Search

4022 Background: Sequential treatment with nab-paclitaxel, gemcitabine followed by oxaliplatin, leucovorin and 5-fluorouracil ( nab-P/Gem-mFOLFOX) have shown a good safety profile and clinical activity in metastatic pancreatic ductal adenocarcinoma (mPDAC) in a previously published phase I SEQUENCE trial. Methods: We have compared nab-P/Gem-mFOLFOX to the standard nab-P/Gem in first-line treatment, in an open-label multi-institutional prospective randomised phase II trial in patients with untreated mPDAC from 14 Spanish hospitals. Patients were allocated 1:1 to nab-paclitaxel (125 mg/m2) plus gemcitabine (1000 mg/m2) on days 1, 8 and 15, followed by modified FOLFOX-6 (oxaliplatin [85 mg/m2], L-leucovorin [200 mg/m2] or racemic leucovorin [400 mg/m2], 5-fluorouracil bolus [400 mg/m2], and 5-fluorouracil 48-hour continuous infusion [2400 mg/m2]) on day 29 of a 6-week cycle or nab-paclitaxel (125 mg/m2) plus gemcitabine (1000 mg/m2) on days 1, 8 and 15 of a 4-week cycle. The primary endpoint was the 12-month overall survival rate (OS) in randomised patients. EudraCT number 2014-005350-19; ClinicalTrial.gov identifier NCT02504333. Results: Between July 27, 2017, and April 16, 2019, 182 patients were screened and 157 randomised: 78 to nab-P/Gem-mFOLFOX and 79 to nab-P/Gem. Patients receiving nab-P/Gem-mFOLFOX showed a significantly higher 12-month, and 24-month OS (95% CI): 55.3% (44.2-66.5%) versus 35.4% (24.9-46.0%) (p = 0.016), and 22.4% (13.0-31.8%) versus 7.6% (1.8-13.4%) (p = 0.012), respectively. The median OS (95% CI) reached 13.2 (10.1-16.2) months with nab-P/Gem-mFOLFOX and 9.7 (7.5-12.0) months with nab-P/Gem (HR = 0.676, 95% CI 0.483-0.947, p = 0.023). 39.7% patients in the nab-P/Gem-mFOLFOX group and 54.4% in nab-P/Gem group received subsequent anticancer treatments. Safety was comparable except for grade ≥3 neutropenia (46.1% versus 24.1%, p = 0.004) and grade ≥3 thrombocytopenia (23.7% versus 7.6%, p = 0.007) that were higher in the nab-P/Gem-mFOLFOX regimen. Two (2.6%) patients died due to adverse events in the nab-P/Gem-mFOLFOX arm. Conclusions: Nab-P/Gem-mFOLFOX showed significantly higher clinical activity than the standard nab-P/Gem treatment, with a manageable safety profile. This regimen represents a feasible and efficient new option for first-line treatment of mPDAC. Clinical trial information: NCT02504333.

Summary Context Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. Objective The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. Results A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Conclusions Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

PurposeType I pseudohypoparathyroidism (PHP-I) can be subclassified into Ia and Ib, depending on the presence or absence of Albright's hereditary osteodystrophy's phenotype, diminished α-subunit of the stimulatory G protein (Gsα) activity and multihormonal resistance. Whereas PHP-Ia is mainly associated with heterozygous inactivating mutations in Gsα-coding exons ofGNAS, PHP-Ib is caused by imprinting defects ofGNAS. To date, just one patient with PHP and complete paternal uniparental disomy (UPD) has been described.We sought to identify the underlining molecular defect in twenty patients with parathyroid hormone resistance, hypocalcemia and hyperphosphatemia, and abnormal methylation pattern at GNAS locus.MethodsMicrosatellite typing and comparative genome hybridization were performed for proband and parents.ResultsWe describe four patients with partial paternal UPD of chromosome 20 involving pat20qUPD in one case, from 20q13.13-qter in two cases, and pat20p heterodisomy plus interstitial 20q isodisomy in one patient.ConclusionsThese observations demonstrate that mitotic recombination of chromosome 20 can also give rise to UPD and PHP, a situation similar to other imprinting disorders, such as Beckwith–Wiedemann syndrome or neonatal diabetes.

