Search

Pathogenic large inversions are rarely reported on DMD gene due to the lack of effective detection methods. Here we report two DMD pedigrees and proposed a reliable pipeline to define large inversions in DMD patients. In the first pedigree, conventional approaches including multiplex ligation-dependent probe amplification, and whole-exome sequencing by next generation sequencing were failed to detect any pathologic variant. Then an advanced analysis pipeline which consists of RNA-seq, cDNA array capture sequencing, optical mapping, long-read sequencing was built. RNA-seq and cDNA capture sequencing showed a complete absence of transcripts of exons 3-55. Optical mapping identified a 55 Mb pericentric inversion between Xp21 and Xq21. Subsequently, long-read sequencing and Sanger sequencing determined the inversion breakpoints at 32,915,769 and 87,989,324 of the X chromosomes. In the second pedigree, long-read sequencing was directly conducted and Sanger sequencing was performed to verify the mutation. Long-read sequencing and Sanger sequencing found breakpoints at 32,581,576 and 127,797,236 on DMD gene directly. In conclusion, large inversion might be a rare but important mutation type in DMD gene. An effective pipeline was built in detecting large inversion mutations based on long-read sequencing platforms.

OBJECTIVE: : To investigate molecular and clinical characteristics of children with permanent congenital hypothyroidism (CH) in Yunnan, China. METHODS: : The clinical data of 40 children with CH diagnosed and treated in the First People’s Hospital of Yunnan Province during January 2016 and January 2019 were retrospectively analyzed. All children were followed up to 3 years old, and Gesell intelligent score was evaluated at age of 1, 2 and 3 years, respectively. Developmental status and prognosis were evaluated. Next-generation sequencing (NGS) was used to screen all exons and exon-intron boundary sequences of the 27 known CH associated genes, and the relationship between genotypes and clinical phenotypes was analyzed. RESULTS: : Among the 40 children, the thyroid related pathogenic gene mutations were detected in 23 cases with a rate of 57.5%, and a total of 32 mutations of 8 genes were detected. Mutations in DUOX2, TPO and TSHR genes were the most common ones with mutation frequencies of 65.9%(29/44), 11.4%(5/44) and 9.1%(4/44), respectively. DUOX2 gene mutations were detected in 17 children with CH, and a total of 17 mutation types were detected. p.K530* was the most common mutation in DUOX2 gene, accounting for 20.7%(6/29). There was no significant difference in physical development and intelligence assessment between children with DUOX2 heterozygous mutation and compound heterozygous mutations. None of patients could terminate medication at 3 years of the follow-up and all of them were provisionally assessed as permanent CH. The physical and mental development assessment of children with other gene mutations were also in the normal range. CONCLUSION: : The detection rate of DUOX2, TPO and TSHR pathogenic mutations are high among children with permanent CH in Yunnan area, and no correlation is observed between gene mutation types and prognosis in children with CH.

TORCH, the acronym of Toxoplasma gondii (TOX), others, rubella virus (RUV), cytomegalovirus (CMV) and herpes simplex virus (HSV), is a major contributor to congenital infection. National population-based study on the seroepidemiology of TORCH in women is yet lacking, and it is still obscure whether TORCH infection in the women was associated with adverse pregnancy outcomes. A total of 48,406 asymptomatic women from eight hospitals in China which covered the most areas of mainland China were enrolled in this study, and 26,400 were simultaneously subjected to 7 detection tests for TORCH specific antibodies. Chemiluminescent immunoassay was performed to detect TORCH Immunoglobulin M (IgM) and/or Immunoglobulin G (IgG) antibodies, and IgG avidities of TOX and CMV IgM and IgG positive serum samples. The overall IgG prevalence of TOX, RUV, CMV and HSV-(1 + 2) in the reproductive-aged women was 1.71 %, 81.97 %, 95.09 % and 90.15 % respectively. The corresponding IgM prevalence of TOX, RUV and CMV was 0.30 %, 0.89 % and 0.52 %. Moreover, the rates of primary TOX and CMV infections were at least 0.08 % (21/26,400) and 0.03 % (7/26,400) in the studied population. The distributions of TORCH positive women in various age, season and region groups were different (P0.05). The CMV IgM-positive rate was higher in the pregnant women than those in non-pregnant women (P0.05). The higher past infection rates of RUV, CMV and HSV in women with bad obstetric history (BOH) imply that TORCH infections are associated with BOH. These data suggest that TORCH infections in the prenatal women, especially with BOH, are worthwhile to be screened by detections of specific IgG and IgM antibodies, and even IgG avidities.

Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., In this study, we identified five novel mutations in the five families: HBA2:c.245C>T, HBA2:c.54delC, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for the isoelectric point, amino acid conservation, and pathogenicity of the missense mutation.

