Search

Your search keyword '"Cai, Huimin"' showing total 269 results
Start Over Author "Cai, Huimin"
269 results on '"Cai, Huimin"'

11. Spatiotemporal transcriptomic profiling reveals the dynamic immunological landscape of alveolar echinococcosis

Author

Ou, Zhihua, primary, Li, Li, additional, Ren, Peidi, additional, Zhou, Ting-Ting, additional, He, Fan, additional, Chen, Jialing, additional, Cai, Huimin, additional, Han, Xiumin, additional, Wu, Yao-Dong, additional, Li, Jiandong, additional, Li, Xiu-Rong, additional, Tan, Qiming, additional, Li, Wenhui, additional, Chen, Qi, additional, Zhang, Nian-Zhang, additional, He, Xiuju, additional, Chen, Wei-Gang, additional, Zhao, Yanping, additional, Sun, Jiwen, additional, Zhang, Qian, additional, Wu, Yan-Tao, additional, Liang, Yingan, additional, You, Jie, additional, Hu, Guohai, additional, Tian, Xue-Qi, additional, Liao, Sha, additional, Fu, Bao-Quan, additional, Chen, Ao, additional, Cai, Xue-Peng, additional, Yang, Huanming, additional, Wang, Jian, additional, Jin, Xin, additional, Xu, Xun, additional, Jia, Wan-Zhong, additional, Li, Junhua, additional, and Yan, Hong-Bin, additional

Published
2024
Full Text
View/download PDF

14. Chromosome-scale Echinococcus granulosus (genotype G1) genome reveals the Eg95 gene family and conservation of the EG95-vaccine molecule

Author

Korhonen, Pasi K., Kinkar, Liina, Young, Neil D., Cai, Huimin, Lightowlers, Marshall W., Gauci, Charles, Jabbar, Abdul, Chang, Bill C. H., Wang, Tao, Hofmann, Andreas, Koehler, Anson V., Li, Junhua, Li, Jiandong, Wang, Daxi, Yin, Jiefang, Yang, Huanming, Jenkins, David J., Saarma, Urmas, Laurimäe, Teivi, Rostami-Nejad, Mohammad, Irshadullah, Malik, Mirhendi, Hossein, Sharbatkhori, Mitra, Ponce-Gordo, Francisco, Simsek, Sami, Casulli, Adriano, Zait, Houria, Atoyan, Hripsime, de la Rue, Mario Luiz, Romig, Thomas, Wassermann, Marion, Aghayan, Sargis A., Gevorgyan, Hasmik, Yang, Bicheng, and Gasser, Robin B.

Published
2022
Full Text
View/download PDF

21. A deep-learning pipeline for the diagnosis and discrimination of viral, non-viral and COVID-19 pneumonia from chest X-ray images

Author

Wang, Guangyu, Liu, Xiaohong, Shen, Jun, Wang, Chengdi, Li, Zhihuan, Ye, Linsen, Wu, Xingwang, Chen, Ting, Wang, Kai, Zhang, Xuan, Zhou, Zhongguo, Yang, Jian, Sang, Ye, Deng, Ruiyun, Liang, Wenhua, Yu, Tao, Gao, Ming, Wang, Jin, Yang, Zehong, Cai, Huimin, Lu, Guangming, Zhang, Lingyan, Yang, Lei, Xu, Wenqin, Wang, Winston, Olvera, Andrea, Ziyar, Ian, Zhang, Charlotte, Li, Oulan, Liao, Weihua, Liu, Jun, Chen, Wen, Chen, Wei, Shi, Jichan, Zheng, Lianghong, Zhang, Longjiang, Yan, Zhihan, Zou, Xiaoguang, Lin, Guiping, Cao, Guiqun, Lau, Laurance L., Mo, Long, Liang, Yong, Roberts, Michael, Sala, Evis, Schönlieb, Carola-Bibiane, Fok, Manson, Lau, Johnson Yiu-Nam, Xu, Tao, He, Jianxing, Zhang, Kang, Li, Weimin, and Lin, Tianxin

