Search

Background: Identification of mutations in the SERPINC1 has illuminated the intricate pathways underlying antithrombin (AT) deficiency. Our group identified a variation in the SERPINC1 gene (c.964 A > T, p.Lys322stop) and further investigated the mechanism of this variant causing AT deficiency., Methods: Multiple in silico tools were utilized to predict the conservation of mutations and their impact on the AT structure. The coagulation state was evaluated using the thrombin generation assay. Recombinant AT was overexpressed in HEK293T cells. Intracellular kinetics and extracellular secretion of recombinant AT-K322* were scrutinized by RT-qPCR, Western blotting, ELISA, and immunocytofluorescence., Results: Analysis of conservation in silico indicated 43 out of the 143 amino acids deleted byAT-K322* in AT were highly conserved across homologous species. In vitro expression experiments showed that there was no significant difference in mRNA levels between the mutant (AT-K322*) and wild-type (AT-WT) forms of the protein. The truncated AT-K322* protein was clearly detected in cell lysates, but not in the culture medium., Conclusion: AT-K322* resulted in the generation of a truncated protein, which in turn affected the secretion of AT, ultimately leading to AT deficiency., Competing Interests: Declarations. Ethics approval and consent to participate: The study involving human participates was approved by the Ethics Committee of the Beijing Jishuitan Hospital of Capital Medical University. Informed consent was obtained from all participants. Consent for publication: Not applicable. Competing interests: All the authors declare no conflicts of interest., (© 2024. The Author(s).)

Hereditary antithrombin (AT) deficiency due to mutations in SERPINC1 is known to be the most severe form of thrombophilia. We report three members in a family with hereditary AT deficiency with a novel mutation in exon 2 of SERPINC1, that is c.119 G>A (p.Cys40Tyr). Two brothers presented with acute pulmonary thromboembolism (PTE) at 18 and 21 years of age, whereas their 58-year-old father did not have any thrombotic episode till date. The in-silico prediction of the variant was found to be highly damaging by PolyPhen-2, SIFT and MutationTaster. Clinical exome sequencing did not show any strong coinherited thrombophilia genes, except SERPINE1 -844 G>A variant in homozygous state in the two affected brothers as compared to the father who was heterozygous for this variant. The additive effect of SERPINE1 variant in the clinical expression in two siblings cannot be ruled out, in the absence of any other known environmental triggering factors., (Copyright © 2024 Wolters Kluwer Health, Inc. All rights reserved.)

Background: Despite improvements in therapy, breast cancer still contributes to high mortality rates. Survival of these patients becomes progressively worse upon diagnosis with cancer-associated thrombosis (CAT). Unfortunately, the mechanism causing CAT has remained unclear., Objective: Set up an acute and non-invasive hypercoagulable mouse model with an aggressive breast cancer and study the mechanism of cancer-associated thrombosis., Methods: Mice were grafted with the aggressive breast cancer cell line MDA-MB-231 or sham-treated. Subsequently, an acute imbalance in coagulation was introduced by injecting a synthetic small interfering (si) RNA targeting hepatic Serpinc1 to knockdown antithrombin - a condition known to predispose to cause a hypercoagulant state in vivo., Results: Silencing Serpinc1 with siRNA decreased plasma antithrombin levels. siRNA treatment had no short-term effects on tumor characteristics, but increased distant metastasis within the timeframe of this study. The systemic pro-inflammatory status, with elevated platelet counts and fibrinogen levels in tumor-bearing mice, was also not affected by antithrombin silencing. While elevated fibrin deposition in the liver upon Serpinc1 targeting was not significantly affected by the presence of breast cancer, knockdown of antithrombin did significantly increase intratumoral fibrin deposition and inflammation. Surprisingly, in the presence of an aggressive tumor, a protective outcome with less clinical features coinciding with venous thrombosis were observed in mice with antithrombin knockdown., Conclusion: We conclude that the presence of a breast tumor protects hypercoagulant mice from severe consumption of coagulation factors after lowering hepatic antithrombin levels, possibly due to elevated platelet counts. However, the consequences on cancer-associated thrombosis remained inconclusive., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Venous thromboembolism (VTE) represents a worldwide health challenge, impacting millions of people each year. The genesis of venous thrombosis is influenced in part by genetic components. Hereditary thrombosis is described as a genetically determined susceptibility to VTE. In the present study, a male patient was referred to our department presenting with multiple venous thrombosis events in different locations. Given a lack of identifiable risk factors, we aimed to investigate the possible genetic factor underlying venous thrombosis. Whole-exome sequencing was employed to examine genes linked to inherited thrombophilia in the proband. Putative variants were subsequently confirmed through Sanger sequencing within the family. The proband was identified as carrying two genetic mutations. One is the novel c.400G > C (p.E134Q) mutation affecting the final nucleotide of exon 5 in the PROC gene, potentially impacting splicing. The other is a previously reported heterozygous nonsense variant c.1016G > A (p.W339X) in the SERPINC1 gene. The proband inherited the former from her mother and the latter from her father. The presence of digenic inheritance in the patient reflects the complex phenotype of venous thrombosis and demonstrates the significance of an unbiased approach to detect pathogenic variants, especially in patients with a high risk of hereditary thrombosis., Competing Interests: The authors declare that they have no conflict of interest., (The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution-NonDerivative-NonCommercial License, permitting copying and reproduction so long as the original work is given appropriate credit. Contents may not be used for commercial purposes, or adapted, remixed, transformed or built upon. (https://creativecommons.org/licenses/by-nc-nd/4.0/).)

Background: Deficiency of natural anticoagulant antithrombin was first reported as a genetic risk factor for venous thromboembolism, antithrombin III (AT III) is encoded by the serpin family C member 1 (SERPINC1) gene, consisting of 432 amino acids, including 3 disulfide bonds and 4 possible glycosylation sites. Studies have shown that hereditary AT deficiency increases the incidence of venous thromboembolism by up to 20 times., Case Presentation: The case presented a 27-year-old young man with no acquired risk factors and a sudden onset of right lower extremity venous thrombosis and pulmonary embolism. A heterozygous mutation in gene SERPINC1 of c.1154-14G>A was detected in the patient, which is a deleterious mutation resulting in reduced AT III activity and increased risk of thrombotic events. The patient received anticoagulant therapy for approximately 5 months, and the thrombus gradually dissolved and no recurrent thrombotic events occurred during follow-up., Discussion: AT deficiency is a rare autosomal dominant genetic disease, they are mainly divided into 2 types according to the different effects on the structure or function of the encoded protein. The patient had a mutation in the SERPINC1 gene (c.1154-14G>A). Several cases of this type of mutation have been reported since 1991, and it is classified as AT deficiency type I., Conclusion: Thrombosis in patients with antithrombin deficiency is often unpredictable and can lead to fatal pulmonary embolism. Early genetic testing for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors is critical. Long-term anticoagulation treatment is an effective treatment, for this type of type I AT III deficiency combined with pulmonary embolism patients, warfarin is an effective anticoagulant drug., Competing Interests: The authors have no funding and conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Congenital antithrombin (AT) or serpin C1 deficiency, caused by a SERPINC1 abnormality, is a high-risk factor for venous thrombosis. SERPINC1 is prone to genetic rearrangement, because it contains numerous Alu elements. In this study, a Japanese patient who developed deep vein thrombosis during pregnancy and exhibited low AT activity underwent SERPINC1 gene analysis using routine methods: long-range polymerase chain reaction (PCR) and real-time PCR. Sequencing using long-range PCR products revealed no pathological variants in SERPINC1 exons or exon-intron junctions, and all the identified variants were homozygous, suggesting a deletion in one SERPINC1 allele. Copy number quantification for each SERPINC1 exon using real-time PCR revealed half the number of exon 1 and 2 copies compared with controls. Moreover, a deletion region was deduced by quantifying the 5'-upstream region copy number of SERPINC1 for each constant region. Direct long-range PCR sequencing with primers for the 5'-end of each presumed deletion region revealed a large Alu-mediated deletion (∼13 kb) involving SERPINC1 exons 1 and 2. Thus, a large deletion was identified in SERPINC1 using conventional PCR methods., (© 2024. Japanese Society of Hematology.)