Background Most embryos that spontaneously abort during early pregnancy are found to have chromosomal abnormalities. The purpose of this study is to explore the factors involved in chromosome aberrations during embryogenesis. Methods A case-case study was performed to compare the risk factors for spontaneous abortion with and without embryo chromosome aberration. A total of 160 cases of spontaneous abortion were enrolled from a tertiary general hospital in Kunming. KaryoLite BACs-on-Beads (KL-BoBs) and fluorescence in situ hybridization (FISH) were employed to determine chromosomal constitution of abortion chorion villus samples. Maternal serum levels of homocysteine (Hcy) were detected by high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Information about clinical background and environmental exposure was collected through a self-designed questionnaire. To identify the inherited chromosomal abnormalities, couples with chromosomal abnormalities in abortus were recalled for karyotyping. Results The overall rate of chromosomal abnormalities was 62.5% (100/160, KL-BoBs combined with FISH) including 51.9% (83/160) aneuploidies, 6.3% (10/160) polyploidies, and 4.4% (7/160) structural abnormalities. Only one case of structural abnormality was found to be inherited from maternal balanced translocation. Compared to abortus with normal karyotype, abortus with abnormal karyotype showed a positive association with parental age and elevated maternal serum homocysteine (Hcy) level, but negative association with previous miscarriage and perceived noise. Conclusions Embryonic chromosomal aberrations accounted for the majority of spontaneous abortion cases. A combination of internal and external factors may induce spontaneous abortion through fetal chromosomal aberrations or other pathogenic mechanisms.

Background We aimed to evaluate the clinical value of copy number variation-sequencing (CNV-Seq) in combination with cytogenetic karyotyping in prenatal diagnosis. Methods CNV-Seq and cytogenetic karyotyping were performed in parallel for 9452 prenatal samples for comparison of the diagnostic performance of the two methods, and to evaluate the screening performance of maternal age, maternal serum screening, fetal ultrasound scanning and noninvasive prenatal testing (NIPT) for fetal pathogenic copy number variation (CNV). Results Among the 9452 prenatal samples, traditional karyotyping detected 704 cases (7.5%) of abnormal cytogenetic karyotypes, 171 (1.8%) chromosome polymorphism, 20 (0.2%) subtle structural variations, 74 (0.7%) mutual translocation (possibly balanced), 52 (0.6%) without karyotyping results, and 8431 (89.2%) normal cytogenetic karyotypes. Among the 8705 cases with normal karyotype, polymorphism, mutual translocation, or marker chromosome, CNV-Seq detected 63 cases (0.7%) of pathogenic chromosome microdeletion/duplication. Retrospectively, noninvasive prenatal testing (NIPT) had high sensitivity and specificity for the screening of fetal pathogenic CNV, and NIPT combining with maternal age, maternal serum screening or fetal ultrasound scanning, which improved the screening performance. Conclusion The combined application of cytogenetic karyotyping and CNV-Seq significantly improved the detection rate of fetal pathogenic chromosome microdeletion/duplication. NIPT was recommended for the screening of pathogenic chromosome microdeletion/duplication, and NIPT combining with other screening methods further improved the screening performance for pathogenic fetal CNV.

Hemoglobinopathies are the most common monogenic disorders worldwide. Substantial effort has been made to establish databases to record complete mutation spectra causing or modifying this group of diseases. We present a variant database which couples an online auxiliary diagnosis and at‐risk assessment system for hemoglobinopathies (DASH). The database was integrated into the Leiden Open Variation Database (LOVD), in which we included all reported variants focusing on a Chinese population by literature peer review‐curation and existing databases, such as HbVar and IthaGenes. In addition, comprehensive mutation data generated by high‐throughput sequencing of 2,087 hemoglobinopathy patients and 20,222 general individuals from southern China were also incorporated into the database. These sequencing data enabled us to observe disease‐causing and modifier variants responsible for hemoglobinopathies in bulk. Currently, 371 unique variants have been recorded; 265 of 371 were described as disease‐causing variants, whereas 106 were defined as modifier variants, including 34 functional variants identified by a quantitative trait association study of this high‐throughput sequencing data. Due to the availability of a comprehensive phenotype‐genotype data set, DASH has been established to automatically provide accurate suggestions on diagnosis and genetic counseling of hemoglobinopathies. LOVD‐DASH will inspire us to deal with clinical genotyping and molecular screening for other Mendelian disorders.

