Search

Pathogen introductions into novel areas can lead to the emergence of new fungal diseases of plants. Understanding the origin, introduction pathways, possible changes in reproductive system and population size of fungal pathogens is essential in devising an integrated strategy for the control of these diseases. We used minisatellite markers to infer the worldwide invasion history of the fungal plant pathogen Leptosphaeria maculans, which causes stem canker (blackleg) of oilseed and vegetable brassicas. Clustering analyses partitioned genotypes into distinct populations corresponding to major geographic regions, along with two differentiated populations in Western Canada. Comparison of invasion scenarios using Approximate Bayesian Computation suggested an origin of the pathogen in the USA, the region where epidemics were first recorded, and independent introductions from there over the last few decades into Eastern Canada (Ontario), Europe and Australia. The population in Western Canada appeared to be founded from a source in Ontario and the population in Chile resulted from an admixture between multiple sources. A bottleneck was inferred for the introduction into Western Canada but not into Europe, Ontario or Australia. Clonality appeared high in Western Canada, possibly because environmental conditions there were less conducive to sexual reproduction. Leptosphaeria maculans is a model invasive pathogen with contrasting features in different regions: shallow population structure, high genetic variability and regular sexual recombination in some regions, by comparison with reduced genetic variability, high rates of asexual multiplication, strong population structure or admixture in others. [ABSTRACT FROM AUTHOR]

Leptosphaeria maculansis the most ubiquitous pathogen of Brassica crops, and mainly oilseed brassicas (oilseed rape, canola), causing the devastating‘stem canker’ or‘blackleg’. This review summarizes our current knowledge on the pathogen, from taxonomic issues to specific life traits. It mainly illustrates the importance of formal genetics approaches on the pathogen side to dissect the interaction with the host plants. In addition, this review presents the main current research topics onL. maculansand focuses on theL. maculansgenome initiative recently begun, including its main research issues.Leptosphaeria maculans(Desm.) Ces.&de Not. (anamorphPhoma lingamTode ex Fr.). Kingdom Fungi, Phylum Ascomycota, Class Dothideomycetes (Loculoascomycetes), Order Pleosporales, GenusLeptosphaeria, Speciesmaculans.cultivated Brassicas such asBrassica napus(oilseed rape, canola),B. rapa,B. juncea,B. oleracea, etc., along with numerous wild crucifers species.Arabidopsis thalianawas recently reported to be a potential host forL. maculans. Primary disease symptoms are greyish-green collapse of cotyledon or leaf tissue, without a visible margin, bearing tiny black spots (pycnidia). The fungus then develops an endophytic symptomless growth for many months. Secondary symptoms, at the end of the growing season, are dry necroses of the crown tissues with occasional blackening (stem canker or blackleg) causing lodging of the plants. Pseudothecia differentiate on leftover residues. Seedling damping-off and premature ripening are also reported under certain environmental conditions.Leptosphaeria maculanssequencing project at Genoscope:; the SECURE site:the‘Blackleg’ group at the University of Melbourne: [ABSTRACT FROM AUTHOR]

The colonization of winter oilseed rape plants and epidemiology of phoma stem canker differed between A/Tox+ and B/Tox0 Leptosphaeria maculans . In France and England, where plant colonization was investigated during two and three growing seasons, respectively, there was a difference in timing of leaf infection; A/Tox+ L. maculans was predominant on leaves in the autumn (October/November) but there was an increase in the incidence of B/Tox0 in the winter (January/February). In May, June and July both species could be isolated from all external parts of the plant (root to the upper stem) and all crown (stem base) tissues, although they differed in their distribution. At the root and crown, A/Tox+ L. maculans was predominant and was located throughout the cortex, wood and pith tissues, but the rarer B/Tox0 was located mainly in the cortex. Approximately equal numbers of A/Tox+ and B/Tox0 isolates were obtained from the upper stem – there was a greater proportion of B/Tox0 isolates than at the crown. In England, after harvest in 1999 and 2000, pseudothecia on the lignified tap root and crown tissues produced predominantly A/Tox+ ascospores (94%), while pseudothecia higher up the stem produced more B/Tox0 ascospores (60%) than A/Tox+ ascospores (40%). The timing of the onset of leaf spotting, earlier in the season for A/Tox+ than B/Tox0 L. maculans , and the predominance of mycelium of A/Tox+ at the crown are consistent with the assumption that A/Tox+ is more likely to cause the most damaging stem cankers than B/Tox0 L. maculans . Identification as A/Tox+ or B/Tox0 by cultural characteristics differed only slightly (2·3%) from identification by molecular techniques. [ABSTRACT FROM AUTHOR]

The result of the Leptosphaeria maculans/Brassica napus interaction is usually assessed by symptom scoring following a cotyledon-inoculation test. However, an early evaluation of the interaction, and reliable quantitative data of fungal growth inside plant tissues are needed lo supplement the visual assessment of the symptoms. For this purpose, we developed a quantitative double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using rabbit polyclonal antisera directed against soluble mycelial proteins. The specificity of the serum was first assessed by immunoblotting following isoelectric focusing of soluble proteins (Western blot) and by DAS-ELISA. Except for Alternaria brassicae, no cross-reactions were observed with mycelial extracts of saprophytes or pathogens of B. napus following DAS-ELISA. Although Tox+ and Tox0 isolates of L. maculans were unequivocally discriminated by Western blot, they were quantitatively indistinguishable following ELISA, thus enabling us to analyse a wide range of L. maculans isolates in planta. The detection limit of the assay was less than 10 ng of fungal proteins per ml of plant extract. For a given isolate, time-course studies showed that fungal growth in cotyledons was correlated with symptom scoring. In the case of hypersensitive response, only 34% of the plants were ELISA-positive, and these plants never contained more than 10 ng of fungal protein per cotyledon. In contrast, in the cases of susceptibility, 100% of the plants were ELISA-positive and fungal protein content was higher than 10/μg per cotyledon. Moreover, significant differences in ability to colonize the tissues were observed among Tox+ isolates. Finally, using the ELISA quantification, intermediate symptoms could be differentiated as lateresistance responses or susceptibility. [ABSTRACT FROM AUTHOR]

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.