out of 156 reported affected cases, 112 showed HL only, and 44 showed HL associated with other clinical manifestations. This data suggests that in the GCC region 72% of HL forms are non-syndromic and 28% are syndromic. For individuals with NSHL, 66% of variants were detected in four genes (GJB2, OTOF, TMC1 and CDH23), with a predominance of variants located in the GJB2 gene (37.5%). However, among SHL, Usher syndrome was the more frequent as it has been observed in 41% of the reported syndromic GCC cases. Finally, our analysis showed that HL genetics testing and research in the GCC region took advantage of the next generation sequencing (NGS)-based techniques, as approximately 58% of reported variants were identified using this technology.

Recently exploring bioanalytical instrumentation principles emphasized with combination of optics and EM fields in surface enhanced Raman spectroscopy (SERS). The principles favour the rapid detection of DNA with proper fabrication of SERS sensor. 1D semiconductor nanostructures (SiNWs) functionalization with plasmonic silver nanoparticles are fabricated by PLD process and exploited for SERS detection of DNA. The DNA nucleotide bands are indexed with reference to their Raman shift as Adenine (A), Guanine (G), Cytosine (C), Thymine (T) at Raman spectral regions of 1352 cm-1, 676 cm-1, 1625 cm-1, 1441 cm-1 respectively. The finest conditions for sensitive detection of DNA were investigated and their interaction mechanism are presented. The point-to-point reproducibility measurements imprinted higher degree of concordancy. The designed SERS sensor will be definitely helpful almost in all application fields with portable handheld Raman spectrophotometer in near future.

Hereditary hearing impairment (HI) is a common disease with the highest incidence among sensory defects. Several genes have been identified to affect stereocilia structure causing HI, including the unconventional myosin3A. Interestingly, we noticed that variants in MYO3A gene have been previously found to cause variable HI onset and severity. Using clinical exome sequencing, we identified a novel pathogenic variant p.(Lys50Arg) in the MYO3A kinase domain (MYO3A-KD). Previous in vitro studies supported its damaging effect as a ‘kinase-dead’ mutant. We further analyzed this variation through molecular dynamics which predicts that changes in flexibility of MYO3A structure would influence the protein-ATP binding properties. This Lys50Arg mutation segregated with congenital profound non-syndromic HI. To better investigate this variability, we collected previously identified MYO3A-KDs variants, p.(Tyr129Cys), p.(His142Gln) and p.(Pro189Thr), and built both wild type and mutant 3 D MYO3A-KD models to assess their impact on the protein structure and function. Our results suggest that KD mutations could either cause a congenital profound form of HI, when particularly affecting the kinase activity and preventing the auto-phosphorylation of the motor, or a late onset and progressive form, when partially or completely inactivating the MYO3A protein. In conclusion, we report a novel pathogenic variant affecting the ATP-binding site within the MYO3A-KD causing congenital profound HI. Through computational approaches we provide a deeper understanding on the correlation between the effects of MYO3A-KD mutations and the variable hearing phenotypes. To the best of our knowledge this is the first study to correlate mutations’ genotypes with the variable phenotypes of DFNB30. Communicated by Ramaswamy H. Sarma

Extravasation of triple-negative (TN) metastatic breast cancer (BC) cells through the brain endothelium (BE) is a critical step in brain metastasis (BM). During extravasation, metastatic cells induce alteration in the inter-endothelial junctions and transmigrate through the endothelial barrier. Transmigration of metastatic cells is mediated by the upregulation of cyclooxygenase-2 (COX-2) that induces matrix metalloproteinase-1 (MMP-1) capable of degrading inter-endothelial junctional proteins. Despite their important role in BM, the molecular mechanisms upregulating COX-2 and MMP-1 in TNBC cells remain poorly understood. In this study, we unraveled a synergistic effect of a pair of micro-RNAs (miR-26b-5p and miR-101-3p) on COX-2 expression and the brain transmigration ability of BC cells.Using a gain-and-loss of function approach, we modulated levels of miR-26b-5p and miR-101-3p in two TNBC cell lines (the parental MDA-MB-231 and its brain metastatic variant MDA-MB-231-BrM2), and examined the resultant effect on COX-2/MMP-1 expression and the transmigration of cancer cells through the BE.We observed that the dual inhibition of miR-26b-5p and miR-101-3p in BC cells results in higher increase of COX-2/MMP-1 expression and a higher trans-endothelial migration compared to either micro-RNA alone. The dual restoration of both micro-RNAs exerted a synergistic inhibition on COX-2/MMP-1 by targeting COX-2 and potentiated the suppression of trans-endothelial migration compared to single micro-RNA.These findings provide new insights on a synergism between miR-26-5p and miR-101-3p in regulating COX-2 in metastatic TNBC cells and shed light on miR-26-5p and miR-101-3p as prognostic and therapeutic targets that can be exploited to predict or prevent BM.