The study was partially funded by the “Accion Transversal del Cancer”, approved on the Spanish Ministry Council on the 11th October 2007, by the Instituto de Salud Carlos III-FEDER (PI08/1770, PI08/0533, PI08/1359, PS09/00773, PS09/01286,PS09/01903, PS09/02078, PS09/01662, PI11/01403, PI11/01889,PI11/00226, PI11/01810, PI11/02213, PI12/00488, PI12/00265,PI12/01270, PI12/00715, PI12/00150), Castaño-Vinyals, G., Aragonés, N., Pérez-Gómez, B., Martín, V., Llorca, J., Moreno, V., Altzibar, J.M., Ardanaz, E., de Sanjosé, S., Jiménez-Moleón, J.J., Tardón, A., Alguacil, J., Peiró, R., Marcos-Gragera, R., Navarro, C., Pollán, M., Kogevinas, M., Alonso, M.T., Amiano, P., Arias, C., Azpiri, M., Benavente, Y., Boldo, E., Bueno, A., Bustamante, M., Caballero, F.J., Campo, E., Cantón, R., Capelo, R., Carmona, C., Casabonne, D., Chirlaque, M.D., Cirac, J., Clofent, J., Colado, E., Costas, L., Crous, M., Del Campo, R., Santos, M.D., Dierssen-Sotos, T., Ederra, M., Espinosa, A., Cabrera, M.F., Somoano, A.F., Villa, T.F., García-Esquinas, E.G., Martín, P.G., Gómez-Acebo, I., Puga, C.G., Gràcia, E., Eslava, M.G., Guinó, E., Huerta, J.M., Lope, V., López-Abente, G., Lopez-Otín, C., Argüelles, B.M., Salas, S.M., Pozo, B.M., de la Torre, A.J., Moreno, E., Iribas, C.M., Olea, N., Gelis, G.O., Paré, L., Porta, M., Puig, M., Del Fresno, M.R., Robles, C., Suarez, M.M., Romero, B., Castillo, A.I., Serra, M.S., Trejo, D.S., Santaballa, A., Santibáñez, M., Sierra, Á., Souto, A., Villanueva, C.M., Carrasco, E., Sabaté, Y., Persavento, C., García, M., Carrasco, G., Expósito, A., Andreu, M., Bessa, X., Piracés, M., Lorente, J.A., Tusquets, I., Collet, I., Bory, F., Pera, M., Abella, E., Garcia, F., Salar, A., Piñol, M., Fernandez-Llamazares, J., Martín, M.V., Garsot, E., Servio, L.I., Arzoz-Fabregas, M., Suarez, L., Ruiz, J.M., Castells, A., Serradesanferm, A., Bosch, A., Muñoz, M., Fontanillas, M., Alcaraz, A., Mengual, L., Duran, E., Izard, C., López, C., Benítez, J.M., Massanes, A.B., Ferrer, O.G., Almeda, J., Sarret, S., Rodriguez, M.A., Valmaseda, A.B., Liceran, M., Petitbó, D., Nolla, J.I., Pérez, S., Martínez, S., Vilaseca, J.M., Sebastián, L., Quesada, P., Sequera, G., Barca, E.G., Domingo-Domenech, E., Oliveira, A., Alonso, E., de la Banda, E., Sabater, Y., Vergara, M., Exposito, A., Alonso, T., Padrol, I., Klaustermeier, J., Florencia, Y., Camon, V., Esteban, A., Aymerich, M., Lopez-Otin, C., Muñoz, A., Torralba, Y., Dot, D., Mercadal, S., Sarra, J., Medina, P., Atienza, C., Biondo, S., de Oca, J., Ferran, L., Rodriguez-Moranta, F., Soriano, A., Guardiola, J., Urruticoechea, A., Galan, M., Banda, J.M., Zumel, Á., Saez, A., Garrido, J.A., Lacasaña, M., Ariza, J.L., García, T., García, M.Á., Hidalgo, M.Á., Asuero, M., Bayo, J., Vázquez, V.C., Franco, F., Gurucelain, J.L., Frías, M.J., Van de Haar, R., Viñas, J., Jiménez, H., Aguayo, M., Pereira, A., Gutiérrez, S.P., Rada, R., Candón, J., Domínguez, J., Ramos, M., Pedraza, G., Braulio, J., Salas, J., Labrero, D., Muñoz, D., Barrero, F., Delgado, S., Galisteo, L., Camacho, A., Elena, H., Caballero, J., Muñoz, M.J., Arredondo, F., Linares, R., Tejada, A., Tinto, H., Alés, J.D., Coronado, M.V., Bernal, M.L., Ortiz, J.L., Ocaña, M.N., Cavanillas, A.B., Miguel, Mejías, E.J., Abril, O.M., Requena, R.O., Morata, J.L., Echezarreta, E.G., López, L.M., Martínez, M.M., Sedano, P.P., de la Pedraja Pavón, A., López-Rojo, C., Mendiola, J., Pellicer, E., Caparrós, J.M., Oltra, E.G., Martínez, J.M., Molina, A., Villanueva, V., Miranda, M.J., Abril, C., Martinez, J., Salas, D., Ruiz, J.L., Ponce, M., Noos, P., Cervera, J., Del Val, A., Segura, A., Jiménez, N., Bellmunt, E., Aznar, I., Ramos, D., Montón, T., Solera, M.C., Mora, E.M., Estañ, N., Camarasa, N., Solanas, J.V., Ripoll, J., Cantero, J., Díaz, C.A., García, A.S., Avellón, S.M., Neumann, M., González, M.J., Suárez, M.M., Fernández, G., Fresno, M.R., Gómez, A., Garín, U., de