Search

The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting., (© 2024. The Author(s).)

Significance: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence., Purpose: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases., Case Reports: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism., Conclusions: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations., Competing Interests: Conflict of Interest Disclosure: None of the authors have reported a financial conflict of interest., (Copyright © 2024 American Academy of Optometry.)

Introduction: Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations., Methods: Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed., Results: We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease., Conclusion: Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis., (© 2023 The Author(s). Published by S. Karger AG, Basel.)

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation., Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143 . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations., Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia., Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes., (Copyright © 2023 Molecular Vision.)

Purpose: The aim of this systematic review was to investigate the available data on the epidemiology of oculocutaneous albinism (OCA) around the world, and to determine whether a generalizable, worldwide prevalence figure could be proposed., Methods: Extensive literature search strategies were conducted, interrogating PubMed, Scopus, and Web of Science, to locate relevant literature. Ultimately 34 studies reporting original data were included for analysis., Results: Findings showed that most data were outdated, and only 6 of 34 articles (18%) were published after 2010. There were few good studies with sound methodology and large, clearly defined population samples. Only a small proportion of countries worldwide (26/193 [13%]) have produced prevalence figures for OCA. By continent, African studies were disproportionately represented (15/34 [44%]). The highest prevalence rates (range, 1 in 22 to 1 in 1300; mean, 1 in 464) were reported in population isolates. The mean prevalence from four African countries was 1 in 4264 (range, 1 in 1755 to 1 in 7900). Prevalence for three countries in Europe (mean, 1 in 12,000; range, 1 in 10,000 to 1 in 15,000) may be underestimated, as the phenotype, in fair-skinned populations, may be missed or misdiagnosed as ocular albinism or isolated visual impairment. Population rates may vary depending on local cultural factors (e.g., consanguineous matings) and may change over time., Conclusions: The prevalence of OCA varies widely between continents and population groups, and it is often influenced by local factors. It was not possible, therefore, to determine a single, generalizable worldwide prevalence rate for OCA, although continental rates for Africa and Europe are useful.

Background: Oculocutaneous albinism (OCA) could be either non-syndromic or syndromic. There are significant challenges in clinically recognizing and differentiating Hermansky-Pudlak syndrome (HPS) from non-syndromic OCA., Materials and Methods: In a prospective consecutive case series, 63 patients (less than 18 years old) with a molecular genetic diagnosis of albinism (except OCA1A ), Ocular albinism (OA) and Hermansky-Pudlak syndrome seen over a 3-year period were evaluated and analyzed. Hair colour, iris colour was graded, compared and correlated with the degree of fundus pigmentation and foveal development., Results: A total of 63 patients were evaluated. Forty-five patients had non-syndromic OCA (11 OCA1B, 24 OCA2, 9 OCA4, and 1 OCA6), 5 patients had OA and 13 patients had HPS. All 3 BLOC-related HPS categories were seen (1 with BLOC1, 7 with BLOC-2 and 5 with BLOC-3 related HPS). All patients with OA were hyperopic, had darker fundus pigmentation, but had poor foveal development. All HPS patients had lighter fundus pigmentation. The degree of fundus pigmentation correlated positively with the iris pigmentation and also with the foveal development only in OCA2., Conclusions: Careful observation of the phenotype by comparison of the skin, hair, iris colour, with the degree of fundus pigmentation and foveal development may help clinically differentiate HPS from OCA patients of Chinese ethnicity even in the absence of any bleeding tendency.

The diagnostic yield of genetic testing for ocular/oculocutaneous albinism (OA/OCA) in a diverse pediatric population in the United States (U.S.) is unclear. Phenotypes of 53 patients who presented between 2006-2022 with OA/OCA were retrospectively correlated with genetic testing results. Genetic diagnostic yield was defined as detection of pathogenic/likely pathogenic variant(s) matching the anticipated inheritance for that gene-disease relationship. Variant reclassifications of those with variants of uncertain significance (VUS) and without positive diagnostic yield were completed. Overall initial genetic diagnostic yield of OA/OCA was 66%. There was no significant difference ( p = 0.59) between race and ethnicities (Black (78%), White (59%), Hispanic/Latino (64%)); however, the diagnostic yield of OA (33%) was significantly lower ( p = 0.007) than OCA (76%). Causative variants in OCA2 (28%) and TYR (20%) were most common. Further, Hermansky-Pudlak syndrome variants were identified in 9% of patients. Re-classification of VUS in non-diagnostic cases resulted in genetic diagnoses for 29% of individuals and increased overall diagnostic yield to 70% of all subjects. There is a high diagnostic yield of genetic testing of patients overall with OA/OCA in a diverse U.S. based pediatric population. Presence or absence of cutaneous involvement of albinism significantly affects genetic diagnostic yield.