Brain metastases represent one of the incurable end stages in breast cancer (BC). Developing effective or preventive treatments is hampered by a lack of knowledge on the molecular mechanisms driving brain metastasis. Transmigration of BC cells through the brain endothelium is a key event in the pathogenesis of brain metastasis. In this study, we identified miR-101-3p as a critical micro-RNA able to reduce transmigration of BC cells through the brain endothelium. Our results revealed that miR-101-3p expression is downregulated in brain metastatic BC cells compared to less invasive variants, and varies inversely compared to the brain metastatic propensity of BC cells. Using a loss-and-gain of function approach, we found that miR-101-3p downregulation increased transmigration of BC cells through the brain endothelium in vitro by inducing COX-2 expression in cancer cells, whereas ectopic restoration of miR-101-3p exerted a metastasis-reducing effect. In regulatory experiments, we found that miR-101-3p mediated its effect by modulating COX-2-MMP1 signaling capable of degrading the inter-endothelial junctions (claudin-5 and VE-cadherin), key components of the brain endothelium. These findings suggest that miR-101-3p plays a critical role in the transmigration of breast cancer cells through the brain endothelium by modulating the COX-2-MMP1 signaling and thus may serve as a therapeutic target that can be exploited to prevent or suppress brain metastasis in human breast cancer.

Background The development of next generation sequencing-based techniques showed an important progress in the identification of pathogenic variants related to monogenetic diseases with genetic and phenotypic heterogeneities. Hereditary hearing loss is considered as one of these heterogeneous diseases, given the large number of deafness causing genes, the different modes of inheritance and the phenotypic variabilities associated to the severity, age of onset and/or presence or absence of other clinical manifestations. Material and methods In this study, we performed next-generation sequencing (NGS) in 51 UAE patients with hearing loss and no GJB2 mutations. In addition, we reviewed all reported SLC26A4 missense mutations with a confirmed DFNB4/Pendred syndrome phenotype and tried to find a genotype/phenotype correlation using different criteria. Results By analyzing the NGS data, we identified one new SLC26A4 variant c.1150G > C (p.Glu384Gln) and one known SLC26A4 mutation c.716T > A (p.Val239Asp) in two different patients. Direct Sanger sequencing and segregation analyses confirmed the implication of both DNA variants in the deafness phenotype. Moreover, the clinical examination of both patients showed that one patient has syndromic deafness (Pendred syndrome) and the second one has non-syndromic deafness. The analysis of all confirmed missense mutations didn't reveal a complete genotype/phenotype correlation. Conclusion To the best of our knowledge, this is the first report of mutations associated with DFNB4/Pendred deafness in the GCC region.