Serine protease inhibitors (serpins) include thousands of structurally conserved proteins playing key roles in many organisms. Mutations affecting serpins may disturb their conformation, leading to inactive forms. Unfortunately, conformational consequences of serpin mutations are difficult to predict. In this study, we integrate experimental data of patients with mutations affecting one serpin with the predictions obtained by AlphaFold and molecular dynamics. Five SERPINC1 mutations causing antithrombin deficiency, the strongest congenital thrombophilia were selected from a cohort of 350 unrelated patients based on functional, biochemical, and crystallographic evidence supporting a folding defect. AlphaFold gave an accurate prediction for the wild-type structure. However, it also produced native structures for all variants, regardless of complexity or conformational consequences in vivo. Similarly, molecular dynamics of up to 1000 ns at temperatures causing conformational transitions did not show significant changes in the native structure of wild-type and variants. In conclusion, AlphaFold and molecular dynamics force predictions into the native conformation at conditions with experimental evidence supporting a conformational change to other structures. It is necessary to improve predictive strategies for serpins that consider the conformational sensitivity of these molecules., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 Garrido-Rodríguez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Predicting the likelihood vascular events in patients with BCR/ABL1-negative myeloproliferative neoplasms (MPN) is essential for the treatment of the disease. However, effective assessment methods are lacking. Thrombin-antithrombin complex (TAT), plasmin-α 2 - plasmininhibitor complex (PIC), thrombomodulin (TM), and tissue plasminogen activator-inhibitor complex (t-PAIC) are the new direct indicators for coagulation and fibrinolysis. The aim of this study was to investigate the changes of these four new indicators in thrombotic and hemorrhagic events in BCR/ABL1-negative MPN. The study cohort of 74 patients with BCR/ABL negative myeloproliferative disorders included essential thrombocythemia, polycythemia vera, and primary myelofibrosis (PMF). A panel of 4 biomarkers, including TAT, PIC, TM, and t-PAIC were determined using Sysmex HISCL5000 automated analyzers, whereas fibrin/fibrinogen degradation products (FDP), D-dimer and Antithrombin III (ATIII) were analyzed using Sysmex CS5100 coagulation analyzer. A total of 24 (32.4%) patients experienced thrombotic events and hemorrhagic events occurred in 8 patients (10.8%). Compared to patients without hemorrhagic-thrombotic events, patients with thrombotic events had higher fibrinogen (FIB) level, FDP level and lower ATIII activity, while patients with hemorrhagic events had lower white blood cell count and hemoglobin level, higher FDP level (P < 0.05). Patients with a JAK2V617F mutation were more likely to experience thrombotic events (P < 0.05). In addtion, patients with thrombotic events had higher TAT, PIC, TM, and t-PAIC levels than patients without hemorrhagic-thrombotic events (P < 0.05), whereas patients with hemorrhagic events had a lower median value in TAT and TM (no statistical difference, P > 0.05). Patients with higher TAT, TM and t-PAIC were more likely to experience thrombotic events (P < 0.05), and only TAT was positively correlated with thrombotic events (Spearman  r =0.287, P = 0.019). TAT, PIC, TM, and t-PAIC combined with ATIII and FDP have a certain value for predicting thrombosis in patients with BCR/ABL1-negative MPN. These 6 parameters are worth further exploration as predictive factors and prognostic markers for early thrombotic events., (© 2024. The Author(s).)

Rationale: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective., Patient Concerns: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS., Diagnoses: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father., Interventions: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation., Outcomes: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation., Lessons: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Introduction: Prothrombin Belgrade mutation is the result of the c.1787G>A substitution in the prothrombin gene. It is located in the antithrombin and sodium binding site and leads to impaired inactivation of thrombin by antithrombin, resulting in antithrombin resistance and thrombotic disorders. However, it negatively affects sodium binding and may have hypocoagulant effects. Considering that prothrombin Belgrade mutation mechanism is still not fully elucidated and that sodium binding is important for thrombin affinity towards fibrinogen, our aim was to determine whether this mutation affects fibrin clot formation and lysis., Methods: Using HEK293T cell line, recombinant wild type and mutated prothrombin were generated by transient transfection. Samples that correspond to plasma of a non-carrier, heterozygous and homozygous carriers were reconstituted using prothrombin deficient plasma and recombinant proteins. Reconstituted samples were used in OHP assay (Overall Hemostasis Potential) to determine kinetic profiles of coagulation and fibrinolysis. Clot turbidity assay was performed to observe kinetics of clot formation and lysis more closely. Fibrin clots formed in reconstituted plasma samples were analyzed by confocal microscopy to determine density of fibrin network. Fibrin clots were additionally observed using electron microscopy to determine thickness of individual fibrin fibers., Results: No significant difference found in OHP, OCP, OFP, and fibrin network density between wild type, heterozygous, and homozygous carrier reconstituted plasma samples. There were significant differences between samples for slope and slope time parameters in kinetic profiles and fibrin fiber thickness., Conclusions: Results indicate that prothrombin Belgrade mutation has no significant impact on fibrinolysis, however it may affect kinetics of clot formation and its architecture., (© 2023 John Wiley & Sons Ltd.)