Background: Albinism is a group of genetic disorders characterized by general skin and retinal hypopigmentation. It is in most cases an autosomal recessive condition. Foveal hypoplasia (FH) is one of the main criteria for the diagnosis of albinism. The aim of this study was to analyze the macular profile of the parents of patients with albinism., Methods: This study included a case series of 27 patients with albinism seen in Rothschild Foundation between April 2017 and February 2020. Spectral-domain optical coherence tomography (SD-OCT) and OCT angiography (OCT-A) were performed in every patient when possible and in every available parents. FH was graded according to Thomas' classification based on OCT. Next generation sequencing-based gene panel testing was performed in parents and children when a FH was detected on OCT in a parent., Results: Twenty-seven patients with albinism were examined. Nine parents had FH based on the OCT B-scan (33%). In parents without FH based on the SD-OCT B-scan (67%), OCT-A showed a reduced avascular zone in the deep vascular plexus in 4 parents. Six parents carried variants that could explain their phenotype, including TYR R402Q hypomorphic alleles., Conclusion: This study showed the presence of FH in parents of patients with albinism, and aimed to genetically explain this phenotype.

This case series details macular findings in three female siblings who were found to be carriers of a previously unreported splice mutation in GPR143 (X-linked ocular albinism [OA1]). Presumed lyonization is responsible for both the subtle and varied findings in OA1 carriers, even among siblings, and especially in patients with darker skin pigmentation. In this series, we used green-light autofluorescence to reveal subtle subfoveal involvement and used optical coherence tomography angiography to uncover previously unreported narrowing of the foveal avascular zone, consistent with foveal hypoplasia. [ Ophthalmic Surg Lasers Imaging Retina 2022;53:460-463.] .

Mutations in the GPR143 gene cause X-linked ocular albinism type 1 (OA1), a disease that severely impairs vision. We recently generated induced pluripotent stem cells (iPSCs) from skin fibroblasts of an OA1 patient carrying a point mutation in intron 7 of GPR143 . This mutation activates a new splice site causing the incorporation of a pseudoexon. In this study, we present a high-performance CRISPR-Cas ribonucleoprotein strategy to permanently correct the GPR143 mutation in these patient-derived iPSCs. Interestingly, the two single-guide RNAs available for SpCas9 did not allow the cleavage of the target region. In contrast, the cleavage achieved with the CRISPR-AsCas12a system promoted homology-directed repair at a high rate. The CRISPR-AsCas12a-mediated correction did not alter iPSC pluripotency or genetic stability, nor did it result in off-target events. Moreover, we highlight that the disruption of the pathological splice site caused by CRISPR-AsCas12a-mediated insertions/deletions also rescued the normal splicing of GPR143 and its expression level.

Purpose: To characterize the genotypic and phenotypic spectrum of foveal hypoplasia (FH)., Design: Multicenter, observational study., Participants: A total of 907 patients with a confirmed molecular diagnosis of albinism, PAX6, SLC38A8, FRMD7, AHR, or achromatopsia from 12 centers in 9 countries (n = 523) or extracted from publicly available datasets from previously reported literature (n = 384)., Methods: Individuals with a confirmed molecular diagnosis and availability of foveal OCT scans were identified from 12 centers or from the literature between January 2011 and March 2021. A genetic diagnosis was confirmed by sequence analysis. Grading of FH was derived from OCT scans., Main Outcome Measures: Grade of FH, presence or absence of photoreceptor specialization (PRS+ vs. PRS-), molecular diagnosis, and visual acuity (VA)., Results: The most common genetic etiology for typical FH in our cohort was albinism (67.5%), followed by PAX6 (21.8%), SLC38A8 (6.8%), and FRMD7 (3.5%) variants. AHR variants were rare (0.4%). Atypical FH was seen in 67.4% of achromatopsia cases. Atypical FH in achromatopsia had significantly worse VA than typical FH (P < 0.0001). There was a significant difference in the spectrum of FH grades based on the molecular diagnosis (chi-square = 60.4, P < 0.0001). All SLC38A8 cases were PRS- (P = 0.003), whereas all FRMD7 cases were PRS+ (P < 0.0001). Analysis of albinism subtypes revealed a significant difference in the grade of FH (chi-square = 31.4, P < 0.0001) and VA (P = 0.0003) between oculocutaneous albinism (OCA) compared with ocular albinism (OA) and Hermansky-Pudlak syndrome (HPS). Ocular albinism and HPS demonstrated higher grades of FH and worse VA than OCA. There was a significant difference (P < 0.0001) in VA between FRMD7 variants compared with other diagnoses associated with FH., Conclusions: We characterized the phenotypic and genotypic spectrum of FH. Atypical FH is associated with a worse prognosis than all other forms of FH. In typical FH, our data suggest that arrested retinal development occurs earlier in SLC38A8, OA, HPS, and AHR variants and later in FRMD7 variants. The defined time period of foveal developmental arrest for OCA and PAX6 variants seems to demonstrate more variability. Our findings provide mechanistic insight into disorders associated with FH and have significant prognostic and diagnostic value., (Copyright © 2022 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.)

