Search

Background: To aid in the development of antimicrobial stewardship programs (ASPs), we analyzed the patterns and trends in antibiotic prescriptions for patients with severe acute respiratory infection (SARI), utilizing the WHO's AWaRe classification. Methods: We analyzed data from hospital-based influenza surveillance from January 2011 to December 2020 across nine Bangladeshi tertiary-level hospitals. Surveillance physicians collected WHO-defined SARI patient data, including demographics, clinical characteristics, and antibiotic prescriptions. Descriptive statistics and parametric and non-parametric tests were used for the analysis. Results: Of 21,566 SARI patients [median age 20 years (IQR: 1.33-45), 66% male], 91% were prescribed at least one antibiotic. A total of 25,133 antibiotics were prescribed, of which 47.0% were third-generation cephalosporins, 16.5% were macrolides, and 11.1% were beta-lactam/beta-lactamase inhibitors. According to the AWaRe classification, 28.7% were in the Access group, while 71.3% were in the Watch group, and none were from the Reserve group. A downward trend in Access group (30.4% to 25.1%; p = 0.010) and an upward trend in Watch group antibiotic prescription (69.6% to 74.9%; p = 0.010) were observed. We identified that patients aged < 5 years (aOR: 1.80; 95% CI: 1.44-2.25), who were treated in government hospitals (aOR: 1.45; 95% CI: 1.35-1.57), patients with the presence of lung diseases (aOR: 1.56; 95% CI: 1.35-1.80) had an increased likelihood of being prescribed Watch group antibiotics. Conclusions : This study reveals a concerning pattern of antibiotic overuse among SARI patients in Bangladesh, with a growing trend over the past decade towards increased Watch group antibiotic prescriptions. Only one-third of the prescribed antibiotics were from the Access group, falling short of the two-thirds threshold recommended by the WHO. Effective ASPs are crucial to optimize antibiotic prescriptions and mitigate the risk of antimicrobial resistance.

The global opioid poisoning crisis is a complex issue with far-reaching public health implications. Opioid Poisoning Education and Naloxone Distribution (OPEND) programs aim to reduce stigma and promote harm reduction strategies, enhancing participants' ability to apply life-saving interventions, including naloxone administration and cardiopulmonary resuscitation (CPR) to opioid poisoning. While virtual OPEND programs have shown promise in improving knowledge about opioid poisoning response, their implementation and evaluation have been limited. The COVID-19 pandemic has sparked renewed interest in virtual health services, including OPEND programs. Our study reviews the literature on fully virtual OPEND programs worldwide. We analyzed 7,722 articles, 30 of which met our inclusion criteria. We extracted and synthesized information about the interventions' type, content, duration, the scales used, and key findings. Our search shows a diversity of interventions being implemented, with different study designs, duration, outcomes, scales, and different time points for measurement, all of which hinder a meaningful analysis of interventions' effectiveness. Despite this, virtual OPEND programs appear effective in increasing knowledge, confidence, and preparedness to respond to opioid poisoning while improving stigma regarding people who use opioids. This effect appears to be true in a wide variety of populations but is significantly relevant when focused on laypersons. Despite increasing efforts, access remains an issue, with most interventions addressing White people in urban areas. Our findings offer valuable insights for the design, implementation, and evaluation of future virtual OPEND programs., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 dos Santos et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Chronic lymphocytic leukemia (CLL) clones contain subpopulations differing in time since the last cell division ("age"): recently born, proliferative (PF; CXCR4 Dim CD5 Bright ), intermediate (IF; CXCR4 Int CD5 Int ), and resting (RF; CXCR4 Bright CD5 Dim ) fractions. Herein, we used deuterium ( 2 H) incorporation into newly synthesized DNA in patients to refine the kinetics of CLL subpopulations by characterizing two additional CXCR4/CD5 fractions, i.e., double dim (DDF; CXCR4 Dim CD5 Dim ) and double bright (DBF; CXCR4 Bright CD5 Bright ); and intraclonal fractions differing in surface membrane (sm) IgM and IgD densities. Although DDF was enriched in recently divided cells and DBF in older cells, PF and RF remained the most enriched in youngest and oldest cells, respectively. Similarly, smIgM High and smIgD High cells were the youngest, and smIgM Low and smIgD Low were the oldest, when using smIG levels as discriminator. Surprisingly, the cells closest to the last stimulatory event bore high levels of smIG, and stimulating via TLR9 and smIG yielded a phenotype more consistent with the in vivo setting. Finally, older cells were less sensitive to in vivo inhibition by ibrutinib. Collectively, these data define additional intraclonal subpopulations with divergent ages and phenotypes and suggest that BCR engagement alone is not responsible for the smIG levels found in vivo, and the differential sensitivity of distinct fractions to ibrutinib might account, in part, for therapeutic relapse.