Published
2021
Full Text
View/download PDF

23. Lens regeneration using endogenous stem cells with gain of visual function

Author

Lin, Haotian, Ouyang, Hong, Zhu, Jie, Huang, Shan, Liu, Zhenzhen, Chen, Shuyi, Cao, Guiqun, Li, Gen, Signer, Robert AJ, Xu, Yanxin, Chung, Christopher, Zhang, Ying, Lin, Danni, Patel, Sherrina, Wu, Frances, Cai, Huimin, Hou, Jiayi, Wen, Cindy, Jafari, Maryam, Liu, Xialin, Luo, Lixia, Zhu, Jin, Qiu, Austin, Hou, Rui, Chen, Baoxin, Chen, Jiangna, Granet, David, Heichel, Christopher, Shang, Fu, Li, Xuri, Krawczyk, Michal, Skowronska-Krawczyk, Dorota, Wang, Yujuan, Shi, William, Chen, Daniel, Zhong, Zheng, Zhong, Sheng, Zhang, Liangfang, Chen, Shaochen, Morrison, Sean J, Maas, Richard L, Zhang, Kang, and Liu, Yizhi

Subjects
Medical Biotechnology, Biomedical and Clinical Sciences, Ophthalmology and Optometry, Aging, Stem Cell Research - Nonembryonic - Human, Stem Cell Research - Nonembryonic - Non-Human, Stem Cell Research, Eye Disease and Disorders of Vision, Regenerative Medicine, Eye, Animals, Cataract, Cataract Extraction, Epithelial Cells, Eye Proteins, Homeodomain Proteins, Homeostasis, Humans, Lens, Crystalline, Macaca, PAX6 Transcription Factor, Paired Box Transcription Factors, Polycomb Repressive Complex 1, Proto-Oncogene Proteins, Recovery of Function, Regeneration, Repressor Proteins, Stem Cells, Vision, Ocular, General Science & Technology
Abstract

The repair and regeneration of tissues using endogenous stem cells represents an ultimate goal in regenerative medicine. To our knowledge, human lens regeneration has not yet been demonstrated. Currently, the only treatment for cataracts, the leading cause of blindness worldwide, is to extract the cataractous lens and implant an artificial intraocular lens. However, this procedure poses notable risks of complications. Here we isolate lens epithelial stem/progenitor cells (LECs) in mammals and show that Pax6 and Bmi1 are required for LEC renewal. We design a surgical method of cataract removal that preserves endogenous LECs and achieves functional lens regeneration in rabbits and macaques, as well as in human infants with cataracts. Our method differs conceptually from current practice, as it preserves endogenous LECs and their natural environment maximally, and regenerates lenses with visual function. Our approach demonstrates a novel treatment strategy for cataracts and provides a new paradigm for tissue regeneration using endogenous stem cells.

Published
2016

25. Transcription Factor PAX6 (Paired Box 6) Controls Limbal Stem Cell Lineage in Development and Disease*

Author

Li, Gen, Xu, Fan, Zhu, Jie, Krawczyk, Michal, Zhang, Ying, Yuan, Jin, Patel, Sherrinal, Wang, Yujuan, Lin, Ying, Zhang, Ming, Cai, Huimin, Chen, Daniel, Zhang, Meixia, Cao, Guiqun, Yeh, Emily, Lin, Danni, Su, Qiao, Li, Wen-wen, Sen, George L, Afshari, Natalie, Chen, Shaochen, Maas, Richard L, Fu, Xiang-Dong, Zhang, Kang, Liu, Yizhi, and Ouyang, Hong

Subjects
Stem Cell Research, Stem Cell Research - Nonembryonic - Human, Genetics, Stem Cell Research - Nonembryonic - Non-Human, Eye Disease and Disorders of Vision, Aetiology, 2.1 Biological and endogenous factors, 5.2 Cellular and gene therapies, Development of treatments and therapeutic interventions, Underpinning research, 1.1 Normal biological development and functioning, Skin, Eye, Animals, Cell Lineage, Cornea, Eye Proteins, Gene Expression Profiling, Homeodomain Proteins, Humans, Limbic System, Membrane Proteins, Mice, PAX6 Transcription Factor, Paired Box Transcription Factors, Repressor Proteins, Signal Transduction, Stem Cells, cell differentiation, cornea, eye, stem cells, transcription factor, Chemical Sciences, Biological Sciences, Medical and Health Sciences, Biochemistry & Molecular Biology
Abstract