Objective: To analyze the clinical phenotype and genetic characteristics of a Chinese pedigree affected with Hereditary antithrombin deficiency., Methods: A pedigree diagnosed at the the Second Affiliated Hospital of Wenzhou Medical University, Yuying Children's Hospital in June, 2020 was selected as the study subject. Plasma prothrombin time (PT), activated partial thromboplastin time (APTT), fibrinogen (FIB), and thrombin time (TT) of the probands and their pedigree members were determined using a STA-R automatic coagulation analyzer. Antithrombin activity (AT: A) and antithrombin antigen (AT: Ag) in plasma were determined with chromogenic substrate and immunonephelometry assays. All exons and flanking sequences of the anticoagulant protein gene SERPINC1 were amplified by PCR and subjected to Sanger sequencing. Candidate variants were verified with bioinformatic tools (PolyPhen-2, SIFT, Mutation Taster and PYMOL) to explore their effect on the function and structural conformation of the protein., Results: The probands (II-2, II-10), their brother (II-5) and sons (III-1, III-8) had shown normal PT, APTT, FIB, and TT, but significantly decreased AT: A and AT: Ag, with their levels being 34%, 57%, 56%, 48%, 53% and 13.51 mg/dL, 13.44 mg/dL, 18.39 mg/dL, 17.36 mg/dL, 17.71 mg/dL, respectively. The remaining pedigree members had normal values. Sanger sequencing revealed that the probands and all affected pedigree members had harbored a heterozygous c.851T>C (p.Met284Thr) missense variant in exon 5 of the SERPINC1 gene. Bioinformatic analysis and simulation suggested that the variant has resulted in alteration of hydrogen bonds at the c.851 position, which may affect the structure of the protein. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was classified as pathogenic (PS1+PM1+PM5+PP1+PP4)., Conclusion: The probands and other affected members were all diagnosed with type I hereditary AT deficiency, for which the c.851T>C (p.Met284Thr) variant of the SERPINC1 gene may be accountable.

Introduction: Hereditary antithrombin (AT) deficiency is a rare autosomal dominant disorder with significant clinical heterogeneity. In the study, we identified a patient with AT deficiency caused by compound heterozygous mutations in the SERPINC1 gene., Methods: A total of 9 individuals from three generations were investigated. The mutations were identified by direct sequencing of SERPINC1. Multiple in silico tools were programmed to predict the conservation of mutations and the effect on the AT structure. The coagulation state was evaluated by the thrombin generation assay. Recombinant AT was overexpressed in HEK293T cells; the mRNA level was determined using RT-qPCR. Western blotting, ELISA, and immunocytofluorescence were applied to characterize the recombinant AT protein., Results: The proband was a 26-year-old male who experienced recurrent venous thrombosis. He presented the type I deficiency with 33 % AT activity and a synchronized decrease in AT antigen. Genetic screening revealed that he carried a heterozygous c.318&#95;319insT (p.Asn107*) in exon 2 and a heterozygous c.922G > T (p.Gly308Cys) in exon 5, both of which were completely conserved in homologous species and resulted in enhanced thrombin generation capability. Hydrophobicity analysis suggested that the p.Gly308Cys mutation may interfere with the hydrophobic state of residues 307-313. In vitro expression studies indicated that the levels of the recombinant protein AT-G308C decreased to 46.98 % ± 2.94 % and 41.35 % ± 1.48 % in transfected cell lysates and media, respectively. After treatment with a proteasome inhibitor (MG132), the quantity of AT-G308C protein in the cytoplasm was replenished to a level comparable to that of the wild type. The mRNA level of AT-N107* was significantly reduced and the recombinant protein AT-N107* was not detected in either the lysate or the culture media., Conclusion: These two mutations were responsible for the AT defects and clinical phenotypes of the proband. The p.Gly308Cys mutation could lead to proteasome-dependent degradation of the AT protein in the cytoplasm by altering local residue hydrophobicity. The c.318&#95;319insT could eliminate aberrant transcripts by triggering nonsense-mediated mRNA degradation. Both mutations resulted in type I AT deficiency., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Objective: To evaluate the impact of increased Activated Protein C (APC) resistance, decreased antithrombin III activity and hypocomplementemia on the pregnancy outcomes of the patients with methylentetrahydrofolate reductase (MTHFR) polymorphisms., Methods: This study was composed of 83 pregnancies with MTHFR polymorphisms. Increased APC resistance, decreased antithrombin III activity and hypocomplementemia were accepted as risk factors for poor gestational outcome., Results: Having at least one risk factor resulted in significantly higher rates of "APGAR score of<7" at the first ten minutes (p=0.009). Composite adverse outcome rate was also higher in patients with at least one of the defined risk factors despite lack of statistical significance (p=0.241). Rate of newborn with an "APGAR score of<7" at first ten minutes was significantly higher at patients with hypocomplementemia (p=0.03)., Conclusion: Hypocomplementemia is a risk factor for poor gestational outcome in pregnancies with MTHFR polymorphisms., Competing Interests: The authors declare that they have no conflict of interest., (Thieme. All rights reserved.)

Introduction: Hereditary antithrombin (AT) deficiency type I causes venous thrombosis due to decreased levels of AT antigen in the blood. We identified one novel and one known abnormal variant in two unrelated Japanese families with venous thrombosis. In this study, we analyzed the mechanism by which these abnormal variants cause type I AT deficiency., Materials and Methods: Wild-type and variant AT expression vectors were constructed and transiently expressed in human embryonic kidney 293 cells, and AT antigen levels and N-glycosylation of cell lysates and culture medium were evaluated by western blot analysis. Subcellular co-localization of AT was also examined using confocal microscopy, and chase experiments with cycloheximide and MG132 were performed to investigate the degradation pathway of AT variants., Results: Genetic analysis identified a novel variant, c.613delC (p.Leu205Trpfs ⁎ 79), and the known variant c.283T>C (p.Tyr95His). These AT variants exhibited significantly reduced extracellular secretion compared with the wild-type; N-glycosylation of the AT protein was normal. Co-localization analysis suggested that the transport of these abnormal AT proteins to the Golgi apparatus was impaired. The c.613delC variant was degraded early by the proteasome, suggesting that the c.283T>C variant is stored in the endoplasmic reticulum (ER)., Conclusions: The AT variants identified here synthesize abnormal AT proteins that exhibit suppressed secretion and impaired transport from the ER to the Golgi apparatus. These results provide clues that could help elucidate the mechanism of type I AT deficiency and facilitate therapy development., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Mutation of SERPINC1 is related to the incidence of Inherited antithrombin (AT) deficiency. In this study, we generated a human induced pluripotent stem cell (iPSC) line from peripheral blood mononuclear cells of a patient with a mutation of SERPINC1 c.236G>A (p.R79H). The generated iPSCs express pluripotent cell markers with no mycoplasma contamination. Besides, it has a normal female karyotype and could differentiate into all three germ layers in vitro., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 The Authors. Published by Elsevier B.V. All rights reserved.)