Echocardiography is the gold standard clinical tool for the evaluation of left ventricular diastolic dysfunction (LVDD) and is used to validate other cardiac imaging modalities in measuring diastolic dysfunction. We examined Cardiac Magnetic Resonance Imaging (CMR) in detecting diastolic dysfunction using the time-volume curve-derived parameters compared to echocardiographic diastolic parameters. We evaluated patients who underwent both CMR and transthoracic echocardiography (TTE) within 2 ± 1 weeks of each other. On echo, Doppler/Tissue Doppler Imaging (TDI) measurements were obtained. On CMR, peak filling rate (PFR), time to PFR (TPFR), 1/3 filling fraction (1/3FF), and 1/3 filling rate (1/3FR) were calculated from the time-volume curve. Using the commonly employed E/A ratio, 44.4% of patients were found to have LVDD. Using septal E/E' and lateral E/E', 29.6% and 48.1% of patients had LVDD, respectively. Correlation was found between left atrial (LA) size and E/A ratio (R = -0.36). Using LVDD criteria for CMR, 63% of patients had diastolic dysfunction. CMR predicted LVDD in 66.7% of the cases. CMR-derived diastolic filling parameters provided a relatively easy and promising method for the assessment of LVDD and can predict the presence of LVDD as assessed by traditional Doppler and TDI methods.

Pili torti or 'twisted hair' is characterized by flattened hair shaft twisted through 180 degree around their long axis at irregular intervals. It is inherited or acquired hair shaft disorder with increased fragility. It may be associated with numerous dermatological and systemic conditions or may be drug-induced. An isolated pili torti case is reported which is very rare and the related literature reviewed., Competing Interests: There are no conflicts of interest., (Copyright: © 2023 Indian Journal of Dermatology.)

First bite syndrome (FBS) has been previously characterised as a surgical complication, following head and neck surgical procedures. There are also rare reports in the literature associating FBS with malignancies of the head and neck. The term 'idiopathic parotid pain' (IPP) has been used recently to describe an exceedingly rare clinical presentation similar to FBS, but without history of head and neck surgery or malignancy. We present the rare case of a 65-year-old male diagnosed with IPP, our work-up and management., (Published by Oxford University Press and JSCR Publishing Ltd. © The Author(s) 2022.)

Background: Dorsal preservation rhinoplasty (PR-D) attempts to preserve as much of the native nasal anatomy as possible when performing a hump reduction, but clinical outcomes are unclear. Objective: In patients undergoing PR-D rhinoplasty, this article investigates the rates of complications and revisions. Methods: This meta-analysis was prospectively registered on the PROSPERO database. The Pubmed, Embase, and Scopus databases were searched. Pooled incidence was calculated in a meta-analysis within a random-effects model. Results: Twenty-two studies representing a cohort of 5660 patients were included in this study. Postoperative hump recurrence rates (4.18%, 95% confidence interval [CI]: 2.41-6.40%), rates of revision rhinoplasty (3.48%, 95% CI: 1.77-5.74%), rates of postoperative nasal deviation (1.13%, 95% CI 0.37-2.28%), and rates of infection (1.89%, 95% CI: 0.35-4.62%) were all found to be low. Conclusion: PR-D has low rates of revision surgery, residual or recurrent hump, postoperative nasal deviation, and postoperative infection.