Aim: The aim of this study was to detail the neurodevelopmental profile of subjects affected by ocular albinism (OA) and to collect data on GPR143 gene analysis., Design: The design of the study involves a retrospective longitudinal observational case series., Methods: We collected data on the neurodevelopmental profile of 13 children affected by OA from clinical annual assessments conducted for a period of 6 years after the first evaluation. We described visual profile, neuromotor development and neurological examination, cognitive profile, communication and language skills and behavioral characteristics. The GPR143 gene analysis was performed as well., Results: Children presented a variable combination of ocular and oculomotor disorders unchanged during the follow-up, a deficit in visual acuity and in contrast sensitivity that progressively improved. Abnormalities in pattern visual evoked potential were found. No deficits were detected at neurological examination and neuromotor development except for a mild impairment in hand-eye coordination observed in five cases. A language delay was observed in five cases, two of whom had also a developmental quotient delay at 2 years evolving to a borderline/deficit cognitive level at preschool age, difficulties in adaptive behavior and autistic-like features were found. Mutations in the GPR143 gene were identified in the two patients who presented the most severe clinical phenotype., Conclusion: Children with OA may share, in addition to a variable combination of ocular signs and symptoms, a neurodevelopment impairment regarding mostly the cognitive, communicative, and social area, especially those with GPR143 mutation., Competing Interests: None declared., (Thieme. All rights reserved.)

Purpose: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene., Methods: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants., Results: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%., Conclusions: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.

Background: The study aimed to describe genotype-phenotype associations in patients with oculocutaneous and ocular-only albinism and to evaluate a set of diagnostic criteria proposed recently by Kruijt et al., Materials and Methods: Genotype-phenotype associations in patients with a clinical diagnosis of albinism were studied based on imaging of hair and ocular features (nystagmus, iris color and translucency, fundus pigmentation and foveal development) and self-evaluated skin type. Patients were sub-grouped based on genetic findings., Results: Patients with biallelic variants in TYR (n = 29), OCA2 (n = 22), other albinism genes (n = 13) or monoallelic variants in GPR143 (n = 13) were included as were 15 patients with a pure clinical diagnosis but no genetic findings. In descending order the most common findings were: foveal hypoplasia (any hypoplasia 95.2%, severe 88.0%), nystagmus (93.5%), iris translucency (any translucency 80.2%, moderate to severe 31.5%), misrouting on VEP (80.0%): fundus hypopigmentation (any hypopigmentation: 75.8%, severe 30.1%), fair skin type (73.8%), blue irides (62.0%), blonde hair (57.5%), and unpigmented eye lashes (39.1%). There were no phenotypic differences between the different genetic subgroups of albinism but patients with a pathogenic haplotype in TYR in combination with a classic variant had less iris translucency than patients with two classic variants in TYR ., Conclusions: Ocular developmental features were the most common findings whereas phenotypic features related to pigmentation were less common findings but there were no genotype-phenotype correlations. All patients with a genetically confirmed diagnosis of albinism fulfilled the diagnostic criteria by Kruijt irrespective of genetic subtype.

Albinism encompasses a group of hereditary disorders characterized by reduced or absent ocular pigment and variable skin and/or hair involvement, with syndromic forms such as Hermansky-Pudlak syndrome and Chédiak-Higashi syndrome. Autosomal recessive oculocutaneous albinism (OCA) is phenotypically and genetically heterogenous (associated with seven genes). X-linked ocular albinism (OA) is associated with only one gene, GPR143 . We report the clinical and genetic outcomes of 44 patients, from 40 unrelated families of diverse ethnicities, with query albinism presenting to the ocular genetics service at Moorfields Eye Hospital NHS Foundation Trust between November 2017 and October 2019. Thirty-six were children (≤ 16 years) with a median age of 31 months (range 2-186), and eight adults with a median age of 33 years (range 17-39); 52.3% ( n = 23) were male. Genetic testing using whole genome sequencing (WGS, n = 9) or a targeted gene panel ( n = 31) gave an overall diagnostic rate of 42.5% (44.4% (4/9) with WGS and 41.9% (13/31) with panel testing). Seventeen families had confirmed mutations in TYR ( n = 9), OCA2 , ( n = 4), HPS1 ( n = 1), HPS3 ( n = 1), HPS6 ( n = 1), and GPR143 ( n = 1). Molecular diagnosis of albinism remains challenging due to factors such as missing heritability. Differential diagnoses must include SLC38A8 -associated foveal hypoplasia and syndromic forms of albinism.

Inherited retinal dystrophies (IRDs) are characterized by high clinical and genetic heterogeneity. A precise characterization is desirable for diagnosis and has impact on prognosis, patient counseling, and potential therapeutic options. Here, we demonstrate the effectiveness of the combination of in-depth retinal phenotyping and molecular genetic testing in complex pedigrees with different IRDs. Four affected Caucasians and two unaffected relatives were characterized including multimodal retinal imaging, functional testing, and targeted next-generation sequencing. A considerable intrafamilial phenotypic and genotypic heterogeneity was identified. While the parents of the index family presented with rod-cone dystrophy and ABCA4 -related retinopathy, their two sons revealed characteristics in the spectrum of incomplete congenital stationary night blindness and ocular albinism, respectively. Molecular testing revealed previously described variants in RHO , ABCA4 , and MITF as well as a novel variant in CACNA1F . Identified variants were verified by intrafamilial co-segregation, bioinformatic annotations, and in silico analysis. The coexistence of four independent IRDs caused by distinct mutations and inheritance modes in one pedigree is demonstrated. These findings highlight the complexity of IRDs and underscore the need for the combination of extensive molecular genetic testing and clinical characterization. In addition, a novel variant in the CACNA1F gene is reported associated with incomplete congenital stationary night blindness., Competing Interests: M.G. is employee and equity owner of F. Hoffmann-La Roche Ltd., Basel, Switzerland. The other authors report no conflict of interest.