Recent in vitro and clinical studies have found that metformin (MET) may play a preventive or therapeutic role in preeclampsia (PE) and may be a candidate drug for the prevention and/or treatment of PE. In this study, we used lipopolysaccharide (LPS) to induce a PE-like rat model and investigated the intervention effect of MET from the perspectives of clinical manifestations, placental morphology, serum marker for placental injury, systemic inflammatory response and oxidative/nitrative stress, and placental nuclear factor-κB (NF-κB) signaling. The results showed that MET improved LPS-induced hypertension, proteinuria, fetal growth restriction (FGR) and stillbirth, alleviated placental injury and decreased maternal serum marker alpha-fetoprotein (MS-AFP) level; MET suppressed LPS-induced TNF-α and IL-6 productions, reduced oxidative/nitrative stress as evidenced by increased superoxide dismutase (SOD) activity, decreased inducible nitric oxide synthase (iNOS) activity, and decreased levels of malondialdehyde (MDA) and nitric oxide (NO); MET inhibited LPS-induced NF-κB activation in placentas. Based on these findings, it can be concluded that MET is beneficial to the PE-like rat model by protecting placentas from injury, suppressing systemic inflammatory response and oxidative/nitrative stress, and inhibiting placental NF-κB signaling pathway. MET is a promising drug for prevention and/or treatment of PE.

AIM It has been reported in numerous studies that elevated maternal serum alpha-fetoprotein (MS-AFP) is associated with adverse pregnancy outcomes (APO), such as pre-eclampsia, stillbirth, preterm birth and fetal growth restriction. However, the mechanism linking elevated MS-AFP and APO is obscure. In this study, we tried to explore the mechanism by using pregnant rats. METHODS Lipopolysaccharide (LPS) was used to induce placental inflammation in pregnant rats. Maternal serum and placental inflammatory cytokines and placental morphology were used to assess the level of placental inflammation. The incidences of APO and the levels of MS-AFP were evaluated. The expressions of alpha-fetoprotein (AFP) in the related organs and fetal serum AFP levels were detected. RESULTS Compared to saline-treated pregnant rats, LPS led to elevated maternal serum and placental inflammatory cytokines and a higher rate of placental inflammation. Lipopolysaccharide resulted in the features of APO and at the same time elevated MS-AFP. Maternal serum alpha-fetoprotein levels were significantly correlated to the evaluation parameters of APO. Lipopolysaccharide did not increase the expressions of AFP in fetal liver, maternal liver and placenta, but reduced the fetal serum AFP levels. CONCLUSION The phenomenon that elevated MS-AFP is associated with APO, which has been reported in human pregnancies, is observed in our rat model. Placental inflammation can be the potential cause linking the two manifestations together. Although the source of elevated MS-AFP is not identified, fetal blood circulation is suspected. Our study may provide an animal model for the future studies on this subject.

Background Targeted next‐generation sequencing is an efficient tool to identify pathogenic mutations of hereditary deafness. The molecular pathology of deaf patients in southwestern China is not fully understood. Methods In this study, targeted next‐generation sequencing of 127 deafness genes was performed on 84 deaf patients. They were not caused by common mutations of GJB2 gene, including c.35delG, c.109 G>A, c.167delT, c.176_191del16, c.235delC and c.299_300delAT. Results In the cohorts of 84 deaf patients, we did not find any candidate pathogenic variants in 14 deaf patients (16.7%, 14/84). In other 70 deaf patients (83.3%, 70/84), candidate pathogenic variants were identified in 34 genes. Of these 70 deaf patients, the percentage of “Solved” and “Unsolved” patients was 51.43% (36/70) and 48.57% (34/70), respectively. The most common causative genes were SLC26A4 (12.9%, 9/70), MT‐RNR1 (11.4%, 8/70), and MYO7A (2.9%, 2/70) in deaf patients. In “Unsolved” patients, possible pathogenic variants were most found in SLC26A4 (8.9%, 3/34), MYO7A (5.9%, 2/34), OTOF (5.9%, 2/34), and PDZD7 (5.9%, 2/34) genes. Interesting, several novel recessive pathogenic variants were identified, like SLC26A4 c.290T>G, SLC26A4 c.599A>G, PDZD7c.490 C>T, etc. Conclusion In addition to common deafness genes, like GJB2, SLC26A4, and MT‐RNR1 genes, other deafness genes (MYO7A, OTOF, PDZD7, etc.) were identified in deaf patients from southwestern China. Therefore, the spectrum of deafness genes in this area should be further studied., In addition to common deafness genes, like GJB2, SLC26A4, and MT‐RNR1 genes, other deafness genes (MYO7A, OTOF, PDZD7, etc.) were identified in deaf patients from southwestern China.