Background: Antithrombin, PC (protein C), and PS (protein S) are circulating natural anticoagulant proteins that regulate hemostasis and of which partial deficiencies are causes of venous thromboembolism. Previous genetic association studies involving antithrombin, PC, and PS were limited by modest sample sizes or by being restricted to candidate genes. In the setting of the Cohorts for Heart and Aging Research in Genomic Epidemiology consortium, we meta-analyzed across ancestries the results from 10 genome-wide association studies of plasma levels of antithrombin, PC, PS free, and PS total., Methods: Study participants were of European and African ancestries, and genotype data were imputed to TOPMed, a dense multiancestry reference panel. Each of the 10 studies conducted a genome-wide association studies for each phenotype and summary results were meta-analyzed, stratified by ancestry. Analysis of antithrombin included 25 243 European ancestry and 2688 African ancestry participants, PC analysis included 16 597 European ancestry and 2688 African ancestry participants, PSF and PST analysis included 4113 and 6409 European ancestry participants. We also conducted transcriptome-wide association analyses and multiphenotype analysis to discover additional associations. Novel genome-wide association studies and transcriptome-wide association analyses findings were validated by in vitro functional experiments. Mendelian randomization was performed to assess the causal relationship between these proteins and cardiovascular outcomes., Results: Genome-wide association studies meta-analyses identified 4 newly associated loci: 3 with antithrombin levels ( GCKR , BAZ1B , and HP-TXNL4B ) and 1 with PS levels ( ORM1 - ORM2 ). transcriptome-wide association analyses identified 3 newly associated genes: 1 with antithrombin level ( FCGRT ), 1 with PC ( GOLM2 ), and 1 with PS ( MYL7 ). In addition, we replicated 7 independent loci reported in previous studies. Functional experiments provided evidence for the involvement of GCKR , SNX17 , and HP genes in antithrombin regulation., Conclusions: The use of larger sample sizes, diverse populations, and a denser imputation reference panel allowed the detection of 7 novel genomic loci associated with plasma antithrombin, PC, and PS levels., Competing Interests: Disclosures None.

Background: The natural history and genotype-phenotype correlation of congenital antithrombin (AT) deficiency in children are unknown., Objectives: To describe the clinical presentation of congenital AT deficiency in children and evaluate its correlation to specific mutations in SERPINC1., Methods: In 2017, a prospective pediatric database and DNA biorepository for congenital AT deficiency was established. During the pilot phase, the database was opened at 4 tertiary care centers in Canada and US. Approval from research ethics board was obtained at each participating center. Written consent/assent was obtained from guardians/subjects who met eligibility. Demographic/clinical data were uploaded into a database. DNA extraction and SERPINC1 sequencing were centralized for US centers. Standard statistical methods were used to summarize parameters. Probability of VTE-free survival was assessed using the Kaplan-Meier method., Results: Overall, 43 participants (25 females) from 31 unique kindreds were enrolled. Median age (range) at enrollment was 14.8 years (1-21 years). Median AT activity was 52% (24%-87%), and median AT antigen (n = 20) was 55% (38%-110%). Nineteen (44%) participants had a history of venous thromboembolism (VTE). Median age at VTE diagnosis was 12.8 years (0.1-19.2 years). SERPINC1 sequencing was completed for 31 participants and 21 unique mutations were identified, including 5 novel variants. Probability of 5-year VTE-free survival (95% CI) for carriers of missense mutations (92.0% [95% CI: 71.6%-97.9%]) was significantly higher compared with carriers of null mutations (66.7% [95% CI: 19.5%-90.4%]); p = .0012., Conclusion: To our knowledge, this is the first pediatric study to document a severe thrombotic phenotype in carriers of null mutations in SERPINC1, when compared with carriers of missense mutations; underscoring the importance of genetic testing., (Copyright © 2023 International Society on Thrombosis and Haemostasis. Published by Elsevier Inc. All rights reserved.)

Hereditary antithrombin (AT) deficiency is an autosomal dominant inherited thrombophilia. In three pedigrees of hereditary type I AT deficiency, we identified novel variants c.126delC (p.Lys43Serfs * 7), c.165C > G (p.Tyr55 * ), and c.546delA (p.Lys182Asnfs * 102) in the open reading frame encoding AT in each patient. Each of these aberrant variants leads to premature termination of AT protein synthesis. To investigate whether these abnormal variants are involved in the pathogenesis of type I AT deficiency, we analyzed the function of these variants in HEK293 cells. Results of western blot analysis and immunofluorescence microscopy showed that all abnormal variants were expressed intracellularly, but p.Lys43Serfs * 7 and p.Tyr55 * protein were aggregated in the cells. These three variants were not detected in the spent culture medium, indicating that these novel variants affect protein secretion. In summary, we suggest that these variants in the AT-encoding gene are translated in the cell, but form abnormal proteins that form aggregates and/or inhibit secretion. These results provide insight into novel mechanisms of type I AT deficiency and potential therapies for the condition., (© 2022. Japanese Society of Hematology.)

Local coagulation activation has been shown to impact both primary tumor growth and metastasis in mice. It is well known that components of the blood clotting cascade such as tissue factor and thrombin play a role in tumor progression by activating cellular receptors and local formation of fibrin. However, whether venous thromboembolism (VTE) or a hypercoagulable state has a direct impact on cancer progression is unknown. Here we have combined an orthotopic murine breast cancer model, using female Nod-SCID mice, with siRNA-mediated silencing of antithrombin (siAT) leading to the induction of a systemic hypercoagulable state. We show that, compared to control siRNA-treated (not experiencing a hypercoagulable state) tumor-bearing mice, siAT treated tumor-bearing mice do not show enhanced tumor growth nor enhanced metastasis. We conclude that, in this murine model for hypercoagulability, induction of a hypercoagulable state does not contribute to breast cancer progression., Competing Interests: Declaration of competing interest The authors have nothing to disclose with regard to commercial support., (Copyright © 2022 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Rationale: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia., Patient Concerns: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain., Diagnoses: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315&#95;1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4)., Interventions: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy., Outcomes: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed., Lessons: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.)

Antithrombin, a major endogenous anticoagulant, is a serine protease inhibitor (serpin). We characterized the biological and clinical impact of variants involving C-terminal antithrombin. We performed comprehensive molecular, cellular, and clinical characterization of patients with C-terminal antithrombin variants from a cohort of 444 unrelated individuals with confirmed antithrombin deficiency. We identified 17 patients carrying 12 C-terminal variants, 5 of whom had the p.Arg445Serfs*17 deletion. Five missense variants caused qualitative deficiency, and 7, including 4 insertion-deletion variants, induced severe quantitative deficiency, particularly p.Arg445Serfs*17 (antithrombin <40%). This +1 frameshift variant had a molecular size similar to that of WT antithrombin but possessed a different C-terminus. Morphologic and cotransfection experiments showed that recombinant p.Arg445Serfs*17 was retained at the endoplasmic reticulum and had a dominant-negative effect on WT antithrombin. Characterization of different 1+ frameshift, aberrant C-terminal variants revealed that protein secretion was determined by frameshift site. The introduction of Pro441 in the aberrant C-terminus, shared by 5 efficiently secreted variants, partially rescued p.Arg445Serfs*17 secretion. C-terminal antithrombin mutants have notable heterogeneity, related to variant type and localization. Aberrant C-terminal variants caused by 1+ frameshift, with similar size as WT antithrombin, may be secreted or not, depending on frameshift site. The severe clinical phenotypes of these genetic changes are consistent with their dominant-negative effects.