Gros, A., Tamayo, E., Rua, M., Lasarte, C.S., Jauregi, M., Recio, J., Fernández, M., Múgica, M., Ciria, J.P., Guimón, E., Adúriz, C., Lacasta, A., Francisco, J.S., Alvarez, I., Enriquez-Navascués, J.M., Ruiz, I., Michelena, M., Alberro, J.A., Almansa, A.M., Goñi, L.M., Elizagaray, M.I., Técnico, M.O., Pérez, R.B., De Miguel Medina, M.C., Repáraz Romero, M., de Azúa Ciria, A.Y., Díaz, M.M., Lizárraga, M.S., Jiménez, Y.L., López, C.E., Legaz, S.O., Lezaun, R.A., Hurtado, H.O., De Miguel Velasco, M., Rubio, P.A., Cunchillos, F.D., de Liaño Arguelles, Á.D., Peñuela, J.M., Dorronsoro, M.L., Celaya, F.B., García, D.R., de la Higuera Carnicer, B.G., Tricas, J.M., Rivera, E.M., García, F.V., Noain, J.J., Erdozain, E.A., Ulibarrena, C.I., Lopeandía, J.G., Caden, M.A., Moraza, F.A., Domench, J.J., Arteaga, A.A., Navarro, K.A., Del Burgo Tajadura, M.A., Irastorza, F.C., Urrisarri, M.J., Zubicoa, B.F., Lorente, P.G., Sevilla, P.H., Echamendi, M.L., Díaz, Á.M., Salaverri, J.M., Gorricho, F.J., Del Valle, M.P., de Prado Marcilla, J., Garcésducar, M., Herce, P.A., Barasoain, J.E., Campos, I.A., Vergara, E.A., Beraza, B.C., Blasco, L.F., Díaz, L.G., Larrañeta, J.G., Ruiz, N.G., García, J.G., Orduna, M.S., Larena, D.I., Fernández, M.P., de Ciriza Pejenaute, F.J., Escuin, R., Puertas, I.R., Samper, I.A., Sesma, M.E., López, M.J., Apestegui, C.Z., Linares, C., Cervantes, M., Ferreras, E., García-Pérez, J., Fernández-Navarro, P., Pastor, R., Ramis, R., González, Á., Ruiz, T., Muñoz, V., Delgado, R., Lanza, M., Marín, M., Posada, M., Cosmen, J., Villanueva, A., Castaño, A., Jiménez, J.A., Rin, A., Díaz, G., Herreros, M., Pedraza, V., López, P., de la Fuente, M., de Castro, M.F., Sobrino, J., Calvo, R., Carrascal, I., Bernal, R., Mateo, A., García-Olmo, D., Zarazaga, A., Gombau, M.Á., Díaz, J., Gómez, T., Sánchez, T., de la Quintana, P., Ordás, J., Cuevas, P., Sánchez-Pastor, M., de la Peña, J.J., Tabernero, Á., Cámara, N., Hardisson, D., Suárez, A., Burgos, E., Alves, J., Miguel, M., Feliú, J., Belda, C., Zamora, P., Sánchez, A., Hernández, A., Beato, T., Arroba, A., Ballesteros, A., Canora, S., García, C., Romero, M., José, T.S., Espinel, M., Mañas, A., Sánchez, M., Ramón, H., Morillo, J.L., Cuchí, M., García, M.J., Ramos, J.M., Rojo, R., Sanjuanbenito, A., Villanueva, A.G., Gras, M., Cabañas, J.L., Collado, V., Arano, I., Capela, I., Mojarrieta, C., Peñas, B., Rodríguez, M., Ramos, A., Sancho, S., Hervás, A., Moreno, P., Sánchez, C., DoloresRubio, Montoya, L., Sancho, P., Rodríguez, L., Durán, E., Morel, S., Burgos, J., García, R., Del Cañizo, C.G., Díaz, A., González, F., Cristóbal, E., Barahona, C., Vázquez, S., Esteban, V., Pedrera, M., Martínez, J., Carrato, A., Ponce, C.G., Santos-Olmo, A., Barrientos, R.R., López, G., Fernández, A., García, A.B., Noriega, A., Campo, M., Varona, E., López, F., Montero, M., Gómez, M.T., Bartibas, P., Sanz, R., Montes, T., Salinero, M.Á., Herrero, M., Igea, M., Calvo, C., Pérez-Pellón, C., Maestre, M., Agora, M.A., Martín, M.G., Velázquez, D., Fernández, B., Castro, M., Ayuso, E., Masa, R., Antelo, C., García, S., Herrero, S., Delgado, A., Vilardell, L., Puig-Vives, M., Osca-Gelis, G., Buxo, M., Izquierdo, A., Carmona-Garcia, M.C., Romanos, R.R., Galindo, C.T., Bargalló, P.M., Sanchez, E.R., Saez, M., Roncero, J.M., Gallardo, D., Coll, R., Blanco, I., Ruano, L.M., Castaño, E.A., Rusiñol, J.M., Perez, R.J., Pujol, I.M., Tuero, G.C., de Barrio Lera, J.P., Carral, J.M., Pérez, C.A., Puente, M.E., Balbuena, S.P., Presa, J.M., Ramírez, J.A., Martínez, A.Á., de Francisco, T.G., Elosua, T.G., Teso, E.P., Fueyo, J.F., Guadarrama, O.A., Turienzo Frade Mdel, A., De la Hoz Riesco, M., Fernández, J.J., Fernández, V.S., Fernández, R.C., Santamaría, M.V., Simón, J.A., Ganso, A.M., Pacho, A.V., Alegre, S.V., Plaza, F.J., Cuenllas, B.