Despite the developmental toxicity reported in animals, few epidemiologic studies have investigated the potential effects of prenatal exposure to pyrethroid pesticides (PYRs) on fetal growth. A birth cohort study was conducted to examine the association between prenatal exposure to PYRs and birth outcomes, and a nested case-control study was conducted in this cohort to evaluate the effects of PYR on congenital defects. The assessment of PYR exposure was based on self-reported household pesticide use and urinary PYR metabolite levels. We found that pregnant women in this region were ubiquitously exposed to low-level PYRs, although few reported household pesticide use. Women who often ate bananas or cantaloupes had a higher level of urinary 3-(2,2-dibromovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid (DBCA), and the number of fruit types consumed by pregnant women was positively related to the concentrations of 3-phenoxybenzoic acid (3PBA) and total PYR metabolites (P < 0.05). Increased urinary 4-fluoro-3-phenoxybenzoic acid (4F3PBA), DBCA, and total PYR metabolites were associated with increased birth weight, length, and gestational age, and with decreased risk of small for gestational age (SGA) and/or premature birth. However, maternal household pesticides use was related to congenital anomalies. Thus, although prenatal exposure to low-dose PYRs promoted the fetal growth, the beneficial effects of fruit intake may outweigh the adverse effects of pesticide exposure. This study provided us an insight into the biological mechanisms for the effect of prenatal PYR exposure on fetal development, and suggested that further investigations in a larger study population with low-dose PYR exposure is needed.

To perform carrier screening for spinal muscular atrophy (SMA) among 3049 reproductive-age individuals from Yunnan region and determine the copy number of survival motor neuron (SMN) gene and carrier frequencies.Multiplex ligation-dependent probe amplification (MLPA) was used to determine the copy number of exon 7 of SMN1 and SMN2 genes and identify those with a single copy of SMN1 gene. Prenatal diagnosis was performed for couples whom were both found to be SMA carriers.In total 62 SMA carriers were identified among the 3049 subjects, which yielded a carrier frequency of 1 in 49 (2.03%). No statistical difference was found in the carrier frequency between males and females (1.91% vs. 2.30%, P0.05). Respectively, 1.3% (41/3049) and 0.69% (21/3049) of the carriers were caused by heterozygous deletion and conversion of the SMN1 gene. The average copy number for SMN1 alleles was 1.99. Two couples were found to be both as SMA carriers, for whom the birth of an affected fetus was avoided by prenatal diagnosis.No difference was found in the carrier frequency of SMA-related mutations between the two genders in Yunnan region, which was in keeping to an autosomal recessive inheritance pattern. Determination of the carrier frequency for SMA and SMN gene variants may provide a basis for genetic counseling and prenatal diagnosis for the disease.

In this article, the correlation between the copy number of survival motor neuron 2 (SMN2) gene, neuronal apoptosis inhibitory protein (NAIP), and the phenotype of spinal muscular atrophy patients were analyzed.Forty patients with spinal muscular atrophy (SMA) were included in the study at the Department of Medical Genetics of the First People's Hospital and the Department of Neurology of the Second People's Hospital in Yunnan Province from January 2012 to September 2018. Multiplex ligation-dependent probe amplification assay was performed to determine the copy numbers of SMN2 and NAIP genes. Statistical analysis was performed to determine the correlation between copy numbers of the SMN2 and NAIP genes and the clinical phenotypes of SMA.Our results show that among the 40 SMA patients, there were 13 type I cases, 16 type II cases and 11 type III cases. A total of 37 patients possessed a homozygous deletion of SMN1 exons 7 and 8, while the other 3 SMA patients possessed a single copy of SMN1 exon 8. There was no correlation between SMA subtypes and the deletion types of SMN1 exon 7 and 8 (P = .611). The percentage of 2, 3, and 4 copies of SMN2 exon 7 was 25.0%, 62.5%, and 12.5%, respectively. The percentage of 0, 1, and 2 copies of NAIP exon 5 was 10%, 57.5%, and 32.5%, respectively. The distributions of SMN2 and NAIP copy numbers among various SMA types were significantly different (all P

Background It is well known that second-trimester maternal serum alpha-fetoprotein (MS-AFP) is a predictor for adverse pregnancy outcomes (APOs), such as preterm birth, stillbirth, preeclampsia and small for gestational age (SGA). However, it is unknown whether first-trimester MS-AFP is also predictive of APOs. Methods We retrospectively reviewed the data on the first-trimester MS-AFP levels and pregnancy outcomes of 3325 singleton pregnant women. The cutoff value of 2.5 multiple of the median (MoM) was used to evaluate the risks of APOs regarding MS-AFP. The receiver operating characteristic (ROC) curves were used to evaluate the predictive efficiencies of MS-AFP to these disorders. Results A total of 181 pregnancies resulted in preterm birth, 32 in stillbirth, 81 in preeclampsia, and 362 in SGA. Compared to women with MS-AFP P = 0.004) and a lower distribution of neonatal birth weights (P = 0.000), but the actual between-group differences were minuscule. The areas under ROC curves were 0.572 (P = 0.001), 0.579 (P = 0.015) and 0.565 (P = 0.000) for preterm birth, preeclampsia and SGA, respectively. Subdivisions for the disorders did not obviously improve the performances of MS-AFP. Conclusions Elevated first-trimester MS-AFP is associated with increased risk of preterm birth, preeclampsia and SGA. However, the predictive efficiencies were low and it is not a good predictor for these APOs.