RNAs have become a well-known target for chemotherapeutic agents in the recent years. The tails of most eukaryotic m-RNA are characterized by the presence of a long polyadenylate sequence which plays an important role in its growth and maturation. This lays emphasis on development of molecular probes that target the polyadenylate sequence. Cryptolepine (hereafter, CRP) is an indoloquinoline alkaloid well known for its anti-malarial activities. A series of spectroscopic experiments namely absorption studies, fluorimetric studies and circular dichroism studies show that cryptolepine binds with single-stranded polyriboadenylic acid (hereafter, ss-poly (rA)) with a binding constant of ∼5 × 10 3  M -1  at 25 °C. Moreover thermal denaturation experiments show that the bound form of polyriboadenylic acid shows a characteristic transition profile. Such a profile is indicative of the ability of cryptolepine to induce self-assembly in the polyriboadenylic acid sequence on binding to it. Such ability of CRP to modulate the structural conformation of poly (rA), which in turn may cause functional aspects of the RNA to change, may give us a chance to develop effective alkaloid based chemotherapeutic agents., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Background: Low pH induced nucleic acid polymorphism and the interaction of naturally occurring small molecules with different polymorphic forms of DNA have been the focus in developing new drugs. Recent studies have revealed that low pH plays an active role in growth and development of cancer cells. Our target is to find whether and how the indoloquinoline alkaloid cryptolepine (CRP) interact with different polymorphic forms of natural DNA, in hope to explore this group of alkaloids as new therapeutics., Methods: Multiple spectroscopic techniques that include UV-visible absorption spectrophotometry, fluorimetry, CD spectroscopy along with thermal melting studies were employed to characterize the interaction between the alkaloid cryptolepine with the B and protonated forms of DNA., Results & Conclusions: Cryptolepine has been found to interact with either forms of DNA. The nature of binding is non-cooperative in both cases. Data show that the affinity of CRP to B form of DNA is relatively higher than that for the protonated form of DNA. Circular dichroic studies reveal that the alkaloid converts the left handed protonated DNA into bound right handed form. Fluorescence quenching experiments reveal that cryptolepine intercalates within the DNA base pairs. Thermal melting studies show that the alkaloid stabilises the DNA structures., General Significance: Such non-B DNA structures are often present at the 'mutation hotspots' that are associated with genetic instability related diseases such as cancer. The ability of cryptolepine to interact to such non-B DNA structures makes it a useful substrate in the designing of potential chemotherapeutic agents., (Copyright © 2021 Elsevier B.V. All rights reserved.)

Single stranded polyriboadenylic acid [poly (rA)] has been accepted widely as a suitable drug target owing to its vital role in the development of cancer since it controls gene expression during cell growth and differentiation. The biological properties of poly (rA) depend on its structural morphology. Pharmacologically active flavonoids can act as suitable binders to poly (rA) and significantly change its biophysical properties. Different factors favour flavonoid-poly (rA) binding. In our present work we have explored the role played by the position of hydroxyl groups in the flavonoids namely 3, 5, 6 and 7 hydroxyflavones in their course of interaction with poly (rA). A range of spectroscopic experiments reveal that 3HF binds best to poly (rA) among the four chosen flavonoids. This is probably due to the presence of a hydroxyl group in '3' position that enables it to exhibit ESIPT phenomenon which is missing for the other used flavonoids., Competing Interests: Declaration of competing interest The authors declare that they have no conflict of interest., (Copyright © 2020 Elsevier B.V. All rights reserved.)

The use of bioactive flavonoids as drugs has long mesmerized the scientific world. Their small size and planar structure enables them to interact with limitless substrates especially biomolecules. Taxifolin is a flavonoid well known for its anti-oxidizing and metal chelating properties. Its interaction with a few biomolecules has been studied so far to exploit its pharmacological activities. Hemoglobin, an iron containing macromolecule acts as a major carrier protein and is also associated with the occurrence of many diseases. Our present study lays emphasis on the interaction of flavanonol taxifolin with bovine hemoglobin at physiological pH. This was achieved by monitoring the changes in the absorbance, fluorescence, anisotropic, lifetime and circular dichroic spectra. Benesi-Hildebrand plot determined a binding constant value of 20.0 × 10 3  M -1 at 25 °C. Stern-Volmer quenching studies reveal that the binding is associated with a static mode of quenching. The complexation is thermodynamically favored as indicated by the negative value of enthalpy and positive value of entropy changes seen from the van't Hoff plot. Theoretical DFT calculations were used to find out an optimized geometry and HOMO-LUMO energy gap for taxifolin. Molecular docking studies revealed the location of taxifolin inside the hemoglobin moiety., (Copyright © 2019 Elsevier B.V. All rights reserved.)