Ocular albinism type 1 (OA1) is a genetic disorder characterized by reduced eye pigmentation and nystagmus, which is often accompanied by decreased visual acuity, strabismus and other symptoms, whereas skin and hair color remain normal. The present study aimed to assess the clinical features and perform genotype analysis of a family with OA1, and to determine the disease‑causing mutation. A total of 18 family members (nine affected patients and nine normal subjects) from Hainan, China, were recruited to the present study in December 2017. A detailed clinical ophthalmic examination was performed for all participants, including a visual acuity test, anterior segment slit lamp examination, eye fundus examination and optical coherence tomography. Mutations in the G protein‑coupled receptor 143 (GPR143) gene were determined by DNA sequencing assays and polymerase chain reaction assays for deletions; all exon coding sequences, exons at the 5'‑ and 3'‑ends, and non‑coding region sequences of intron splicing were assessed. Within the family, nine male patients exhibited disease occurrence at the age of 0‑6 months. All patients presented with different degrees of iris depigmentation, horizontal jerk nystagmus, foveal hypoplasia and reduced visual acuity. The fundus of only one patient exhibited choroid coloboma; in the remaining patients, their fundi exhibited different degrees of irregular retinal depigmentation. The mutation c.360+5G>T in the GPR143 gene was identified in this family. In conclusion, the present study identified the splicing mutation c.360+5G>T in the GPR143 gene in a Chinese family with OA1 and successfully identified the site. To the best of our knowledge, there have been no previous reports regarding this mutation in any major genome databases; therefore, this outcome may enrich the mutation spectrum of the GPR143 gene.

Purpose: Pathogenic variants of the G-protein coupled receptor 143 (GPR143) gene may result in Ocular albinism type I (OA1). In this study, we describe the clinical features and investigate the GPR143 gene mutations in six Chinese families with OA1 and evaluate the thickness changes of iris for the affected males and female carriers., Methods: Families were ascertained, and patients underwent complete ophthalmologic examinations, including the best corrected visual acuity (BCVA), anterior segment of the eyes, vitreous and fundus changes. Spectral domain optical coherence tomography (SD-OCT) was used to measure the full iris thickness, the stroma/anterior border (SAB) layer, and the posterior epithelial layer (PEL) at the pupillary and ciliary regions. DNA was extracted from the peripheral blood vessels after confirmed consent information. GPR143 gene was directly sequenced by the Sanger method., Results: The affected males had variable reduced visual acuity, nystagmus and macular hypoplasia. Four novel frameshift mutations and two previously reported missense/nonsense mutations in the GPR143 gene were detected in these families. The thickness of the iris was significantly reduced at the ciliary region in the affected males, compared with that in the normal controls and the female carriers., Conclusions: Pathogenic variants in the GPR143 gene may disturb the normal melanogenesis in the pigmented tissues of the eye, result in macular hypoplasia, and alter the thickness of the iris., (Copyright © 2019 Elsevier Ltd. All rights reserved.)

A 12 year-old boy who consulted due to nystagmus and low vision from birth. His mother also consulted for low vision of the right eye since she was a child, which worsened recently. The physical examination revealed no alterations in skin and hair pigmentation. In the examination of the anterior segment of the child, areas of slight circumferential hypopigmentation were observed in the iris in both eyes. The fundus examination revealed a choroidal fundus due to the absence of melanin in the retinal pigment epithelium. In the autofluorescence, an absence of physiological macular hypo-autofluorescence was observed and, in optical coherence tomography, foveal hypoplasia was observed in both eyes. In the ocular fundus examination of the mother, slight macular pigmentary changes were observed in the right eye, with hyperpigmented radiated spots in the retinal periphery of both eyes, which were hypo-autofluorescent in the wide-field autofluorescence. In the optical coherence tomography of the right eye, a cavitation of the outer retinal layers was observed in the fovea. The genetic study by nucleotide sequencing was performed on the mother and the child. In the mutation found in the GPR143 gene, the son was hemizygous and the mother was heterozygous. X-linked ocular albinism was diagnosed and the genetic counselling was carried out. Ocular albinism linked to X is the most frequent genetic variant of this disease. Peripheral pigment alterations in heterozygous mothers have been previously described in the literature, but there are no reports of cavitations in the external retinal layers using optical coherence tomography., (Copyright © 2019 Sociedad Española de Oftalmología. Publicado por Elsevier España, S.L.U. All rights reserved.)

In albinism of all species, perturbed melanin biosynthesis in the eye leads to foveal hypoplasia, retinal ganglion cell misrouting, and, consequently, altered binocular vision. Here, written before he died, Ray Guillery chronicles his discovery of the aberrant circuitry from eye to brain in the Siamese cat. Ray's characterization of visual pathway anomalies in this temperature sensitive mutation of tyrosinase and thus melanin synthesis in domestic cats opened the exploration of albinism and simultaneously, a genetic approach to the organization of neural circuitry. I follow this account with a remembrance of Ray's influence on my work. Beginning with my postdoc research with Ray on the cat visual pathway, through my own work on the mechanisms of retinal axon guidance in the developing mouse, Ray and I had a continuous and rich dialogue about the albino visual pathway. I will present the questions Ray posed and clues we have to date on the still-elusive link between eye pigment and the proper balance of ipsilateral and contralateral retinal ganglion cell projections to the brain., (© 2019 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.)