Expanded carrier screening (ECS) has been demonstrated to increase the detection rate of carriers compared with traditional tests. The aim of this study was to assess the potential value of ECS for clinical application in Southern China, a region with high prevalence of thalassemia and with diverse ethnic groups, and to provide a reference for future implementations in areas with similar population characteristics. A total of 10,476 prenatal/preconception couples from 34 self-reported ethnic groups were simultaneously tested and analyzed anonymously for 11 Mendelian disorders using targeted next-generation sequencing. Overall, 27.49% of individuals without self-reported family history of disorders were found to be carriers of at least 1 of the 11 conditions, and the carrier frequency varied greatly between ethnic groups, ranging from 4.15% to 81.35%. Furthermore, 255 couples (2.43%) were identified as carrier couples at an elevated risk having an affected baby, sixty-five of which would not have been identified through the existing screening strategy, which only detects thalassemia. The modeled risk of fetuses being affected by any of the selected disorders was 531 per 100,000 (95% CI, 497-567 per 100,000). Our data demonstrate the feasibility of ECS, and provide evidence that ECS is a promising alternative to traditional one-condition screening strategies. The lessons learned from this experience should be applicable for other countries or regions with diverse ethnic groups.

Postsynaptic density (PSD) proteins have been implicated in the pathophysiology of neurodevelopmental and psychiatric disorders. Here, we present detailed clinical and genetic data for 20 patients with likely gene-disrupting mutations in TANC2—whose protein product interacts with multiple PSD proteins. Pediatric patients with disruptive mutations present with autism, intellectual disability, and delayed language and motor development. In addition to a variable degree of epilepsy and facial dysmorphism, we observe a pattern of more complex psychiatric dysfunction or behavioral problems in adult probands or carrier parents. Although this observation requires replication to establish statistical significance, it also suggests that mutations in this gene are associated with a variety of neuropsychiatric disorders consistent with its postsynaptic function. We find that TANC2 is expressed broadly in the human developing brain, especially in excitatory neurons and glial cells, but shows a more restricted pattern in Drosophila glial cells where its disruption affects behavioral outcomes., Neurodevelopmental disorders (NDDs) are a heterogeneous group of diseases for which the genetic basis is still unknown in more than half of the cases. Here, the authors report a NDD associated with disruptive variants in the TANC2 gene and show that rols, the TANC2 homolog in flies, is required for synapse growth and function.

Themutations of androgen receptor (AR) gene are the most common cause for complete androgen insensitivity syndrome (CAIS). We aimed to characterize the six cases enrolled in our hospital (the First People's Hospital of Yunnan, China) and explore the molecular mechanism of CAIS. Between 2010 and 2013, six female cases were enrolled in our hospital for the agenesis of secondary sexual characteristics. The clinical examinations such as sex hormone test and B ultrasound were performed and the genetic characterization of patients were evaluated by karyotype analysis, polymerase chain reaction and DNA sequencing. The six cases with 46, XY karyotype were diagnosed with CAIS and four novel AR mutations were discovered, which were responsible for Chinese CAIS. The molecular study of the AR gene facilitated the understanding of themechanism of CAIS and provided the genetic counselling clinically.

Large vestibular aqueduct syndrome (LVAS) is a type of hearing loss characterized by an autosomal recessive inheritance. LVAS has been shown to be associated with mutations in SLC26A4 gene. In the present study, we report the clinical, genetic and molecular characterization of a Chinese family with LVAS. By using the targeted sequence capture and next-generation sequencing, we identified heterozygous mutations of SLC26A4 p.I188T (c.563T > C), p.L582LfsX4 (c.1746 delG) and p.E704K (c.2110G > A) in the affected individual of this family, of which SLC26A4 p.E704K is a novel mutation associated with LVAS. By tracing the transmission and functional prediction of these mutations in the pedigree, the heterozygous mutations of p.I188T, p.L582LfsX4 and p.E704K in SLC26A4 gene were responsible for the LVAS of the affected individual. This is the first case of LVAS caused by these mutations.

Objective: The aim of this study was to investigate the overall distribution of pregnancy outcomes in women with elevated second-trimester maternal serum alpha-fetoprotein (MS-AFP), and to determine the risk of adverse pregnancy outcomes (APOs) by MS-AFP level. Materials and methods: We retrospectively analyzed the clinical data of 429 women with elevated MS-AFP (≥2.5 multiple of the median (MOM)) and 1555 women with normal MS-AFP (0.5–2.49MOM) from a total of 46,741 prenatally screened singleton pregnant women. The overall distribution of APOs of the two groups, the risk of APOs by MS-AFP level, and the predictive value of elevated MS-AFP to APOs were analyzed. Results: The incidence rate of APOs in elevated MS-AFP group was significantly higher than that in normal MS-AFP group (42.89 vs. 8.23%). In elevated MS-AFP group, the top three APOs, in term of incidence rate, were structural fetal abnormalities (7.93%), spontaneous abortion (7.46%) and preterm birth (7.23%); regarding to the risk, the top three APOs were stillbirth, spontaneous abortion and early-onset preeclampsia (odds ratio 35.98, 20.81 and 8.58 respectively). For structural fetal abnormalities, MS-AFP had predictive values for fetal open neural tube defects (ONTDs), gastroschisis and multiple malformations. Conclusion: Elevated MS-AFP is associated with increased risks of APOs. ONTDs complicate merely a small proportion of pregnancies with elevated MS-AFP, and the rest of them have high risks of obstetric complications. MS-AFP can help to identify these women at high risk of APOs in earlier second-trimester. Keywords: Alpha-fetoproteins, Neural tube defects, Pre-eclampsia, Premature birth, Spontaneous abortion, Stillbirth