The association of a putative bioactive alkaloid nitidine (NIT) with blood protein bovine hemoglobin (BHb) was investigated by employing various biophysical and molecular docking techniques. NIT binding to BHb was first characterized by hypochromic effect on the Soret band absorption of BHb from spectrophotometric studies. Spectrofluorimetric titration and unchanged fluorescence lifetime of BHb confirmed ground state complexation followed by the static nature of the emission quenching mechanism of the protein induced by NIT. Substantial conformational changes in the protein structure were established from circular dichroism study. Conformational perturbation results a lowering in the α-helical organization of the tetrameric protein structure. Thermodynamics of the binding suggest that the binding is exothermic with a favourable small positive entropy change and negative enthalpy change making a sense of electrostatic interaction as the major acting force. Experimentally calculated free energy change for the NIT-BHb interaction was found to be -7.50 kcal mol -1 which is in well agreement to the theoretical docking energy value of -6.36 kcal mol -1 . AutoDock based molecular docking suggests the internal cavity of BHb as the preferred binding position of NIT. Overall this manuscript depicts consequences on the molecular interaction of NIT with BHb from structural and energetic standpoints providing a profound insight into protein-ligand association., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Chelerythrine (CHL) is a pharmacologically important molecule that appears in positively charged iminium and neutral alkanolamine form on varying the pH. Association of bovine hemoglobin (BHb) with iminium and alkanolamine forms of CHL is explored employing several spectroscopic and theoretical tools. Our results revealed that iminium form of CHL shows greater binding affinity than the neutral alkanolamine form, with nearly one binding site on the protein for both forms. Thermodynamic data showed that the iminium binding to BHb was characterized by negative enthalpy and positive entropy changes while the association of the alkanolamine CHL was accompanied with both positive enthalpy and entropy changes. Both forms of CHL have been found to quench the intrinsic fluorescence of BHb. From Förster's resonance energy transfer (FRET) studies, the binding distance between the energy acceptor (CHL) and donor (β-Trp 37 of BHb) was found to be optimum for fluorescence quenching to occur. The conformational transformation of BHb induced by CHL complexation showed greater unfolding of the protein architecture for the iminium interaction from CD spectroscopy. Molecular docking study revealed that both iminium and alkanolamine form of CHL reside near β-Trp 37 at the α 1 β 2 interface of BHb., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10 5  M -1 ], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10 5  M -1 , and that of BER was (0.98 ± 0.03) × 10 5  M -1 . Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Fisetin (FTN) and its metal chelates are critically important since this bioflavonoid possesses wide range of pharmacological properties. Usually, metal binding property enhances the pharmaceutical activity of FTN. Thus in this report, we investigated the complexation of FTN with biologically essential metal ion Cu 2+ and further examined the effect of such complexation on calf thymus DNA (CT DNA) binding in comparison with free FTN. We have characterized the complex formation of FTN with Cu 2+ using UV-visible, fluorimetric and FTIR studies. Within our experimental concentration range we found that, FTN forms a 2:1 complex with Cu 2+ in terms of FTN:Cu 2+ . Spectroscopic analysis revealed that both FTN and FTN 2 -Cu 2+ complex bind with CT DNA and the binding constant is higher for free FTN. Perturbation of circular dichroism spectrum of CT DNA was observed in presence of free FTN due to structural alteration in DNA double helix. Viscometric, thermal melting and fluorescence quenching study confirm that FTN intercalates in between the base pairs of CT DNA while its Cu (II) complex acts as a groove binder. Molecular docking study further confirms that FTN intercalates into AT rich region of CT DNA while its Cu (II) complex binds at the minor groove., (Copyright © 2018 Elsevier B.V. All rights reserved.)