Background: Congenital nystagmus is one of the most common neuro-ophthalmological disorders. X chromosome-linked forms are associated with pathogenic variants of the GPR143 and FRMD7 genes., Materials and Methods: Patients' DNA was analyzed using a next-generation sequencing (NGS) panel of genes involved in albinism and related pathologies (TYR, OCA2, TYRP1, SLC45A2, SLC24A5, C10ORF11, GPR143, SLC38A8, HPS 1 to 10, LYST, MITF, FRMD7) Results: We report a 4 generation family with 5 affected members initially referred for molecular diagnosis of ocular albinism. A missense variant of FRMD7 was found in 3 affected cases and one female carrier. We show that the disease in the affected girl is due to skewed inactivation of the X chromosome., Conclusions: By compiling all the published cases we discuss the variable penetrance among females due to different types of mutation and to X-inactivation.

Oculocutaneous albinism (OCA) is a genetically heterogeneous disorder. Six genes are associated with autosomal recessive OCA (TYR, OCA2, TYRP1, SLC45A2, SLC24A5 and LRMDA), and one gene, GPR143, is associated with X-linked ocular albinism (OA). Molecular genetic analysis provides a genetic diagnosis in approximately 60% of individuals with clinical OA/OCA. A considerably number of the remaining 40% are heterozygous for a causative sequence variation in TYR. To identify missing causative sequence variants in these, we used a NGS based approach, genotyping and segregation analysis. We report two putative pathogenic haplotypes which only differ by two extremely rare SNVs, indicating that the haplotypes have a common derivation. Both haplotypes segregate consistent with an autosomal recessive inheritance pattern and include the allele p.S192Y-p.R402Q. An explanation for the pathogenicity of the haplotypes could be the combination of p.S192Y and p.R402Q. Homozygosity for the pathogenic haplotypes causes a partial albinism phenotype. In our cohort, 15% of affected individuals had a molecular genetic diagnosis involving the pathogenic haplotype. Consequently, the prevalence of albinism seems to be substantially underestimated, and children with unexplained bilateral subnormal vision and/or nystagmus should be analysed clinically and molecularly for albinism.

Albinism, typically characterized by decreased melanin synthesis, is associated with significant visual deficits owing to developmental changes during neurosensory retina development. All albinism is caused by genetic mutations in a group of diverse genes including enzymes, transporters, G-protein coupled receptor. Interestingly, these genes are not expressed in the neurosensory retina. Further, regardless of cause of albinism, all forms of albinism have the same retinal pathology, the extent of which is variable. In this review, we explore the possibility that this similarity in retinal phenotype is because all forms of albinism funnel through the same final common pathway. There are currently seven known genes linked to the seven forms of ocular cutaneous albinism. These types of albinism are the most common, and result in changes to all pigmented tissues (hair, skin, eyes). We will discuss the incidence and mechanism, where known, to develop a picture as to how the mutations cause albinism. Next, we will examine the one form of albinism which causes tissue-specific pathology, ocular albinism, where the eye exhibits the retinal albinism phenotype despite near normal melanin synthesis. We will discuss a potential way to treat the disease and restore normal retinal development. Finally, we will briefly discuss the possibility that this same pathway may intersect with the most common cause of permanent vision loss in the elderly., (© 2018 Wiley Periodicals, Inc.)

Ocular albinism type 1 (OA1) is an X-linked inherited disease characterized by impaired visual acuity, congenital nystagmus, foveal hypoplasia, hypopigmentation of iris and fundus. It is caused by mutations in the G protein-coupled receptor143 ( GPR143 ) gene. The genetic characteristics of OA1 have not been well defined in Asians. In this study, six members from three consecutive generations of a Korean family with OA1 were enrolled. We performed whole-exome sequencing followed by validation and segregation analysis. Two affected patients underwent detailed ophthalmic examinations and eye movement recordings. Of the two affected males, the proband had all classical phenotypes of OA1, but the other showed isolated foveal hypoplasia without nystagmus. We identified a hemizygous missense (c.623C > A, p.Ala208Glu) mutation of GPR143 in affected males. This mutation was also present as heterozygous in two obligate female carriers, and was not found in unaffected members. Our data expands thespectrum of phenotypes and genotype in GPR143 in Asians, and highlights the phenotypic heterogeneity in OA1.

Ocular albinism type 1 is a genetic eye disease caused by mutations in the GPR143 gene. Little is known about the molecular pathways involved in this disease and no therapeutic candidate has been identified as yet. Here we report the generation of an iPSC line from the skin fibroblasts of a patient with a mutation in the GPR143 gene using Sendai Virus vectors. This new iPSC line will allow a better understanding of the Ocular Albinism type 1 disease and to screen for potential therapeutic candidates., (Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.)