Abnormal haemoglobin (Hb) variants result in the most commonly inherited disorders in humans worldwide. In this study, we investigated the molecular epidemiology characteristics of Hb variants, along with associated structural and functional predictions in the Yunnan province population of Southwestern China. A total of 41,933 subjects who sought haemoglobinopathy screening were included. Based on bioinformatics and structural analysis, as well as protein modeling, the pathogenesis and type of Hb genetic mutations were characterized. Among all individuals studied, 328 cases (0.78%) were confirmed as carriers of Hb variants, with 13 cases (0.03%) presenting α-globin variants, 313 (0.75%) β-globin variants, and two δ-globin variants. A total of 19 different mutations were identified, including three novel mutations. In addition, 48 cases of ααCS mutations and 14 cases of Hb H or Hb Bart’s were found. The isoelectric point, evolutionary conservation, and genotype-phenotype correlation for these mutations were predicted. Additionally, secondary and tertiary protein structure modeling were performed for three selected mutations. In conclusion, the prevalence of Hb variants in the Yunnan population is much higher than other regions of China. Complete characterization of these Hb variants is essential for generating a rational strategy to control the haemoglobinopathies in this region.

Background Deletional hereditary persistence of fetal hemoglobin (HPFH)/δβ‐thalassemia and δ‐thalassemia are rare inherited disorders which may complicate the diagnosis of β‐thalassemia. The aim of this study was to reveal the frequency of these two disorders in Southwestern China. Methods A total of 33,596 subjects were enrolled for deletional HPFH/δβ‐thalassemia, and positive individuals with high fetal hemoglobin (Hb F) level were diagnosed by multiplex ligation‐dependent probe amplification (MLPA). A total of 17,834 subjects were analyzed for mutations in the δ‐globin gene. Positive samples with low Hb A2 levels were confirmed by δ‐globin gene sequencing. Furthermore, the pathogenicity and construction of a selected δ‐globin mutation were analyzed. Results A total of 92 suspected cases with Hb F ≥5.0% were further characterized by MLPA. Eight different deletional HPFH/δβ‐thalassemia were observed at a frequency of 0.024%. In addition, 195 cases suspected to have a δ‐globin gene mutation (Hb A2 ≤2.0%) were characterized by molecular analysis. δ‐Globin gene mutation was found at a frequency of 0.49% in Yunnan. The pathogenicity and construction for a selected δ‐globin mutation was predicted. Conclusion Screening of these two disorders was analyzed in Southwestern China, which could define the molecular basis of these conditions in this population.

Multiple chromosomal aneuploidies may be associated with maternal malignancies and can cause failure of noninvasive prenatal screening (NIPS) tests. However, multiple chromosomal aneuploidies show poor specificity and selectivity for diagnosing maternal malignancies. This multicenter retrospective analysis evaluated 639 pregnant women who tested positive for multiple chromosomal aneuploidies on initial NIPS test between January 2016 and December 2017. Women were assessed using genome profiling of copy-number variations, which was translated to cancer risk using a novel bioinformatics algorithm called the cancer detection pipeline (CDP). Sensitivity, specificity, and positive predictive value (PPV) of diagnosing maternal malignancies were compared for multiple chromosomal aneuploidies, the CDP model, and the combination of CDP and plasma tumor markers. Of the 639 subjects, 41 maternal malignant cancer cases were diagnosed. Multiple chromosomal aneuploidies predicted maternal malignancies with a PPV of 7.6%. Application of the CDP algorithm to women with multiple chromosomal aneuploidies allowed 34 of the 41 (83%) cancer cases to be identified, while excluding 422 of 501 (84.2%) of the false positive cases. Combining the CDP with plasma tumor marker testing gave PPV of 75.0%. The CDP algorithm can diagnose occult maternal malignancies with a reasonable PPV in multiple chromosomal aneuploidies–positive pregnant women in NIPS tests. This performance can be further improved by incorporating findings for plasma tumor markers.