Á., Franco, E.H., Martín, M.H., Ariño, M.T., Tascón, C.D., Palomo, J.A., Castañón López Mdel, C., Lorenzo, M.P., González, I.A., Rivero, F.G., Román, C.H., Fernández, E.Á., Bayón, T.R., Fernández, A.G., Municio, F., de Celis, M.G., Ingelmo, L.Á., Herrero, J.G., Carbajo, M.J., Esteras, T.R., Baz, B.V., Baticón, C.H., Baza, E.Á., Urdiales, A.U., Gil, J.I., López, M.A., Ule, E.C., Diez, C.B., Marín, A.I., Bernabeu, M.Á., de Abajo Olea, S., Rojo, C.V., Fernández, M.Á., González, F.G., Martínez, L.G., Del Huertotrancón Moratiel, M., Ramos, N.C., Fidalgo, S.P., Coque, P.R., González, Á.G., Díez, A.B.

Background The oral multikinase inhibitor regorafenib improves overall survival (OS) in patients with metastatic colorectal cancer (CRC) for which all standard treatments have failed. This study investigated regorafenib plus modified FOLFOX (mFOLFOX6) as first-line treatment of metastatic CRC. Methods In this single-arm, open-label, multicentre, phase II study, patients received mFOLFOX6 on days 1 and 15, and regorafenib 160 mg orally once daily on days 4-10 and 18-24 of each 28-day cycle. The primary end-point was centrally assessed objective response rate (ORR). Secondary end-points included disease control rate (DCR), OS, progression-free survival (PFS) and safety. Results Median overall treatment duration with any study drug was 9.9 months (range 0.6-19.6); median treatment duration with regorafenib was 7.7 months (range 0.1-19.5); six patients remained on regorafenib for more than 1 year. Fifty-three patients received at least one dose of regorafenib. ORR was 43.9% (all partial responses); DCR was 85.4%; median OS was not reached; median PFS was 8.5 months. Treatment-emergent adverse events were experienced by all patients but were manageable with dose modifications. Conclusion Regorafenib + mFOLFOX6 as first-line treatment in patients with metastatic CRC did not improve ORR over historical controls. Regorafenib plus mFOLFOX6 did not appear to be associated with a markedly worse tolerability profile versus mFOLFOX6 alone. ClinicalTrials.gov identifier: NCT01289821.

Introduction Familial history of melanoma is a well-known risk factor for the disease, and 7% melanoma patients were reported to have a family history of melanoma. Data relating to the frequency and clinical and pathological characteristics of both familial and non-familial melanoma in Spain have been published, but these only include patients from specific areas of Spain and do not represent the data for the whole of Spain. Patients and methods An observational study conducted by the Spanish Group of Melanoma (GEM) analyzed the family history of patients diagnosed with melanoma between 2011 and 2013 in the dermatology and oncology departments. Results In all, 1047 patients were analyzed, and 69 (6.6%) fulfilled criteria for classical familial melanoma (two or more first-degree relatives diagnosed with melanoma). Taking into account other risk factors for familial melanoma, such as multiple melanoma, pancreatic cancer in the family or second-degree relatives with melanoma, the number of patients fulfilling the criteria increased to 165 (15.8%). Using a univariate analysis, we determined that a Breslow index of less than 1 mm, negative mitosis, multiple melanoma, and a history of sunburns in childhood were more frequent in familial melanoma patients, but a multivariate analysis revealed no differences in any pathological or clinical factor between the two groups. Conclusions Similar to that observed in other countries, familial melanoma accounts for 6.6% of melanoma diagnoses in Spain. Although no differences in the multivariate analysis were found, some better prognosis factors, such as Breslow index, seem more frequent in familial melanoma, which reflect a better early detection marker and/or a different biological behavior.