Polymorphism of DNA plays a very important part of research relating to the drug-DNA interactions. Here main focus of our investigation is to monitor the interaction of the benzophenanthridine plant alkaloid, nitidine (NIT) with two different forms of DNA i.e. B-DNA and protonated form of DNA maintaining proper temperatures and buffer conditions. Binding interaction of NIT was ascertained from the UV-Visible spectroscopic and spectrofluorimetric titration experiments. Binding constants of the interactions of NIT with different polymorphic forms were calculated from UV-absorption study. The binding constants were 3.8 × 10 5  M -1 and 1.3 × 10 5  M -1 for B-DNA and protonated DNA respectively. Red shift in the absorption maxima of NIT on binding with DNA, comparatively greater relative quenching of fluorescence intensity of free NIT than bound NIT, perturbation in the CD spectrum of DNA in presence of NIT confirmed the mode of binding as intercalation. Moreover, spectropolarimetric experiment confirms that left handed protonated form of DNA gets partially converted to the canonical B form of DNA while binds with NIT. Besides the CD experiment, thermal melting experiment also showed that on binding with NIT stabilization of protonated DNA was increased to an appreciable extent., (Copyright © 2018 Elsevier B.V. All rights reserved.)

In this report, the interaction between a phenanthrene-pyrene-based fluorescent probe (PPI) and bovine serum albumin (BSA), a transport protein, has been explored by steady-state emission spectroscopy, fluorescence anisotropy, far-ultraviolet circular dichroism (CD), time-resolved spectral measurements, and molecular docking simulation study. The blue shift along with emission enhancement indicates the interaction between PPI and BSA. The binding of the probe causes quenching of BSA fluorescence through both static and dynamic quenching mechanisms, revealing a 1:1 interaction, as delineated from Benesi-Hildebrand plot, with a binding constant of ∼10 5 M -1 , which is in excellent agreement with the binding constant extracted from fluorescence anisotropy measurements. The thermodynamic parameters, Δ H °, Δ S °, and Δ G °, as determined from van't Hoff relationship indicate the predominance of van der Waals/extensive hydrogen-bonding interactions for the binding phenomenon. The molecular docking and site-selective binding studies reveal the predominant binding of PPI in subdomain IIA of BSA. From the fluorescence resonance energy transfer study, the average distance between tryptophan 213 of the BSA donor and the PPI acceptor is found to be 3.04 nm. CD study demonstrates the reduction of α-helical content of BSA protein on binding with PPI, clearly indicating the change of conformation of BSA., Competing Interests: The authors declare no competing financial interest.

Present study allows us a better understanding of the interaction of nitidine, a benzophenanthridine alkaloid with single stranded polyriboadenylic acid [ss-poly (rA)]. The interaction leads to self-structure induction in ss-poly (rA) under the experimental condition of pH 7.0. Interaction of nitidine with ss-poly (rA) was ascertained by monitoring the change in absorbance, fluorescence intensity and circular dichroism values. Binding mode of nitidine with ss-poly (rA) was observed to be intercalation as confirmed from the quenching and viscometric studies. The association was characterized by both negative enthalpy and entropy changes accompanying with a moderately high binding constant of 5.10×10 5 M -1 . Nitidine induced double helical organization in single stranded poly (rA) under the experimental pH., (Copyright © 2017 Elsevier B.V. All rights reserved.)

We have reported the interaction of two flavonoids namely quercetin (Q) and morin (M) with double stranded poly(A).poly(U) (herein after A.U) and triple stranded poly(U).poly(A)*poly(U) (herein after U.A*U, dot represents the Watson-Crick and asterisk represents Hoogsteen base pairing respectively) in this article. It has been observed that relative positions of hydroxyl groups on the B-ring of the flavonoids affect the stabilization of RNA. The double strand as well as the triple strand of RNA-polymers become more stabilized in presence of Q, however both the duplex and triplex remain unaffected in presence of M. The presence of catechol moiety on the B-ring of Q is supposed to be responsible for the stabilization. Moreover, after exploiting a series of biophysical experiments, it has been found that, triple helical RNA becomes more stabilized over its parent duplex in presence of Q. Fluorescence quenching, viscosity measurement and helix melting results establish the fact that Q binds with both forms of RNA through the mode of intercalation while M does not bind at all to either forms of RNA., (Copyright © 2017 Elsevier Inc. All rights reserved.)