Introduction Hearing loss (HL) is a common sensory disorder over the world, and it has been estimated that genetic etiology is involved in more than 50% of the cases in developed countries. Both nuclear and mitochondrial genes were reported as responsible for hereditary HL. Mitochondrial mutations leading to HL have so far been reported in the MT-RNR1 gene, mitochondrially encoded 12S rRNA. Methods To study the molecular contribution of mitochondrial 12S rRNA gene mutations in UAE-HL, a cohort of 74 unrelated UAE patients with no gap junction protein beta 2 (GJB2) mutations were selected for mitochondrial 12S rRNA gene mutational screening using Sanger sequencing and whole-exome sequencing. Detected DNA variants were analyzed by bioinformatics tools to predict their pathogenic effects. Results Our analysis revealed the presence of two known deafness mutations; m.669T > C and m.827A > G in two different deaf individuals. Furthermore, whole-exome sequencing was done for these two patients and showed the absence of any nuclear mutations. Our study supports the pathogenic effect of the m.669T > C and m.827A > G mutations and showed that mitochondrial mutations have a contribution of 2.7% in our cohort. Conclusions This is the first report of mtDNA mutations in the UAE which revealed that both variants m.669T > C and m.827A > G should be included in the molecular diagnosis of patients with maternally inherited HL in UAE.

Intellectual disability (ID) often co-occurs with other neurologic phenotypes making molecular diagnosis more challenging particularly in consanguineous populations with the co-segregation of more than one ID-related gene in some cases. In this study, we investigated the phenotype of three patients from a large Tunisian family with significant ID phenotypic variability and microcephaly and performed a clinical exome sequencing in two cases. We identified, within the first branch, a homozygous variant in the TRAPPC9 gene (p.Arg472Ter) in two cases presenting severe ID, absent speech, congenital/secondary microcephaly in addition to autistic features, supporting the implication of TRAPPC9 in the “secondary” autism spectrum disorders and congenital microcephaly. In the second branch, we identified a homozygous variant (p.Lys189ArgfsTer15) in the CDK5RAP2 gene associated with an heterozygous TRAPPC9 variant (p.Arg472Ter) in one case harbouring primary hereditary microcephaly (MCPH) associated with an inter-hypothalamic adhesion, mixed hearing loss, selective thinning in the retinal nerve fiber layer and parafoveal ganglion cell complex, and short stature. Our findings expand the spectrum of the recently reported neurosensorial abnormalities and revealed the variable phenotype expressivity of CDK5RAP2 defect. Our study highlights the complexity of the genetic background of microcephaly/ID and the efficiency of the exome sequencing to provide an accurate diagnosis and to improve the management and follow-up of such patients.

BackgroundBrain metastasis (BM) is a major cause of morbidity and mortality in breast cancer (BC) and its molecular mechanism remains poorly understood. Transmigration of metastatic cells through the brain endothelium is an essential step in BM. Metalloproteinase-1 (MMP-1) overexpression plays a key role in promoting trans-endothelial migration by degrading the inter-endothelial junctions and disrupting the endothelial integrity. However, little is known about the molecular mechanisms that induce MMP-1 in metastatic cells granting them a brain invasive phenotype. MiR-202-3p is downregulated in brain metastases compared to primary breast tumors and directly targets MMP-1. Here, we unraveled a critical role of miR-202-3p loss in MMP-1 upregulation promoting transmigration of metastatic cells through the brain endothelium.MethodsA variant of the MDA-MB-231 human BC cell line (MDA-MB-231-BrM2) selected for its propensity to form brain metastases was found to express high levels of MMP-1 and low levels of miR-202-3p compared to the parental cells. Using a gain-and-loss of function approach, we modulated levels of miR-202-3p and examined the resultant effect on MMP-1 expression. Effect of miR-202-3p modulation on integrity of the brain endothelium and the transmigrative ability of BC cells were also examined.ResultsLoss of miR-202-3p in breast cancer cells enhanced their transmigration through the brain endothelium by upregulating MMP-1 and disrupting the inter-endothelial junctions (claudin-5, ZO-1 and ß-catenin). Restoring miR-202-3p exerted a metastasis-suppressive effect and preserved the endothelial barrier integrity.ConclusionsOur study identified a critical regulatory role of miR-202-3p in brain metastasis and shed light on miR-202-3p/MMP-1 axis as a novel prognostic and therapeutic target that can be exploited to predict and prevent brain metastasis in breast cancer patients.