Coinheritance of a high oxygen affinity structural hemoglobin (Hb) variant along with a thrombophilia marker is a rare occurrence. This may lead to a multi fold increase in the risk of thrombosis in patients. We report here a first case of Hb Coombe Park ( HBA2 : c.382A>G; p.Lys128Glu) from India, coinherited with a novel mutation (c.839C>G; p.Ser280Ter) on the SERPINC1 gene. This coinheritance has not been reported before. Though the patient is presently asymptomatic, identification of these variants will help in genetic counseling and to decide the future course of action in case of any clinical complications.

Antithrombin deficiency, the most severe congenital thrombophilia, might be underestimated, as some pathogenic variants are not detected by routine functional methods. We have identified 2 new SERPINC1 variants, p.Glu227Lys and p.Asn224His, in 4 unrelated thrombophilic patients with early and recurrent thrombosis that had normal antithrombin activity. In one case, the mutation was identified by whole genome sequencing, while in the 3 remaining cases, the mutation was identified by sequencing SERPINC1 based on a single functional positive finding supporting deficiency. The 2 variants shared a common functional defect, an impaired or null N-glycosylation of Asn224 according to a eukaryotic expression model. Carriers had normal anti-FXa or anti-FIIa activities but impaired anti-FVIIa activity and a detectable loss of inhibitory function when incubating the plasma for 1 hour at 41°C. Moreover, the β glycoform of the variants, lacking 2 N-glycans, had reduced secretion, increased heparin affinity, no inhibitory activity, and a potential dominant-negative effect. These results explain the increased thrombin generation observed in carriers. Mutation experiments reflected the role that Lysine residues close to the N-glycosylation sequon have in impairing the efficacy of N-glycosylation. Our study shows new elements involved in the regulation of N-glycosylation, a key posttranslational modification that, according to our results, affects folding, secretion, and function, providing new evidence of the pathogenic consequence of an incorrect N-glycosylation of antithrombin. This study supports that antithrombin deficiency is underestimated and encourages the development of new functional and genetic tests to diagnose this severe thrombophilia., (© 2022 by The American Society of Hematology.)

Antithrombin deficiency, the most severe thrombophilia, might be underestimated, since it is only investigated in cases with consistent functional deficiency or family history. We have analyzed 444 consecutive, unrelated cases, from 1998 to 2021, with functional results supporting antithrombin deficiency in at least one sample. Plasma antithrombin was evaluated by functional and biochemical methods in at least two samples. SERPINC1 gene was analyzed by sequencing and MPLA. Hypoglycosylation was studied by electrophoresis and high-performance liquid chromatography (HPLC). In 260 of 305 cases (85.2%) with constitutive deficiency (activity < 80% in all samples), a SERPINC1 (N = 250), or N-glycosylation defect (N = 10) was observed, while 45 remained undetermined. The other 139 cases had normal antithrombin activity (≥ 80%) in at least one sample, what we called transient deficiency. Sixty-one of these cases (43.9%) had molecular defects: 48 had SERPINC1 variants, with two recurrent mutations (p.Ala416Ser[Cambridge II], N = 15; p.Val30Glu[Dublin], N = 12), and 13 hypoglycosylation. Thrombotic complications occurred in transient deficiency, but were less frequent, latter-onset, and had a higher proportion of arterial events than in constitutive deficiency. Two mechanisms explained transient deficiency: The limitation of functional methods to detect some variants and the influence of external factors on the pathogenic consequences of these mutations. Our study reveals a molecular defect in a significant proportion of cases with transient antithrombin deficiency, and changes the paradigm of thrombophilia, as the pathogenic effect of some mutations might depend on external factors and be present only at certain timepoints. Antithrombin deficiency is underestimated, and molecular screening might be appropriate in cases with fluctuating laboratory findings., (© 2021 The Authors. American Journal of Hematology published by Wiley Periodicals LLC.)

Objective: To analyze the clinical manifestations and molecular pathogenesis of 18 patients with inherited protein S (PS) deficiency. Methods: Eighteen patients with inherited PS deficiency who were admitted to the Institute of Hematology & Blood Diseases Hospital from June 2016 to February 2019 were analyzed: activity of protein C (PC) and antithrombin (AT) , PS activity were measured for phenotype diagnosis; high throughput sequencing (HTS) was used for screening of coagulation disease-related genes; Sanger sequencing was used to confirm candidate variants; Swiss-model was used for three-dimensional structure analysis. Results: The PS:C of 18 patients ranged from 12.5 to 48.2 U/dL. Among them, 16 cases developed deep vein thrombosis, including 2 cases each with mesenteric vein thrombosis and cerebral infarction, and 1 case each with pulmonary embolism and deep vein thrombosis during pregnancy. A total of 16 PROS1 gene mutations were detected, and 5 nonsense mutations (c.134&#95;162del/p.Leu45*, c.847G>T/p.Glu283*, c.995&#95;996delAT/p.Tyr332*, c.1359G> A/p.Trp453*, c.1474C>T/p.Gln492*) , 2 frameshift mutations (c.1460delG/p.Gla487Valfs*9 and c.1747&#95;1750delAATC/p.Asn583Wfs*9) and 1 large fragment deletion (exon9 deletion) were reported for the first time. In addition, the PS:C of the deep vein thrombosis during pregnancy case was 55.2 U/dL carrying PROC gene c.565C>T/p.Arg189Trp mutation. Conclusion: The newly discovered gene mutations enriched the PROS1 gene mutation spectrum which associated with inherited PS deficiency.

The impact of steroid hormones estrogen and progesterone on human immunodeficiency virus type 1 (HIV-1) replication is well documented. However, the exact mechanism involved in the regulation of HIV-1 replication by estrogen and progesterone is still unclear. In the present study, we wanted to elucidate the molecular mechanisms underlying the modulation of HIV-1 replication by estrogen and progesterone. To achieve this goal, we used real-time quantitative PCR arrays (PCR arrays) to identify differentially expressed host genes in response to hormone treatments that are involved in antiviral responses. Our in vitro results suggest that treatment with high doses of estrogen and progesterone promotes the expression of host antiviral factors Secretory leukocyte protease inhibitor (SLPI) and Serpin family C member 1 (SERPIN C1) among others produced in response to HIV-1 infection. SLPI is an enzyme that inhibits human leukocyte elastase, human cathepsin G, human trypsin, neutrophil elastase, and mast cell chymase. SERPIN C1 is a plasma protease inhibitor that regulates the blood coagulation cascade by the inhibition of thrombin and other activated serine proteases of the coagulation system. A dose dependent downmodulation of HIV-1 replication was observed in monocyte-derived macrophages (MDMs) pre-treated with the two proteins SLPI and SERPIN C1. Further investigations suggests that the host antiviral factors, SLPI and SERPIN C1 act at the pre-integration stage, inhibiting HIV-1 viral entry and leading to the observed downmodulation of HIV-1 replication. Our studies would help identify molecular mechanisms and pathways involved in HIV-1 pathogenesis.