Ocular albinism type 1 (OA1) is caused by mutations in the GPR143 gene located at Xp22.2. The manifestations, which are due to hypopigmentation, are confined to the eyes and optic pathway. OA1 associated with late-onset sensorineural hearing loss was previously reported in a single family and hypothesized to be caused by a contiguous gene deletion syndrome involving GPR143 and the adjacent gene, TBL1X. Here, we report on a family with OA1, infertility, late-onset sensorineural hearing loss, and a small interstitial Xp microdeletion including the GPR143, TBL1X, and SHROOM2 genes. In addition, we re-examined a patient previously described with OA1, infertility and a similar Xp deletion with audiologic follow-up showing a late-onset sensorineural hearing loss. Our results raise an intriguing question about the possibility for TBL1X (absence) involvement in this type of hearing loss. However, our study cannot claim a causative relationship and more convincing evidence is needed before the hypothesis can be accepted that TBL1X could be involved in late-onset sensorineural hearing loss and that ocular albinism with late-onset sensorineural hearing loss can present itself as a contiguous gene deletion/microdeletion syndrome. The finding of infertility in all affected male patients demonstrates that this deletion, including the SHROOM2 gene, may be a potentially causative X-linked genetic factor of male infertility., (© 2018 Wiley Periodicals, Inc.)

Purpose: We sought to advance interpretations and quantification of short-wavelength fundus autofluorescence (SW-AF) emitted from bisretinoid lipofuscin and near-infrared autofluoresence (NIR-AF) originating from melanin., Methods: Carriers of mutations in X-linked GPR143/OA1, a common form of ocular albinism; patients with confirmed mutations in ABCA4 conferring increased SW-AF; and subjects with healthy eyes were studied. SW-AF (488 nm excitation, 500-680 nm emission) and NIR-AF (excitation 787 nm, emission >830 nm) images were acquired with a confocal scanning laser ophthalmoscope. SW-AF images were analyzed for quantitative autofluoresence (qAF). Analogous methods of image acquisition and analysis were performed in albino and pigmented Abca4-/- mice and wild-type mice., Results: Quantitation of SW-AF (qAF), construction of qAF color-coded maps, and examination of NIR-AF images from GPR143/OA1 carriers revealed mosaics in which patches of fundus exhibiting NIR-AF signal had qAF levels within normal limits whereas the hypopigmented areas in the NIR-AF image corresponded to foci of elevated qAF. qAF also was increased in albino versus pigmented mice. Although melanin contributes to fundus infrared reflectance, the latter appeared to be uniform in en face reflectance images of GPR143/OA1-carriers. In patients diagnosed with ABCA4-associated disease, NIR-AF increased in tandem with increased qAF originating in bisretinoid lipofuscin. Similarly in Abca4-/- mice having increased SW-AF, NIR-AF was more pronounced than in wild-type mice., Conclusions: These studies corroborate RPE melanin as the major source of NIR-AF but also indicate that bisretinoid lipofuscin, when present at sufficient concentrations, contributes to the NIR-AF signal. Ocular melanin attenuates the SW-AF signal.

Competing Interests: There are no conflicts of interest

Background: Albinism refers to a group of disorders primarily characterized by hypopigmentation. Affected individuals usually manifest both ocular and cutaneous features of the disease, but occasionally hair and skin pigmentation may appear normal. This is the case in ocular albinism, an X chromosome linked disorder resulting from mutation of GPR143. Female carriers may be recognized by a "mud-splatter" appearance in the peripheral retina. The macula is thought to be normal, however., Methods: Obligate female carriers of pathogenic GPR143 alleles were recruited. Molecular confirmation of disease was performed only for atypical cases. Detailed retinal imaging was performed (colour fundus photography, optical coherence tomography, fundus autofluorescence., Results: Eight individuals were ascertained. A novel GPR143 mutation was identified in one family (p.Gln328Ter). Foveal fundus autofluorescence was subjectively reduced in 6/6 patients imaged. A "tapetal-like" pattern of autofluorescence was visible at the macula in 3/6. Persistence of the inner retinal layers at the fovea was observed in 6/8 females., Conclusion: Female carriers of ocular albinism may manifest signs of retinal pigment epithelium mosaicism at the macula and the peripheral fundus. A tapetal-like reflex on fundus autofluorescence may be considered the macular correlate of "mud-splatter."

Albinism can be divided into oculocutaneous albinism (OCA) and ocular albinism (OA). In the differential diagnostics these can be distinguished from rarer syndromes with partial albinism, which are frequently associated with susceptibility to infections and neurological symptoms. The OCA is an autosomal recessive inherited disease of melanin biosynthesis, which leads to complete or partial loss of melanin in the skin, hair follicles and eyes. Of the seven currently known subtypes (OCA 1-7), four are well-characterized (OCA 1-4). These are based on gene mutations, which code for tyrosinase, a key enzyme in melanin synthesis and for further proteins. These play an important role in the catalytic activity of tyrosinase and the structure and function of melanosomes. In the presence of these subtypes, the clinical symptoms and the course of the disease show a pronounced variability, especially in the type and extent of pigmentation of the skin and hair as well as the severity of eye involvement, which makes the phenotypic classification difficult. Treatment priorities are a consistent protection from UV light for prophylaxis against skin cancer and regular preventive investigations. The ocular alterations typical for albinism necessitate timely diagnostics and care by institutions specialized in ophthalmology. Novel strategies for systemic treatment of subtypes of albinism are in preclinical testing. The OA without skin involvement shows X‑linked inheritance, is much rarer and is characterized by reduced pigmentation of the retina and iris, nystagmus and macular hypoplasia, sometimes with substantial loss of visual acuity. The typical ocular symptoms of OA can be manifested to a varying extent in all forms of OCA.

