Search

Given recent data regarding fishing vessels switching off their Automatic Identification Systems (AIS) in the Western Indian Ocean, this article assesses the potential illegality of the practice by analysing national and international legislation. It shows that the enforcement of AIS laws is generally poor, and although these are becoming increasingly robust in some jurisdictions, the sanctions are not severe enough to act as deterrents. Furthermore, this article suggests that the insurance industry enables the practice of switching off AIS through weak due diligence practices. Insurers have a role to play in curbing such illegal behaviour, and it is not discretionary.

RNA modifications are involved in numerous biological processes and are present in all RNA classes. These modifications can be constitutive or modulated in response to adaptive processes. RNA modifications play multiple functions since they can impact RNA base-pairings, recognition by proteins, decoding, as well as RNA structure and stability. However, their roles in stress, environmental adaptation and during infections caused by pathogenic bacteria have just started to be appreciated. With the development of modern technologies in mass spectrometry and deep sequencing, recent examples of modifications regulating host-pathogen interactions have been demonstrated. They show how RNA modifications can regulate immune responses, antibiotic resistance, expression of virulence genes, and bacterial persistence. Here, we illustrate some of these findings, and highlight the strategies used to characterize RNA modifications, and their potential for new therapeutic applications.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent

Potato (

Tomatoes (

Economic growth and population expansion in Mauritius have driven unprecedented rates of development. Most notably, increased urbanization of flood-prone regions has exacerbated challenges around resilience and vulnerability to recurrent flooding. We implement a multi-criteria model consisting of a physical-oriented, a social-oriented and an economic-oriented scenario to identify highly vulnerable sites to flooding in the capital city, Port Louis. Social, technical, economic and legal perspectives are incorporated to propose comprehensive flood management strategies. The aim is to minimize the physical impacts of floods while also addressing the broader social and economic risks. Location-based flood management strategies are thereafter proposed to increase the resilience of the city to flooding. Measures include, inter alia, the construction of an underground stormwater storage tank at Champ de Mars, establishment of flood refugee camps at Vallee Pitot and Cite La Cure, reviewing building regulations and urban planning, replacement of the Caudan Underpass by an Overhead Bridge, green renaturing of rivers in downstream areas, construction of a retention pond on the downhill slope of the mountain at Bell Village, and the setting up of a diversion tunnel linking St Louis River to Grand River North West. The approach adopted will allow an understanding of the geography of flooding in Port Louis and support management decisions for limiting its impacts.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis ‘P1’, which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 μm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena, Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm o) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

There is a rising concern over the impact of aquaculture, particularly salmon farming, on the aquatic environment. Two Scottish parliamentary investigations have revealed concerns over the environmental impacts of the industry, particularly with regard to the potential hazard to wild salmonids. Many have pointed to regulatory complexity being a cause of the poor regulation. Representatives of the Crown Estate Scotland stated: ‘We have the right bits and pieces, but they have not been put together in the right order’. Yet it is the Crown which grants the leases of fish farms to their operators and therefore the Crown is where the ultimate responsibility for their impact sits. If changes to public controls are required, we must first fully understand the roles of the public agencies involved.

An island wide survey carried over 18 months across 79 tomato (Lycopersicum esculentum L.) plantations in 30 localities on 12 varieties revealed that symptoms related to phytoplasma-associated diseases are widespread in this species in Mauritius. Typical witches, broom and stunting and/or yellowing were observed in 74.6 % of fields visited. Phytoplasmas belonging to three groups: stolbur (16SrXII), aster yellows (16SrI) and elm yellows (16SrV) were identified in tomato leaf and fruit samples by nested-PCR assays followed by RFLP and/or sequencing analyses. Mixed phytoplasma and virus infections (PVY, TYLCV) were detected in 28.8 % of symptomatic sample tested. Survey results indicate a widespread distribution of all identified phytoplasmas across local tomato plantations (pathogens were detected in 8 out of 9 districts) irrespective of the variety grown. Use of insect-proof nets for seedling production, avoid re-planting a new tomato crop in the vicinity of phytoplasma infected ones and uprooting of symptomatic plants are the recommended measures to reduce the pathogen dissemination and resulted to be effective in reducing the pathogen presence in the Country.

The small multi-ethnic island state of Mauritius has made great strides and embraced the notion of equal opportunity for all, although this has not always been translated in practice. This article argues that, while the first wave of structural transformation contributed to economic growth and employment opportunities for citizens, development has not been equitable, especially with respect to Mauritians of African origin. The quest for a second wave of sustainable transformation may not be easy and the country needs to rethink its model of development and ensure that the latter is infused with ethical and human centred governance.