Autosomal recessive nonsyndromic hearing loss (ARNSHL) is the most common form of hereditary deafness. Despite its frequency, the diagnosis of this disorder continues to be a challenging task given its extreme genetic heterogeneity. The purpose of this study was to identify the causative mutation in a consanguineous United Arab Emirates (UAE) family with ARNSHL.Clinical exome sequencing (CES) followed by segregation analysis via Sanger sequencing was used to identify the causative mutation. In addition, 109 deaf individuals and 50 deafness-free controls from the UAE population were screened for the identified mutation.CES identified the STRC frameshift mutation c.4510del (p.Glu1504Argfs*32) as the causative mutation in this family. Moreover, segregation analysis confirmed the above finding. In addition, the absence of this variant in 109 unrelated deaf individuals and 50 healthy controls indicates that it is rare in the UAE population.The present study represents the first STRC mutation reported in the UAE population. It also reinforces the power of next-generation sequencing in the diagnosis of heterogenous disorders such as nonsyndromic hearing loss.

Clarin-1, a tetraspan-like membrane protein defective in Usher syndrome type IIIA (USH3A), is essential for hair bundle morphogenesis in auditory hair cells. We report a new synaptic role for clarin-1 in mouse auditory hair cells elucidated by characterization of Clrn1 total (Clrn1(ex4-/-)) and postnatal hair cell-specific conditional (Clrn1(ex4fl/fl) Myo15-Cre(+/-)) knockout mice. Clrn1(ex4-/-) mice were profoundly deaf, whereas Clrn1(ex4fl/fl) Myo15-Cre(+/-) mice displayed progressive increases in hearing thresholds, with, initially, normal otoacoustic emissions and hair bundle morphology. Inner hair cell (IHC) patch-clamp recordings for the 2 mutant mice revealed defective exocytosis and a disorganization of synaptic F-actin and Ca(V)1.3 Ca2+ channels, indicative of a synaptopathy. Postsynaptic defects were also observed, with an abnormally broad distribution of AMPA receptors associated with a loss of afferent dendrites and defective electrically evoked auditory brainstem responses. Protein-protein interaction assays revealed interactions between clarin-1 and the synaptic Ca(V)1.3 Ca2+ channel complex via the Ca-V beta(2) auxiliary subunit and the PDZ domain-containing protein harmonin (defective in Usher syndrome type IC). Cochlear gene therapy in vivo, through adeno-associated virus-mediated Clrn1 transfer into hair cells, prevented the synaptic defects and durably improved hearing in Clrn1(ex4fl/fl) Myo15-Cre(+/-) mice. Our results identify clarin-1 as a key organizer of IHC ribbon synapses, and suggest new treatment possibilities for USH3A patients.

In order to determine the consequence of ILDR1 reported mutations on splicing and translation initiation, we used Human Splicing Finder (version 3.0) (http://www.umd.be/HSF3/) and ORF finder (http://www.geneinfinity.org/sms/sms_orffinder.html) respectively.