Objective: To improve the clinical management of acute pulmonary embolism caused by antithrombin Ⅲ (AT Ⅲ) deficiency through gene sequence analysis of the SERPINC1 gene. Methods: The diagnosis and treatment of a 33-year-old male patient with chest pain was reviewed. All exon sequences and flanking regions of 7 related genes of thrombophilia were subjected to detection by high-throughput next generation sequencing technology. The gene mutation was inquired in the gene database and the pathogenic probability of the mutant gene was predicted by Mutation Taster software. Results: The patient was diagnosed with acute pulmonary embolism (intermediate-low risk), with the ATⅢ activity less than 50%. Anticoagulation with nadroparin calcium combined with warfarin was administrated, but hemoptysis was aggravated, and then the medication was replaced by anticoagulant of rivaroxaban. In the end, the embolus was gradually absorbed. A heterozygous missense mutation of c.1148T>A (p.L383H) in the SERPINC1 gene was detected. The gene database and Mutation Taster confirmed the mutation as a new pathogenic mutation with the pathogenic probability of 0.999 999 851 200 991. Conclusions: C.1148T>A (p.L383H) is a novel pathogenic mutation in SERPINC1 gene that complements and updates the gene mutation spectrum of hereditary AT Ⅲ deficiency. The new oral anticoagulant rivaroxaban may be used as the first-line treatment for these patients.

Venous thromboembolism (VTE) is the third most prevalent cardiovascular complication. Increasing studies have demonstrated that some microRNAs (miRNAs) are aberrantly expressed in VTE and play crucial roles in mediating the development of VTE. Therefore, our study intends to explore the detailed function and molecular mechanism of miR-200c-3p in VTE progression. In our research, VTE rat models were first established via inferior vena cava (IVC) ligation and the time-dependent effects of IVC ligation on thrombus formation were discovered. The results of reverse transcription quantitative polymerase-chain reaction (RT-qPCR) and western blotting showed that serpin family C member 1 (SERPINC1) was downregulated in VTE rat models and showed an inverse correlation with thrombus load. MiRNA target prediction tools and luciferase reporter assay confirmed SERPINC1 as a target for miR-200c-3p. VTE rats were injected with miR-200c-3p inhibitor for 24 h to investigate whether miR-200c-3p knockdown influences thrombus formation in vivo . Histological examination through hematoxylin-eosin staining revealed that miR-200c-3p downregulation markedly inhibited the formation of thrombus in IVC of rats. Additionally, miR-200c-3p was upregulated while SERPINC1 was downregulated in serum and inferior vena cava of VTE rats as well as in plasma of patients with VTE. Linear regression analysis demonstrated that miR-200c-3p expression was negatively correlated to SERPINC1 expression in VTE rats and patients with VTE. Our study determines the previously unelucidated function of miR-200c-3p in VTE, which might provide a potential novel insight for the treatment of VTE.

In a previous study, we reported that human endothelial cells (ECs) express and produce their own coagulation factors (F) that can activate cell surface FX without the additions of external proteins or phospholipids. We now describe experiments that detail the expression and production in ECs and fibroblasts of the clotting proteins necessary for formation of active prothrombinase (FV-FX) complexes to produce thrombin on EC and fibroblast surfaces. EC and fibroblast thrombin generation was identified by measuring: thrombin activity; thrombin-antithrombin complexes; and the prothrombin fragment 1.2 (PF1.2), which is produced by the prothrombinase cleavage of prothrombin (FII) to thrombin. In ECs, the prothrombinase complex uses surface-attached FV and γ-carboxyl-glutamate residues of FX and FII to attach to EC surfaces. FV is also on fibroblast surfaces; however, lower fibroblast expression of the gene for γ-glutamyl carboxylase (GGCX) results in production of vitamin K-dependent coagulation proteins (FII and FX) with reduced surface binding. This is evident by the minimal surface binding of PF1.2, following FII activation, of fibroblasts compared to ECs. We conclude that human ECs and fibroblasts both generate thrombin without exogenous addition of coagulation proteins or phospholipids. The two cell types assemble distinct forms of prothrombinase to generate thrombin., (© 2021. The Author(s).)

Atresia of inferior vena cava (IVC) is a rare congenital malformation associated with high risk of venous thrombosis that still has unknown etiology, although intrauterine IVC thrombosis has been suggested to be involved. The identification of IVC atresia in a case with early idiopathic venous thrombosis and antithrombin deficiency caused by the homozygous SERPINC1 c.391C > T variant (p.Leu131Phe; antithrombin Budapest 3) encouraged us to evaluate the role of this severe thrombophilia in this vascular abnormality. We have done a cross-sectional study in previously identified cohorts of patients homozygous for the Budapest 3 variant (N = 61) selected from 1118 patients with congenital antithrombin deficiency identified in two different populations: Spain (N = 692) and Hungary (N = 426). Image analysis included computed tomography and phlebography. Atresia of the IVC system was observed in 17/24 cases (70.8%, 95% confidence interval [CI]: 48.9%-87.3%) homozygous for antithrombin Budapest 3 with available computed tomography (5/8 and 12/16 in the Spanish and Hungarian cohorts, respectively), 16 had an absence of infrarenal IVC and one had atresia of the left common iliac vein. All cases with vascular defects had compensatory mechanisms, azygos-hemiazygos continuation or double IVC, and seven also had other congenital anomalies. Short tandem repeat analysis supported the specific association of the IVC system atresia with SERPINC1. We show the first evidence of the association of a severe thrombophilia with IVC system atresia, supporting the possibility that a thrombosis in the developing fetal vessels is the reason for this anomaly. Our hypothesis-generating results encourage further studies to investigate severe thrombophilic states in patients with atresia of IVC., (© 2021 The Authors. American Journal of Hematology published by Wiley Periodicals LLC.)

Background: This study aimed to probe and verify aberrantly methylated and expressed genes in hepatoblastoma and to analyze their interactions with tumor immune microenvironment., Methods: Aberrantly methylated and expressed genes were obtained by comprehensively analyzing gene expression and DNA methylation profiles from GSE81928, GSE75271 and GSE78732 datasets. Their biological functions were predicted by the STRING and Metascape databases. CIBERSORT was utilized for inferring the compositions of tumor-infiltrating immune cells (TIICs) in each sample. Correlation between hub genes and immune cells was then analyzed. Hub genes were validated in hepatoblastoma tissues via western blot or immunohistochemistry. After transfection with sh-NOTUM, migration and invasion of HuH-6 and HepG2 cells were investigated. The nude mouse tumorigenesis model was constructed., Results: Totally, 83 aberrantly methylated and expressed genes were determined in hepatoblastoma, which were mainly involved in metabolic and cancer-related pathways. Moreover, their expression was liver-specific. 13 hub genes were screened, which were closely related to immune cells in hepatoblastoma tissues. Among them, it was confirmed that AXIN2, LAMB1 and NOTUM were up-regulated and SERPINC1 was down-regulated in hepatoblastoma than normal tissues. NOTUM knockdown distinctly weakened migration and invasion of HuH-6 and HepG2 cells and tumor growth in vivo., Conclusions: This study identified aberrantly methylated and expressed signatures that were in relation to immune microenvironment in hepatoblastoma. Targeting NOTUM hub gene could suppress migration and invasion of hepatoblastoma cells. Thus, these aberrantly methylated and expressed genes might act as therapeutic agents in hepatoblastoma therapy., (© 2021. The Author(s).)