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

Naturally occurring flavonoid luteolin (LTN) was found to interact with double stranded poly(A).poly(U) and triple stranded poly(U)·poly(A)*poly(U) with association constants of the order of 10 4 M -1 . The association was monitored by various spectroscopic and viscometric techniques. Non-cooperative binding was observed for the association of LTN with two different polymorphic forms of RNA. Intercalation mode of binding was confirmed by fluorescence quenching and viscometric experiments. Thermal melting profiles indicated greater stabilization of the Hoogsteen base paired third strand (∼16°C) compared to Watson-Crick double strand (∼5°C) of RNA by LTN. Since the interaction of naturally occurring small molecules with RNA is an active area of research, this study has led to great openings to explore LTN as RNA targeted therapeutic agent., (Copyright © 2017 Elsevier B.V. All rights reserved.)

A multispectroscopic exploration was employed to investigate the interaction between the metallo-enzyme alcohol dehydrogenase (ADH) from yeast with bioflavonoid quercetin (QTN). Here, we have characterized the complex formation between QTN and Zn 2+ in aqueous solution and then examined the effect of such complex formation on the enzymatic activity of a zinc(II)-dependent enzyme alcohol dehydrogenase from yeast. We have observed an inhibition of enzymatic activity of ADH in presence of QTN. Enzyme inhibition kinetic experiments revealed QTN as a non-competitive inhibitor of yeast ADH. Perturbation of Circular dichroic (CD) spectrum of ADH in presence of QTN is observed due to the structural changes of ADH on complexation with the above flavonoid. Our results indicate a conformational change of ADH due to removal of Zn 2+ present in the enzyme by QTN. This was further established by molecular modeling study which shows that the flavonoid binds to the Zn 2+ ion which maintains the tertiary structure of the metallo-enzyme. So, QTN abstracts only half of the Zn 2+ ions present in the enzyme i.e. one Zn 2+ ion per monomer. From the present study, the structural alteration and loss of enzymatic activity of ADH are attributed to the complex formation between QTN and Zn 2+ ., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Here we have reported a detail study on the interaction of the benzophenanthridine alkaloid chelerythrine (CHL) with double stranded polyriboadenylic acid [ds poly (rA)] by exploiting various spectroscopic techniques. The alkaloid shows high binding affinity (binding constant is 1.10×10 5 M -1 ) towards the double stranded RNA as revealed from Scatchard plot. The binding was confirmed by hypochromic effect in the UV-vis spectrum of CHL, increase in fluorescence intensity of CHL and perturbations of the circular dichroism (CD) spectrum of ds poly (rA). Later fluorescence quenching, cooperative CD melting transition, viscometric and molecular modeling studies establish the fact that the alkaloid binds to the ds poly (rA) by the mechanism of intercalation. Thermodynamic parameters obtained from the isothermal titration calorimetric (ITC) study show that the binding is favoured by negative enthalpy and small positive entropy changes. This report may be a model for intercalation of small molecule like CHL to the double stranded RNA., (Copyright © 2016 Elsevier B.V. All rights reserved.)