PAX6 is a master regulatory gene involved in neuronal cell fate specification. It also plays a critical role in early eye field and subsequent limbal stem cell (LSC) determination during eye development. Defects in Pax6 cause aniridia and LSC deficiency in humans and the Sey (Small eye) phenotype in mice (Massé, K., Bhamra, S., Eason, R., Dale, N., and Jones, E. A. (2007) Nature 449, 1058-1062). However, how PAX6 specifies LSC and corneal fates during eye development is not well understood. Here, we show that PAX6 is expressed in the primitive eye cup and later in corneal tissue progenitors in early embryonic development. In contrast, p63 expression commences after that of PAX6 in ocular adnexal and skin tissue progenitors and later in LSCs. Using an in vitro feeder-free culture system, we show that PAX6 knockdown in LSCs led to up-regulation of skin epidermis-specific keratins concomitant with differentiation to a skin fate. Using gene expression analysis, we identified the involvement of Notch, Wnt, and TGF-β signaling pathways in LSC fate determination. Thus, loss of PAX6 converts LSCs to epidermal stem cells, as demonstrated by a switch in the keratin gene expression profile and by the appearance of congenital dermoid tissue.

Published
2015

26. The value of gadolinium‐enhanced MRI in predicting the development of sudden hearing loss into Ménière's disease.

Author

Cai, Huimin, Xiao, Heng, Lin, Jianwei, Lin, Chenxin, Guo, Xiaojing, Huang, Gengliang, and Ye, Shengnan

Subjects
*MENIERE'S disease, *SENSORINEURAL hearing loss, *CHI-squared test, *MAGNETIC resonance imaging, *PATIENT experience
Abstract

Objective: To compare the clinical features of sudden hearing loss (SHL) in patients with and without endolymphatic hydrops (EH), and to investigate the association between SHL with EH and Ménière's disease (MD). Methods: The clinical data of 63 SHL patients with first symptoms were evaluated retrospectively. Patients were separated into two groups based on the results of gadolinium‐enhanced magnetic resonance imaging: EH and non‐EH groups. Independent sample t‐test and U‐test were used to compare groups for continuous variables, and the chi‐squared test, corrected chi‐squared test and Bonferroni correction test were used to compare groups for binary and ordinal variables. The binary logistic regression model was utilised for univariate and multivariate analysis of follow‐up patient prognosis. Results: The EH and non‐EH groups contained 32 and 31 patients, respectively. The EH group had a higher prevalence of low‐tone descending hearing loss. Fifty‐one patients were followed for more than 2 years. In the EH group, 11 and 15 patients were diagnosed with sudden sensorineural hearing loss (SSNHL) and MD, respectively, while in the non‐EH group, 24 patients were diagnosed with SSNHL and only one with MD. EH, low‐tone descending hearing loss and vertigo were risk factors for the diagnosis of MD in a subgroup univariate regression analysis of patients experiencing SHL. EH was found to be a risk factor for the progression of SHL into MD in a multifactor regression analysis. Conclusions: Patients with SHL who have EH are more likely to present with low‐tone descending hearing loss. EH is a risk factor for the subsequent development of MD. [ABSTRACT FROM AUTHOR]

Published
2024
Full Text
View/download PDF

29. Author Correction: A deep-learning pipeline for the diagnosis and discrimination of viral, non-viral and COVID-19 pneumonia from chest X-ray images