Inherited thrombophilia (e.g., venous thromboembolism, VTE) is due to rare loss-of-function mutations in anticoagulant factors genes (i.e., SERPINC1 , PROC , PROS1 ), common gain-of-function mutations in procoagulant factors genes (i.e., F5 , F2 ), and acquired risk conditions. Genome Wide Association Studies (GWAS) recently recognized several genes associated with VTE though gene defects may unpredictably remain asymptomatic, so calculating the individual genetic predisposition is a challenging task. We investigated a large family with severe, recurrent, early-onset VTE in which two sisters experienced VTE during pregnancies characterized by a perinatal in-utero thrombosis in the newborn and a life-saving pregnancy-interruption because of massive VTE, respectively. A nonsense mutation (CGA > TGA) generating a premature stop-codon (c.1171C>T; p.R391*) in the exon 6 of SERPINC1 gene (1q25.1) causing Antithrombin (AT) deficiency and the common missense mutation (c.1691G>A; p.R506Q) in the exon 10 of F5 gene (1q24.2) (i.e., FV Leiden; rs6025) were coinherited in all the symptomatic members investigated suspecting a cis -segregation further confirmed by STR-linkage-analyses [i.e., SERPINC1 IVS5 (ATT) 5-18 , F5 IVS2 (AT) 6-33 and F5 IVS11 (GT) 12-16 ] and SERPINC1 intragenic variants (i.e., rs5878 and rs677). A multilocus investigation of blood-coagulation balance genes detected the coexistence of FV Leiden (rs6025) in trans with FV HR2-haplotype (p.H1299R; rs1800595) in the aborted fetus, and F11 rs2289252, F12 rs1801020, F13A1 rs5985, and KNG1 rs710446 in the newborn and other members. Common selected gene variants may strongly synergize with less common mutations tuning potential life-threatening conditions when combined with rare severest mutations. Merging classic and newly GWAS-identified gene markers in at risk families is mandatory for VTE risk estimation in the clinical practice, avoiding partial risk score evaluation in unrecognized at risk patients.

Recent research has indicated that metabolically related genes play crucial roles in the pathogenesis of hepatocellular carcinoma (HCC). We evaluated the associations between novel biomarkers and retinol-binding protein 4 (RBP4) for predicting clinical HCC outcomes, hub-related genes, pathway regulation, and immune cells infiltration. Bioinformatic analyses based on data from The Cancer Genome Atlas were performed using online analysis tools. RBP4 expression was low in HCC and was also down-regulated in pan-cancers compared with normal tissues. RBP4 expression was also significantly different based on age (41-60 years old versus 61-80 years old), and low RBP4 expression levels were associated with advanced tumor stages and grades. Higher RBP4 expression was associated with better overall survival time in HCC patients, and we identified a deletion-mutation rate of 1.4% in RBP4. We also identified ten co-expressed genes most related to RBP4 and explored the relationships between six hub genes (APOB, FGA, FGG, SERPINC1, APOA1, and F2) involved in RBP4 regulation. A pathway enrichment analysis for RBP4 indicated complement and coagulation cascades, metabolic pathways, antibiotic biosynthesis pathways, peroxisome proliferator-activated receptor signaling pathways, and pyruvate metabolism pathways. These results suggest that RBP4 may be a novel biomarker for HCC prognosis, and an indicator of low immune response to the disease., (© 2021 The Author(s).)

Antithrombin (AT) is a serine protease inhibitor, its activity is highly accelerated by heparin. Mutations at the heparin-binding region lead to functional defect, type II heparin-binding site (IIHBS) AT deficiency. The aim of this study was to investigate and compare the molecular background of AT Budapest 3 (p.Leu131Phe, ATBp3), AT Basel (p.Pro73Leu), and AT Padua (p.Arg79His) mutations. Advanced in silico methods and heparin-binding studies of recombinant AT proteins using surface plasmon resonance method were used. Crossed immunoelectrophoresis and Differential Scanning Fluorimetry (NanoDSF) were performed in plasma samples. Heparin affinity of AT Padua was the lowest (KD = 1.08 × 10 -6 M) and had the most severe consequences affecting the allosteric pathways of activation, moreover significant destabilizing effects on AT were also observed. KD values for AT Basel, ATBp3 and wild-type AT were 7.64 × 10 -7 M, 2.15 × 10 -8 M and 6.4 × 10 -10 M, respectively. Heparin-binding of AT Basel was slower, however once the complex was formed the mutation had only minor effect on the secondary and tertiary structures. Allosteric activation of ATBp3 was altered, moreover decreased thermostability in ATBp3 homozygous plasma and increased fluctuations in multiple regions of ATBp3 were observed by in silico methods suggesting the presence of a quantitative component in the pathogenicity of this mutation due to molecular instability.

Background:  Hereditary antithrombin deficiency is a rare autosomal-dominant disorder predisposing to recurrent venous thromboembolism (VTE). To date, only two founder mutations have been described., Objectives:  We investigated the antithrombin p.Thr147Ala variant, found in 12 patients of African origin. This variant is known as rs2227606 with minor allele frequency of 0.5% in Africans and absent in Europeans. A possible founder effect was investigated., Methods:  Phenotypical characterization was established through immunological and functional methods, both under basal and stress conditions. Recombinant antithrombin molecules were constructed by site-directed mutagenesis and expressed in HEK-293T cells. Secreted antithrombin was purified and functionally characterized. Structural modeling was performed to predict the impact of the mutation on protein structure. A novel nanopore sequencing approach was used for haplotype investigation., Results:  Ten patients experienced VTE, stroke, or obstetric complications. Antithrombin antigen levels and anti-IIa activity were normal or slightly reduced while anti-Xa activity was reduced with only one commercial assay. On crossed immunoelectrophoresis, an increase of antithrombin fractions with reduced heparin affinity was observed under high ionic strength conditions but not under physiological conditions. The recombinant p.Thr147Ala protein displayed a reduced anti-Xa activity. Structural modeling revealed that residue Thr147 forms three hydrogen bonds that are abolished when mutated to alanine. The investigated patients shared a common haplotype involving 13 SERPINC1 intragenic single nucleotide polymorphisms., Conclusion:  Antithrombin p.Thr147Ala, responsible for antithrombin type II heparin binding site deficiency, is the first founder mutation reported in people of African ancestry. This study further emphasizes the limitations of commercial methods to diagnose this specific subtype., Competing Interests: None declared., (Thieme. All rights reserved.)