Sequencing library construction, exome capture, sequencing, and standard data analyses for the affected children in this family was performed bySengenics. Exome capturing and enrichment was carried out using SureSelect All ExonV5kit (Agilent Technologies, Santa Clara, CA, USA) following the manufacturers' protocols. Whole exome sequencing was carried out on Illumina HiSeq2500system (Illumina, San Diego, CA, USA). Paired end (2×100 bases) DNA sequence reads that passed the quality control i.e phred score > 20 were mapped to the human reference genome build hg19/GRCh37 using the BWA (Li, Durbin 2010) and SAM tools (Li, Handsaker et al. 2009) was used for processing BAM files. Genome analysis tool kit (GATK) v2.7.2 ) (McKenna, Hanna et al. 2010) was used for calling variants from BAM files. Variants were annotated with gene, existing variations, consequences from dbSNP (build 137), SIFT v5.0.2 (Kumar, Henikoff et al. 2009) and polyphen v2.2.2 (Adzhubei, Schmidt et al. 2010) using Ensembl Variant Effect Predictor v73 (VEP) (McLaren, Pritchard et al. 2010). Known variants were annotated by dbSNP and unannotated variants with serious predicted consequences were identified based on SIFT and polyphen which were considered as novel variants. Variants were filtered for increased accuracy using following steps: a) variants were filtered at the read depth (DP) >= 10 b) Variants with >10% i.e > 0.1 minor allele frequency based on 1000 Genome project ((http://www.1000genomes.org/data) References: ADZHUBEI, I.A., SCHMIDT, S., PESHKIN, L., RAMENSKY, V.E., GERASIMOVA, A., BORK, P., KONDRASHOV, A.S. and SUNYAEV, S.R., 2010. A method and server for predicting damaging missense mutations. Nature methods, 7(4), pp. 248-249. KUMAR, P., HENIKOFF, S. and NG, P.C., 2009. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nature protocols, 4(7), pp. 1073-1081. LI, H. and DURBIN, R., 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics (Oxford, England), 26(5), pp. 589-595. LI, H., HANDSAKER, B., WYSOKER, A., FENNELL, T., RUAN, J., HOMER, N., MARTH, G., ABECASIS, G., DURBIN, R. and 1000 GENOME PROJECT DATA PROCESSING SUBGROUP, 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, England), 25(16), pp. 2078-2079. MCKENNA, A., HANNA, M., BANKS, E., SIVACHENKO, A., CIBULSKIS, K., KERNYTSKY, A., GARIMELLA, K., ALTSHULER, D., GABRIEL, S., DALY, M. and DEPRISTO, M.A., 2010. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome research, 20(9), pp. 1297-1303. MCLAREN, W., PRITCHARD, B., RIOS, D., CHEN, Y., FLICEK, P. and CUNNINGHAM, F., 2010. Deriving the consequences of genomic variants with the Ensembl API and SNP Effect Predictor. Bioinformatics (Oxford, England), 26(16), pp. 2069-2070.

The novel c.804delG mutation, occurring in the seventh exon of the ILDR1 gene, abolishes a FauI restriction site. The FauI restriction pattern of the exon7 fragment (1003 bp) was used to screen 50 deaf individuals and 120 unrelated healthy UAE individuals. Digestion of PCR products was performed according to manufacturer’s instructions (New England Biolabs, USA), followed by separation on 2% agarose gels.

Sanger sequencing was performed on available samples from all affected family members to determine whether the potential mutation in the causative gene co-segregated with the disease phenotype. In order to amplify exon 7 of the ILDR1 gene, we designed the following primers: ILDR1-7F: TTGATGTCCTGATTCTGAGG and ILDR1-7R: CTCTGTGGTGGAATGAGAGG. The amplified products were then purified using Wizard SV Gel and PCR Clean-up system (Promega, USA) and were consequently sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Thermo Fisher Scientific, USA). The resulting sequencing reactions were then purified and precipitated using Ethanol/EDTA/Sodium acetate precipitation method. Capillary sequencing was performed in a Genetic Analyzer 3500 (Applied Biosystems, Thermo Fisher Scientific, USA) and the data were analyzed using Sequencing Analysis software. The sequences were aligned with the published sequence of the ILDR1 gene (NM_001199799.1).

Pyridoxine-dependent epilepsy (PDE) is a rare autosomal recessive disorder characterized by seizures and therapeutic response to pharmacological dose of pyridoxine. Mutations in the ALDH7A1 gene, encoding α-aminoadipic semialdehyde (α-AASA) dehydrogenase (antiquitin), have been reported to cause PDE in most patients. In this study molecular analysis of seven PDE Tunisian patients revealed a common missense c.1364T>C mutation in the ALDH7A1 gene. The identification of a cluster of PDE pedigrees carrying the c.1364T>C mutation in a specific area raises the question of the origin of this mutation from a common ancestor. We carried out a genotype-based analysis by way of genotyping a new generated microsatellite marker within the ALDH7A1 gene. Genotype reconstruction of all affected pedigree members indicate that all c.1364T>C mutation carriers harbored the same allele, indicating a common ancestor. The finding of a founder effect in a rare disease is essential for the genetic diagnosis and the genetic counseling of affected PDE pedigrees in Tunisia.