Author

Wang, Guangyu, Liu, Xiaohong, Shen, Jun, Wang, Chengdi, Li, Zhihuan, Ye, Linsen, Wu, Xingwang, Chen, Ting, Wang, Kai, Zhang, Xuan, Zhou, Zhongguo, Yang, Jian, Sang, Ye, Deng, Ruiyun, Liang, Wenhua, Yu, Tao, Gao, Ming, Wang, Jin, Yang, Zehong, Cai, Huimin, Lu, Guangming, Zhang, Lingyan, Yang, Lei, Xu, Wenqin, Wang, Winston, Olvera, Andrea, Ziyar, Ian, Zhang, Charlotte, Li, Oulan, Liao, Weihua, Liu, Jun, Chen, Wen, Chen, Wei, Shi, Jichan, Zheng, Lianghong, Zhang, Longjiang, Yan, Zhihan, Zou, Xiaoguang, Lin, Guiping, Cao, Guiqun, Lau, Laurance L., Mo, Long, Liang, Yong, Roberts, Michael, Sala, Evis, Schönlieb, Carola-Bibiane, Fok, Manson, Lau, Johnson Yiu-Nam, Xu, Tao, He, Jianxing, Zhang, Kang, Li, Weimin, and Lin, Tianxin

Published
2021
Full Text
View/download PDF

37. Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization

Author

Qin, Cheng, Yu, Changshui, Shen, Yaou, Fang, Xiaodong, Chen, Lang, Min, Jiumeng, Cheng, Jiaowen, Zhao, Shancen, Xu, Meng, Luo, Yong, Yang, Yulan, Wu, Zhiming, Mao, Likai, Wu, Haiyang, Ling-Hu, Changying, Zhou, Huangkai, Lin, Haijian, González-Morales, Sandra, Trejo-Saavedra, Diana L., Tian, Hao, Tang, Xin, Zhao, Maojun, Huang, Zhiyong, Zhou, Anwei, Yao, Xiaoming, Cui, Junjie, Li, Wenqi, Chen, Zhe, Feng, Yongqiang, Niu, Yongchao, Bi, Shimin, Yang, Xiuwei, Li, Weipeng, Cai, Huimin, Luo, Xirong, Montes-Hernández, Salvador, Leyva-González, Marco A., Xiong, Zhiqiang, He, Xiujing, Bai, Lijun, Tan, Shu, Tang, Xiangqun, Liu, Dan, Liu, Jinwen, Zhang, Shangxing, Chen, Maoshan, Zhang, Lu, Zhang, Li, Zhang, Yinchao, Liao, Weiqin, Zhang, Yan, Wang, Min, Lv, Xiaodan, Wen, Bo, Liu, Hongjun, Luan, Hemi, Zhang, Yonggang, Yang, Shuang, Wang, Xiaodian, Xu, Jiaohui, Li, Xueqin, Li, Shuaicheng, Wang, Junyi, Palloix, Alain, Bosland, Paul W., Li, Yingrui, Krogh, Anders, Rivera-Bustamante, Rafael F., Herrera-Estrella, Luis, Yin, Ye, Yu, Jiping, Hu, Kailin, and Zhang, Zhiming

Published
2014

38. Treatment of retinitis pigmentosa due to MERTK mutations by ocular subretinal injection of adeno-associated virus gene vector: results of a phase I trial

Author

Ghazi, Nicola G., Abboud, Emad B., Nowilaty, Sawsan R., Alkuraya, Hisham, Alhommadi, Abdulrahman, Cai, Huimin, Hou, Rui, Deng, Wen-Tao, Boye, Sanford L., Almaghamsi, Abdulrahman, Al Saikhan, Fahad, Al-Dhibi, Hassan, Birch, David, Chung, Christopher, Colak, Dilek, LaVail, Matthew M., Vollrath, Douglas, Erger, Kirsten, Wang, Wenqiu, Conlon, Thomas, Zhang, Kang, Hauswirth, William, and Alkuraya, Fowzan S.