Oculocutaneous albinism (OCA) and ocular albinism (OA) are inherited disorders of melanin biosynthesis, resulting in loss of pigment and severe visual deficits. OCA encompasses a range of subtypes with overlapping, often hypomorphic phenotypes. OCA1 is the most common cause of albinism in European populations and is inherited through autosomal recessive mutations in the Tyrosinase (TYR) gene. However, there is a high level of reported missing heritability, where only a single heterozygous mutation is found in TYR. This is also the case for other OCA subtypes including OCA2 caused by mutations in the OCA2 gene. Here we have interrogated the genetic cause of albinism in a well phenotyped, hypomorphic albinism population by sequencing a broad gene panel and performing segregation studies on phenotyped family members. Of eighteen probands we can confidently diagnose three with OA and OCA2, and one with a PAX6 mutation. Of six probands with only a single heterozygous mutation in TYR, all were found to have the two common variants S192Y and R402Q. Our results suggest that a combination of R402Q and S192Y with a deleterious mutation in a 'tri-allelic genotype' can account for missing heritability in some hypomorphic OCA1 albinism phenotypes.

Purpose: GPR143 regulates melanosome biogenesis and organelle size in pigment cells. The mechanisms underlying receptor function remain unclear. G protein-coupled receptors (GPCRs) are excellent pharmacologic targets; thus, we developed and applied a screening approach to identify potential GPR143 ligands and chemical modulators., Methods: GPR143 interacts with β-arrestin; we therefore established a β-arrestin recruitment assay to screen for compounds that modulate activity. Because GPR143 is localized intracellularly, screening with the wild-type receptor would be restricted to agents absorbed by the cell. For the screen we used a mutant receptor, which shows similar basal activity as the wild type but traffics to the plasma membrane. We tested two compound libraries and investigated validated hits for their effects on melanocyte pigmentation., Results: GPR143, which showed high constitutive activity in the β-arrestin assay, was inhibited by several compounds. The three validated inhibitors (pimozide, niclosamide, and ethacridine lactate) were assessed for impact on melanocytes. Pigmentation and expression of tyrosinase, a key melanogenic enzyme, were reduced by all compounds. Because GPR143 appears to be constitutively active, these compounds may turn off its activity., Conclusions: X-linked ocular albinism type I, characterized by developmental eye defects, results from GPR143 mutations. Identifying pharmacologic agents that modulate GPR143 activity will contribute significantly to our understanding of its function and provide novel tools with which to study GPCRs in melanocytes and retinal pigment epithelium. Pimozide, one of three GPR143 inhibitors identified in this study, maybe be a good lead structure for development of more potent compounds and provide a platform for design of novel therapeutic agents.

The aim of the present study was to evaluate mutations of the G protein-coupled receptor 143 (GPR143) gene for ocular albinism type 1 (OA1) in Chinese patients. For the current study, 8 patients with OA1 were selected from the database of ocular genetic diseases. Genomic DNA of OA1 was prepared from venous leukocytes collected from the patients. Cycle sequencing was used to analyze the exons and adjacent introns of GPR143. The variation detected was analyzed by bidirectional DNA sequencing and further evaluated in 96 controls using heteroduplex‑single strand conformational polymorphism analysis. Additionally, slit lamp photography of anterior segment, fundus photography and optical coherence tomography (OCT) were performed to identify the clinical features of OA1. In five patients with OA1, 5 GPR143 gene mutations were identified and four of them there were novel mutations. The screening rate is 62.5%, including c.333G>A (p.W111X), c.353G>A (p.G118E) (known mutation), C.658+2T>G (splice mutation), c.215&#95;216insCGCTGC (p.71‑72insAA) and c.17T>C (p. L6P). These mutations were absent in the 96 normal controls. Only one patient with OA1 in the present study was female. Patients with OA1 often have congenital nystagmus, refractive error, severe decline of visual acuity (from 0.1 to 0.4) and foveal hypoplasia. Different degrees of pigment loss were evident in the patients' iris and retina, whereas macular structure was not identified in the OCT examination. The findings of the present study expanded the gene mutation spectrum of GPR143 and investigated the clinical phenotype of patients with OA1 in the Chinese population. Additional evidence for clinical diagnosis was provided along with differential diagnosis and genetic counseling.

Objective: To detect mutation of GPR143 gene in a Chinese patient affected with ocular albinism., Methods: Peripheral blood samples were collected from the proband and his parents. The coding regions of the GPR143 gene were subjected to PCR amplification and Sanger sequencing., Results: A previously unreported mutation (c.758T>A) was found in exon 6 of the GPR143 gene in the proband and his mother. The same mutation was not found in his father. As predicted, the mutation has resulted in a stop codon, causing premature termination of protein translation., Conclusion: A novel mutation of the GPR143 gene related to X-linked ocular albinism has been identified.