In this study we have reported the anionic surfactant (Sodium dodecyl sulfate, SDS) driven structural conversion of two benzophenanthridine plant alkaloids namely Chelerythrine (herein after CHL) and Sanguinarine (herein after SANG). Both the alkaloids exist in two forms: the charged iminium and the neutral alkanolamine form. The iminium form is stable at low pH (<6.5) and the alkanolamine form exists at higher pH (>10.1). The fluorescence intensity of the alkanolamine form is much stronger than the iminium form. The iminium form of both the alkaloids remains stable whereas the alkanolamine form gets converted to the iminium form in the SDS micelle environment. The iminium form possesses positive charge and it seems that electrostatic interaction between the positively charged iminium and negatively charged surfactant leads to the stabilization of the iminium form in the Stern layer of the anionic micelle. Whereas the conversion of the alkanolamine form into the iminium form takes place and that can be monitored in naked eye since the iminium form is orange in colour and the alkanolamine form has blue violet emission. Such a detail insight about the photophysical properties of the benzophenanthridine alkaloids would be a valuable addition in the field of alkaloid-surfactant interaction., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Triple helical nucleic acids or triplex are formed from the combination of three oligonucleotides. In the double stranded form the base pairs are joined through Watson-Crick base pairing while the third strand of the triplex is joined through Hoogsteen base pairing. The Hoogsteen base paired strands are less stable compare to the Watson-Crick strands. Thus stabilization of the Hoogsteen strand gains importance due to the implication of stable triplexes in various biological processes. For this reason here we have monitored the effect of phenosafranine, a phenazinium dye on the structure of poly(U).poly(A)*poly(U) triplex. Our data revealed that the dye has higher binding affinity to the RNA triplex (K'=3.7 × 10(5) M(-1)) compared to the parent duplex (K'=1.9 × 10(5) M(-1)) form. Through a series of spectroscopic and viscometric study we have found that the dye binds to triplex or duplex through the mechanism of intercalation and it stabilizes the Watson-Crick strand while the Hoogsteen strand remains unaffected., (Copyright © 2016 Elsevier B.V. All rights reserved.)

The interaction between a quaternary benzophenanthridine alkaloid chelerythrine (herein after, CHL) and bovine serum albumin (herein after, BSA) was probed by employing various spectroscopic tools and isothermal titration calorimetry (ITC). Fluorescence studies revealed that the binding affinity of the alkanolamine form of the CHL is higher compared to the iminium counterpart. This was further established by fluorescence polarization anisotropy measurement and ITC. Fluorescence quenching study along with time-resolved fluorescence measurements establish that both forms of CHL quenched the fluorescence intensity of BSA through the mechanism of static quenching. Site selective binding and molecular modeling studies revealed that the alkaloid binds predominantly in the BSA subdomain IIA by electrostatic and hydrophobic forces. From Forster resonance energy transfer (FRET) studies, the average distances between the protein donor and the alkaloid acceptor were found to be 2.71 and 2.30 nm between tryptophan (Trp) 212 (donor) and iminium and alkanolamine forms (acceptor), respectively. Circular dichroism (CD) study demonstrated that the α-helical organization of the protein is reduced due to binding with CHL along with an increase in the coiled structure. This is indicative of a small but definitive partial unfolding of the protein. Thermodynamic parameters obtained from ITC experiments revealed that the interaction is favored by negative enthalpy change and positive entropy change.

A comparative study on the interaction of a benzophenanthridine alkaloid chelerythrine (CHL) with RNA triplex poly(U).poly(A)*poly(U) (hereafter U.A*U, .(dot) and *(asterisk) represent Watson-Crick and Hoogsteen base pairing respectively) and its parent duplex poly(A).poly(U) (A.U) was carried out by using a combination of various spectroscopic, viscometric and calorimetric techniques. The interaction was characterized by hypochromic and bathochromic effects in the absorption spectrum, the increase of thermal melting temperature, enhancement in solution viscosity, and perturbation in the circular dichroic spectrum. The binding constant calculated by using spectrophotometric data was in the order of 10(5) for both forms of RNA, but it was greater for triplex RNA (30.2 × 10(5) M(-1)) than duplex RNA (3.6 × 10(5) M(-1)). Isothermal titration calorimetric data are in good agreement with the spectrophotometric data. The data indicated stronger binding of CHL to the triplex structure of RNA compared to the native duplex structure. Thermal melting studies indicated greater stabilization of the Hoogsteen base paired third strand of the RNA triplex compared to its Watson-Crick strands. The mode of binding of CHL to both U.A*U and A.U was intercalation as revealed from fluorescence quenching, viscosity measurements and sensitization of the fluorescence experiment. Thermodynamic data obtained from isothermal calorimetric measurements revealed that association was favoured by both a negative enthalpy change and a positive entropy change. Taken together, our results suggest that chelerythrine binds and stabilizes the RNA triplex more strongly than its respective parent duplex. The results presented here may be useful for formulating effective antigene strategies involving benzophenanthridine alkaloids and the RNA triplex.

Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M.