Introduction MYO7A gene has been shown to be associated with Usher syndrome 1B and nonsyndromic deafness. Although a lot of mutations have been reported in MYO7A gene, novel MYO7A mutations are continuously to be identified. Methods Targeted next generation sequencing was performed on the two unrelated patients with Usher syndrome 1B and nonsyndromic deafness respectively. The identified mutations from targeted next generation sequencing were further validated by Sanger sequencing, and analyzed by bioinformatics tools, like SIFT, Polyphen-2, PyMOL, I-Mutant 2.0 and so on. Results By analyzing the sequencing data of these two patients, four novel MYO7A mutations were revealed: (i) MYO7A p.Tyr560Ser and p.Ala2039Pro were associated with Usher syndrome 1B. (ii) MYO7A c.2187 + 2_+8 delTGAGCAC and p.Leu728Pro were related to nonsyndromic hearing loss. These mutations were further proved to be possibly disease-causing by segregation analysis, conservation analysis and bioinformatics tools. Conclusions Four novel MYO7A mutations were identified in the present study. These findings provided new evidence for the genetic counseling of Usher syndrome 1B and nonsyndromic deafness.

ObjectiveTo evaluate the use of a portable, rechargeable colposcope combined with human papillomavirus (HPV) testing, as compared with HPV testing alone, for screening of cervical cancer and pre-cancerous lesions.MethodsThis was a cross-sectional study among 488 women in Baoshan County, Yunnan. The women underwent HPV testing followed by Gynocular portable colposcopy with visual inspection with acetic acid. Obvious lesions were biopsied. If portable colposcopy testing was negative but HPV testing was positive, the women underwent follow-up testing with thin-prep cytology and traditional colposcopy. Cervical biopsies were performed for any abnormalities. Histopathology was followed up with diagnosis and treatment.ResultsAmong 488 women screened with portable colposcopy, 24 women underwent biopsy based on positive colposcopy screening. Of these 24 women, three were HPV positive and 21 were HPV negative. Five women had cervical intra-epithelial neoplasia (CIN) I and one had advanced cervical cancer. Forty-six women tested positive for HPV. Three of these women had screened positive on preliminary colposcopy, with one positive for CIN III/squamous cell carcinoma and one woman with CIN I. Forty-three women underwent follow-up testing with thin-prep cytology. Two women had atypical squamous cells of undetermined significance and five had low-grade squamous intra-epithelial lesions and were biopsied; three women had CIN I, one had CIN II and one had CIN III. HPV testing and portable colposcopy was more sensitive but slightly less specific than portable colposcopy or HPV testing alone.ConclusionWhile HPV testing has high sensitivity and specificity for the detection of pre-cancerous and cancerous lesions and portable colposcopy has lower specificity, both methods of detection have low positive predictive value and high negative predictive value. In tandem, HPV testing and portable colposcopy had higher sensitivity for detection among women who underwent biopsies. In clinical practice, portable colposcopy was an effective, easy and affordable tool to transport to villages where cytology is not currently feasible.

This is a follow-up study based on the results of our previous article, to further explore the effect of the TP53 codon 72 (rs1042522) and MDM2 SNP309 (rs2279744) polymorphisms on basal follicle-stimulating hormone (FSH)/luteinizing hormone (LH) ratios in infertility women.The distribution of two genetic polymorphisms (rs1042522 and rs2279744) and basal FSH/LH ratios were tested and analyzed in 1051 in vitro fertilization (IVF) patients at a university-affiliated hospital.The TP53 codon 72 polymorphism had a significant association with the FSH/LH ratio (group I: FSH/LH2.3 and group II: FSH/LH ≥2.3) (C/C vs. G/G: odds ratio [OR] = 1.69, 95% confidence interval [CI]: 1.07-2.65, p = 0.02; G/C vs. G/G: OR = 1.86, 95% CI: 1.25-2.77, p = 0.002). In a stratification analysis, C allele carriers and the C/C genotype showed a strong association with positive clinical pregnancy outcomes after IVF compared with G allele carriers and the G/G genotype in the recessive, dominant, and allelic genetic models in group I (C/C vs. G/G: OR = 1.84, 95% CI: 1.25-2.69, p = 0.01; C/C vs. G carrier: OR = 1.52, 95% CI: 1.12-2.07, p = 0.01; C carrier vs. G/G: OR = 1.46, 95% CI: 1.07-2.01, p = 0.02; C allele vs. G allele: OR = 1.34, 95% CI: 1.11-1.62, p = 0.003), no significant associations by stratification were observed for group II. No associations were found between MDM2 SNP309 and either of two groups.The TP53 codon 72 polymorphism is associated with FSH/LH ratios, suggesting that it is a potential predictive genetic marker of IVF outcome in patients younger than 35 years of age with baseline FSH levels below 10 IU/L and who have an FSH/LH ratio2.3.