X-linked ocular albinism (OA1) is an X-linked inherited disease characterized by hypopigmentation of the fundus and nystagmus. Our study performed mutation analysis of the G protein-coupled receptor 143 gene (GPR143) and assessed the clinical characteristics of OA1 in three Chinese families. Three novel mutations, c.333&#95;360+14del42insCTT, c.276G>A (p.W92X), and c.793C>T (p.R265X), were identified in GPR143 by PCR followed by Sanger sequencing in these families. All affected individuals presented with nystagmus, photophobia, poor visual acuity, foveal hypoplasia and varying degrees of hypopigmentation of the fundus. The fundus of female carriers showed pigmented streaks alternating with hypopigmented streaks. These results allowed us to expand the spectrum of mutations in GPR143 and phenotypes associated with ocular albinism.

Ocular albinism type 1 (OA), caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE). This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain's optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS) on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3' untranslated region (UTR), 6 in the 5' UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism., Competing Interests: The authors have declared that no competing interests exist.

Hermansky-Pudlak syndrome (HPS) is an autosomal recessive disorder characterized by oculocutaneous albinism, platelet dysfunction and ceroid deposition. We report suspected ocular albinism in two Japanese sisters, caused by mutations in the HPS6 (Hermansky-Pudlak syndrome 6) gene. Trio-based whole-exome sequencing (WES) identified novel compound heterozygous mutations in HPS6 (c.1898delC: mother origin and c.2038C>T: father origin) in the two sisters. To date, 10 associated mutations have been detected in HPS6. Although we detected no general manifestations, including platelet dysfunction, in the sisters, even in long-term follow-up, we established a diagnosis of HPS type 6 based on the HPS6 mutations and absence of dense bodies in the platelets, indicating that WES can identify cases of HPS type 6. To the best of our knowledge, this is the first report of HPS6 mutations in Japanese patients.

Purpose: To describe the complex, overlapping phenotype expressed in a two generation family harboring pathogenic mutations in the ABCA4 and GPR143 genes., Methods: Clinical evaluation of a two generation family included quantitative autofluorescence imaging (qAF, 488-nm excitation) using a modified confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for varying laser power detector sensitivity, spectral-domain optical coherence tomography, and full-field ERG testing. Complete sequencing of the ABCA4 and GPR143 genes was carried out in each individual., Results: Affected individuals presented with bull's eye lesions and qAF levels above the 95% confidence interval for healthy eyes; full-field ERG revealed no generalized rod dysfunction but mild implicit time delays in cone responses. Complete sequencing of the ABCA4 gene revealed two disease-causing mutations, p.L541P and p.G1961E; and mutational phase was confirmed in each unaffected parent. Further examination in the affected patients revealed a peripheral "mud-splattered" pattern of hypopigmented RPE after which sequencing of GPR143 revealed a novel missense variant, p.Y157C. The GPR143 variant segregated from the father who did not exhibit any indications of retinal disease with the exception of an abnormal near-infrared autofluorescence (NIR-AF) signal distribution in the macula., Conclusions: An individual carrying both ABCA4 and GPR143 disease-causing mutations can express a complex, overlapping phenotype associated with both Stargardt disease and X-linked ocular albinism (OA1). The absence of OA1-related disease changes (with the exception of NIR-AF changes associated with melanin distribution) in the father may be indicative of mild expressivity or variable gene penetrance.

Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented hair, skin and eyes. It is associated with decreased visual acuity, nystagmus, strabismus and photophobia. Six genes are known to be involved in nonsyndromic oculocutaneous albinism (OCA). In this study, we aimed to find the disease causing mutations in albinism patients using homozygosity mapping. Twenty three unrelated patients with nonsyndromic OCA or autosomal recessive ocular albinism were recruited in this study. All of the patients' parents had consanguineous marriage and all were screened for TYR mutations previously. At first, we performed homozygosity mapping using fluorescently labeled primers to amplify a novel panel of 13 STR markers inside the OCA genes and then the screened loci in each family were studied using PCR and cycle sequencing methods. We found five mutations including three mutations in OCA2, one mutation in SLC45A2 and one mutation in C10ORF11 genes, all of which were novel. In cases where the disease causing mutations are identical by descent due to a common ancestor, these STR markers can enable us to screen for the responsible genes.

From the ophthalmological view, albinism is a disorder of reduced pigmentation of the retinal and irdial pigment epithelium and the iris and choroid stroma. The reduced pigmentation is accompanied by morphological changes in the retina and the optic nerve. The functional relationship of these morphological changes is not yet well understood. This review summarises the genetic causes of reduced pigment synthesis and impaired pigment distribution, and discusses the variability of expression of albinism symptoms, in the light of other disorders affecting retinal development., (Georg Thieme Verlag KG Stuttgart · New York.)

Purpose: Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented eyes (in patients with ocular albinism) or hair, skin, and eyes (in individuals with oculocutaneous albinism). It is associated with decreased visual acuity, nystagmus, strabismus, and photophobia. The tyrosinase gene is known to be involved in both oculocutaneous albinism and autosomal recessive ocular albinism. In this study, we aimed to screen the mutations in the TYR gene in the nonsyndromic OCA and autosomal recessive ocular albinism patients from Iran., Methods: The tyrosinase gene was examined in 23 unrelated patients with autosomal recessive ocular albinism or nonsyndromic OCA using DNA sequencing and bioinformatics analysis., Results: TYR gene mutations were identified in 14 (app. 60%) albinism patients., Conclusions: We found 10 mutations, 3 of which were novel. No mutation was found in our ocular albinism patients, but one of them was heterozygous for the p.R402Q polymorphism.

Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.