Genetic risk factors are important for the occurrence and prognosis of venous thromboembolism (VTE). The studies of thrombophilia families are important for dissecting the genetic background of the thrombotic disease. We conducted the systematic review of all published family-based studies on VTE genetics across all racial groups through PubMed and Embase prior to 13th April 2020. This systematic review of 287 families (including 225 Caucasian families, 52 East Asian families, and families of other ethnicities) revealed a total of 21 different genes; the five most reported mutated genes were F5 (88/287, 30.7%), SERPINC1 (67/287, 23.3%), PROC (65/287, 22.6%), F2 (40/287, 13.9%) and PROS1 (48/287, 16.7%). For Caucasian families, F5 mutations were most frequently reported at 37.8% (85/225), while PROS1 mutations were most frequently reported, at 40.4% (21/52), for East Asian families (Chinese, Japanese and Korean). Factor V Leiden was reported more frequently in Caucasians than in East Asians. Missense mutations were reported frequently in the SERPINC1, PROC and PROS1 genes. In conclusion, our study found the most likely mutated genes associated with VTE among different ethnic groups and provided indications for VTE genetic testing and research in the future.

Humans express seven heparan sulfate (HS) 3- O -sulfotransferases that differ in substrate specificity and tissue expression. Although genetic studies have indicated that 3- O -sulfated HS modulates many biological processes, ligand requirements for proteins engaging with HS modified by 3- O -sulfate (3-OS) have been difficult to determine. In particular, the context in which the 3-OS group needs to be presented for binding is largely unknown. We describe herein a modular synthetic approach that can provide structurally diverse HS oligosaccharides with and without 3-OS. The methodology was employed to prepare 27 hexasaccharides that were printed as a glycan microarray to examine ligand requirements of a wide range of HS-binding proteins. The binding selectivity of antithrombin-III (AT-III) compared well with anti-Factor Xa activity supporting robustness of the array technology. Many of the other examined HS-binding proteins required an IdoA2S-GlcNS3S6S sequon for binding but exhibited variable dependence for the 2-OS and 6-OS moieties, and a GlcA or IdoA2S residue neighboring the central GlcNS3S. The HS oligosaccharides were also examined as inhibitors of cell entry by herpes simplex virus type 1, which, surprisingly, showed a lack of dependence of 3-OS, indicating that, instead of glycoprotein D (gD), they competitively bind to gB and gC. The compounds were also used to examine substrate specificities of heparin lyases, which are enzymes used for depolymerization of HS/heparin for sequence determination and production of therapeutic heparins. It was found that cleavage by lyase II is influenced by 3-OS, while digestion by lyase I is only affected by 2-OS. Lyase III exhibited sensitivity to both 3-OS and 2-OS., Competing Interests: The authors declare no competing interest.

N-linked glycosylation is a crucial post-translational modification involved in protein folding, function, and clearance. N-linked glycosylation is also used therapeutically to enhance the half-lives of many proteins. Antithrombin, a serpin with four potential N-glycosylation sites, plays a pivotal role in hemostasis, wherein its deficiency significantly increases thrombotic risk. In this study, we used the introduction of N-glycosylation sites as a tool to explore what effect this glycosylation has on the protein folding, secretion, and function of this key anticoagulant. To accomplish this task, we introduced an additional N-glycosylation sequence in each strand. Interestingly, all regions that likely fold rapidly or were surrounded by lysines were not glycosylated even though an N-glycosylation sequon was present. The new sequon in the strands of the A- and B-sheets reduced secretion, and the B-sheet was more sensitive to these changes. However, the mutations in the strands of the C-sheet allowed correct folding and secretion, which resulted in functional variants. Therefore, our study revealed crucial regions for antithrombin secretion and could potentially apply to all serpins. These results could also help us understand the functional effects of natural variants causing type-I deficiencies.

Background: Hibernating American black bears have significantly different clotting parameters than their summer active counterparts, affording them protection against venous thromboembolism during prolonged periods of immobility. We sought to evaluate if significant differences exist between the expression of microRNAs in the plasma of hibernating black bears compared with their summer active counterparts, potentially contributing to differences in hemostasis during hibernation., Materials and Methods: MicroRNA sequencing was assessed in plasma from 21 American black bears in summer active (n = 11) and hibernating states (n = 10), and microRNA signatures during hibernating and active state were established using both bear and human genome. MicroRNA targets were predicted using messenger RNA (mRNA) transcripts from black bear kidney cells. In vitro studies were performed to confirm the relationship between identified microRNAs and mRNA expression, using artificial microRNA and human liver cells., Results: Using the bear genome, we identified 15 microRNAs differentially expressed in the plasma of hibernating black bears. Of these microRNAs, three were significantly downregulated (miR-141-3p, miR-200a-3p, and miR-200c-3p), were predicted to target SERPINC1, the gene for antithrombin, and demonstrated regulatory control of the gene mRNA expression in cell studies., Conclusions: Our findings suggest that the hibernating black bears' ability to maintain hemostasis and achieve protection from venous thromboembolism during prolonged periods of immobility may be due to changes in microRNA signatures and possible upregulation of antithrombin expression., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Antithrombin deficiency (ATD) was described in 1965 by Olav Egeberg as the first known inherited form of thrombophilia. Today, it is understood that ATDs can be congenital or acquired, leading to qualitative, quantitative, or mixed abnormalities in antithrombin (AT). All ATDs ultimately hinder AT's ability to serve as an endogenous anticoagulant and antiinflammatory agent. As a result, ATD patients possess higher risk for thromboembolism and can develop recurrent venous and arterial thromboses. Because heparin relies on AT to augment its physiologic function, patients with ATD often exhibit profound heparin resistance. Although rare as a genetic disorder, acquired forms of ATD are seen with surprising frequency in critically ill patients. This review discusses ATD in the context of surgical critical care with specific relevance to trauma, thermal burns, cardiothoracic surgery, and sepsis., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Objective: To analyze the phenotype and genotype of a patient affected with inherited antithrombin deficiency., Methods: All exons and exon-intron boundaries of the AT genes were subjected to PCR amplification and Sanger sequencing. The influence of variants on the disease was predicted using bioinformatic software (MutationTaster)., Results: The results of all coagulation tests were normal, though the antithrombin activity and antigen content of the proband and his father have decreased significantly (34%, 48% and 12.97 mg/dL, 15.60 mg/dL, respectively). His mother was normal. Genetic analysis revealed that the proband and his father both carried a heterozygous g.2736dupT variant of the AT gene. Bioinformatic analysis suggested that the variant may be pathogenic., Conclusion: The proband and his father both had type I hereditary antithrombin deficiency caused by a g.2736dupT variant of the AT gene. The variant was unreported previously.