Published
2016
Full Text
View/download PDF

40. Additional file 1 of A circular RNA blood panel that differentiates Alzheimer’s disease from other dementia types

Author

Ren, Ziye, Chu, Changbiao, Pang, Yana, Cai, Huimin, and Jia, Longfei

Abstract

Additional file 1: Fig. 1. The experimental flow chart. Abbreviations: AD, Alzheimer’s disease; ROC, receiver operating characteristic; AUC, area under the curve; VaD, vascular dementia; PDD, Parkinson disease dementia; bvFTD, behavioral variant frontotemporal dementia; DLB, dementia with Lewy body. Fig. 2. Volcano plot of altered circRNAs in the pilot study (P

Published
2022
Full Text
View/download PDF

41. Corrigendum: Lens regeneration using endogenous stem cells with gain of visual function

Author

Lin, Haotian, Ouyang, Hong, Zhu, Jie, Huang, Shan, Liu, Zhenzhen, Chen, Shuyi, Cao, Guiqun, Li, Gen, Signer, Robert A. J., Xu, Yanxin, Chung, Christopher, Zhang, Ying, Lin, Danni, Patel, Sherrina, Wu, Frances, Cai, Huimin, Hou, Jiayi, Wen, Cindy, Jafari, Maryam, Liu, Xialin, Luo, Lixia, Zhu, Jin, Qiu, Austin, Hou, Rui, Chen, Baoxin, Chen, Jiangna, Granet, David, Heichel, Christopher, Shang, Fu, Li, Xuri, Krawczyk, Michal, Skowronska-Krawczyk, Dorota, Wang, Yujuan, Shi, William, Chen, Daniel, Zhong, Zheng, Zhong, Sheng, Zhang, Liangfang, Chen, Shaochen, Morrison, Sean J., Maas, Richard L., Zhang, Kang, and Liu, Yizhi

Published
2017
Full Text
View/download PDF

50. Wnt7A and PAX6 define corneal epithelium homeostasis and pathogenesis

Author

Ouyang, Hong, Xue, Yuanchao, Lin, Ying, Zhang, Xiaohui, Xi, Lei, Patel, Sherrina, Cai, Huimin, Luo, Jing, Zhang, Meixia, Zhang, Ming, Yang, Yang, Li, Gen, Li, Hairi, Jiang, Wei, Yeh, Emily, Lin, Jonathan, Pei, Michelle, Zhu, Jin, Cao, Guiqun, Zhang, Liangfang, Yu, Benjamin, Chen, Shaochen, Fu, Xiang-Dong, Liu, Yizhi, and Zhang, Kang

Subjects
Epithelium -- Growth -- Genetic aspects, Cornea -- Growth -- Genetic aspects, Homeostasis -- Genetic aspects, Cell differentiation -- Genetic aspects, Company growth, Environmental issues, Science and technology, Zoology and wildlife conservation
Abstract

The surface of the cornea consists of a unique type of non-keratinized epithelial cells arranged in an orderly fashion, and this is essential for vision by maintaining transparency for light transmission. Cornea epithelial cells (CECs) undergo continuous renewal from limbal stem or progenitor cells (LSCs) (1,2), and deficiency in LSCs or corneal epithelium--which turns cornea into a non-transparent, keratinized skin-like epithelium--causes corneal surface disease that leads to blindness in millions of people worldwide (3). How LSCs are maintained and differentiated into corneal epithelium in healthy individuals and which key molecular events are defective in patients have been largely unknown. Here we report establishment of an in vitro feeder-cell-free LSC expansion and three-dimensional corneal differentiation protocol in which we found that the transcription factors p63 (tumour protein 63) and PAX6 (paired box protein PAX6) act together to specify LSCs, and WNT7A controls corneal epithelium differentiation through PAX6. Loss of WNT7A or PAX6 induces LSCs into skin-like epithelium, a critical defect tightly linked to common human corneal diseases. Notably, transduction of PAX6 in skin epithelial stem cells is sufficient to convert them to LSC-like cells, and upon transplantation onto eyes in a rabbit corneal injury model, these reprogrammed cells are able to replenish CECs and repair damaged corneal surface. These findings suggest a central role of the WNT7A-PAX6 axis in corneal epithelial cell fate determination, and point to a new strategy for treating corneal surface diseases. GGATGCTGCCAAACTTGTTCTC, Corneal and skin epithelium share many similarities, including a typical morphology of stratified epithelium and maintenance of their stem cells by p63 in the keratin 5/keratin [14.sup.+] (K5/K14)-expressing basal cell [...]

Published
2014

Catalog

Books, media, physical & digital resources
See catalog results