The widespread application of next generation sequencing (NGS) in clinical settings has enabled testing, diagnosis, treatment and prevention of genetic diseases. However, many issues have arisen in the meanwhile. One of the most pressing issues is the lack of standards for reporting genetic test results across different service providers. The First Forum on Standards and Specifications for Clinical Genetic Testing was held to address the issue in Shenzhen, China, on October 28, 2017. Participants, including geneticists, clinicians, and representatives of genetic testing service providers, discussed problems of clinical genetic testing services across in China and shared opinions on principles, challenges, and standards for reporting clinical genetic test results. Here we summarize expert opinions presented at the seminar and report the consensus, which will serve as a basis for the development of standards and guidelines for reporting of clinical genetic testing results, in order to promote the standardization and regulation of genetic testing services in China.

Non-invasive prenatal screening using cell-free fetal DNA (NIPS) has been integrated into the prenatal health care only in a short span of five years, and the guidelines provided by professional bodies have been continuously updated. The American College of Medical Genetics and Genomics has made a statement on NIPS in July, 2016, suggesting that the NIPS can replace conventional screening for Patau, Edwards and Down syndromes in a continuum of gestational age and for any maternal age, except those who are significantly obese. The scope of target diseases of NIPS are also growing. Meanwhile, pre- and post-test counseling for NIPS has put forward a greater challenge for medical professionals.

To comprehensively evaluate the clinical value of Mean Corpuscular Volume (MCV) in screening Thalassaemia in Guangdong Province in China by Meta-analysis. We searched the databases of PubMed, Wanfang, CBM and CNKI to retrieve relevant studies on screening for Thalassaemia from 1980 to 2015. Totally 306 literatures were screened out by computer, according to inclusive and exclusive criteria, 16 documents were involved for analysis. Firstly, we use the Quality Assessment of Diagnostic Accuracy Study (QUADAS) to evaluate the qualities of the including studies. Then, we use the Meta-Disc 1.4 software to analyze the characteristics fourfold table information. Heterogeneity was not found for threshold effect but for non-threshold effect, so Meta-analysis was performed using the random effects models. The results are as follows: pooled sensitivity is 94% (95%CI: 94%-95%), pooled specificity is 71% (95%CI: 70%--73%), DOR is 60.18 (95%CI: 25.63-141.33) and the Area Under Curve(AUC) of the SROC is 0.9620. Lastly, we adopt the methods of subgroup analysis to investigate the source of the heterogeneity. The results of screening object subgroup are shown that the DOR of the check-ups group is higher than the couples of child-bearing and the pregnant. The results of subgroup of the Thalassaemia types are as follows: the DOR of -Thalassaemia is higher than the DOR of -Thalassaemia and the DOR of -Thalassaemia. Therefore, we draw a conclusion that using the MCV in screening Thalassaemia in Guangdong Province has some clinical value. Especially in check-ups group, the MCV in screening -Thalassaemia have higher detection rate.

To provide genetic analysis for a pregnant woman with chromosomal translocations and intellectual disability, and to provide prenatal diagnosis for her fetus.Routine G-banding was performed to analyze the karyotypes of the woman and her fetus. Copy number variants were determined with array comparative genomic hybridization (array-CGH).The pregnant woman has carried an apparently balanced translocation involving chromosomes 1, 2, 6 and 7, with a karyotype of 46, XX, t(1;2) (p22;p23), t(6;7) (q21;p15). The karyotype of her fetus was ascertained as 46, XY, t(6;7) (q21;p15) mat. Array-CGH has detected a 4 Mb microdeletion at 6q22.1-q22.31 (115 311 507-119 332 956) in both individuals. As the 6q22.1-q22.31 microdeletion may be associated with the main clinical manifestations of the woman, the family decided to terminate the pregnancy. The fetus was male and appeared to have no obvious abnormality.Prenatal diagnosis for pregnant women with translocations and mental retardation is a challenging task. Combined application of cytogenetic analysis and array-CGH may facilitate the diagnosis and genetic counseling.

Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies., Highlights • In 10,111 couples in prevention programs for thalassemia, 186 at-risk couples were identified by NGS and 151 by traditional routine method. • NGS assay had better performance than traditional routine screening approach in carrier screening for hemoglobinopathies. • NGS assay can characterize patients with Thalassemia Major or Thalassemia Intermedia more accurately. Hemoglobinopathies represent a major cause of birth defects in China. Traditional carrier screening strategy is phenotype-based that is associated with risk of miss phenotype-negative carriers. In this study, we validated an effective method for molecular screening and clinical genotyping of hemoglobinopathies using NGS assay. Considering the broad mutation spectrum and high prevalence of hemoglobinopathy-causing mutations across ethnic groups, this technology could make it technically feasible to offer more effective preconception screening and diagnosis in large populations worldwide. Therefore, the current phenotype-based screening guideline might be modified to a better genotype-based screening guideline.