Mitochondrial disease refers to a heterogeneous group of disorders resulting in defective cellular energy production due to dysfunction of the mitochondrial respiratory chain, which is responsible for the generation of most cellular energy. Because cardiac muscles are one of the high energy demanding tissues, mitochondrial cardiomyopathies is one of the most frequent mitochondria disorders. Mitochondrial cardiomyopathy has been associated with several point mutations of mtDNA in both genes encoded mitochondrial proteins and mitochondrial tRNA and rRNA. We reported here the first description of mutations in MT-ATP6 gene in two patients with clinical features of dilated mitochondrial cardiomyopathy. The mutational analysis of the whole mitochondrial DNA revealed the presence of m.1555A>G mutation in MT-RNR1 gene associated to the m.8527A>G (p.M>V) and the m.8392C>T (p.136P>S) variations in the mitochondrial MT-ATP6 gene in patient1 and his family members with variable phenotype including hearing impairment. The second patient with isolated mitochondrial cardiomyopathy presented the m.8605C>T (p.27P>S) mutation in the MT-ATP6 gene. The three mutations p.M1V, p.P27S and p.P136S detected in MT-ATP6 affected well conserved residues of the mitochondrial protein ATPase 6. In addition, the substitution of proline residue at position 27 and 136 effect hydrophobicity and structure flexibility conformation of the protein.

Pyridoxine-dependent Epilepsy (PDE) is a rare autosomal recessive disorder causing intractable seizures in neonates and infants. It is characterized by seizures that are resistant to common anticonvulsants, but patients respond well to the administration of pyridoxine. PDE is caused by ALDH7A1 genetic defect. Here, we report the disease-causative variant in the ALDH7A1 gene in two affected Tunisian families. Direct sequencing analysis revealed a novel missense mutation c.1364T>C (p.Leu455Pro). Using bioinformatic tools we suggested that this variant may have deleterious effects on ALDH7A1 protein structure and function.

We previously mapped the DFNB66 locus to an interval overlapping the DFNB67 region. Mutations in the LHFPL5 gene were identified as a cause of DFNB67 hearing loss (HL). However, screening of the coding exons of LHFPL5 did not reveal any mutation in the DFNB66 family. The objective of this study was to check whether DFNB66 and DFNB67 are distinctive loci and determining their contribution to HL. In the DFNB66 family, sequencing showed absence of mutations in the untranslated regions and the predicted promoter sequence of LHFPL5. Analysis of five microsatellites in the 6p21.31-22.3 region and screening of the LHFPL5 gene by DNA heteroduplex analysis in DHPLC revealed a novel mutation (c.89dup) in one out of 129 unrelated Tunisian families with autosomal recessive nonsyndromic (ARNS) HL. Our findings suggest that two distinct genes are responsible for DFNB66 and DFNB67 HL. These loci are likely to be a rare cause of ARNSHL.

Founder mutations, particularly 35delG in the GJB2 gene, have to a large extent contributed to the high frequency of autosomal recessive nonsyndromic hearing loss (ARNSHL). Mutations in transmembrane channel-like gene 1 (TMC1) cause ARNSHL. The p.R34X mutation is the most frequent known mutation in the TMC1 gene. To study the origin of this mutation and determine whether it arose in a common ancestor, we analyzed 21 polymorphic markers spanning the TMC1 gene in 11 unrelated individuals from Algeria, Iran, Iraq, Lebanon, Pakistan, Tunisia, and Turkey who carry this mutation. In nine individuals, we observed significant linkage disequilibrium between p.R34X and five polymorphic markers within a 220kb interval, suggesting that p.R34X arose from a common founder. We estimated the age of this mutation to be between 1075 and 1900 years, perhaps spreading along the third Hadramaout population movements during the seventh century. A second founder effect was observed in Turkish and Lebanese individuals with markers in a 920kb interval. Screening for the TMC1 p.R34X mutation is indicated in the genetic evaluation of persons with ARNSHL from North African and Southwest Asia.

In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA) and SGCG (c. (*) 102A/C) genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c. (*) 102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.