Search

# Background There are several curricula developed to train providers in low-resource settings on how to care for critically ill and injured children, however few incorporate the unique needs, insights, and challenges faced by the providers. Using a mixed methods approach, we conducted a needs assessment to determine the most important learning issues, attitudes, and beliefs of emergency department (ED) providers at Muhimbili National Hospital (MNH) about the development of a novel pediatric emergency medicine (PEM) curriculum for their setting. # Methods A retrospective, observational, analysis of a database of pediatric (

# Background International non-governmental organizations (NGOs) have widespread experience building health-related programs; however, few studies have examined local stakeholder perceptions of their collaboration and sustainability. # Objective To describe attitudes and beliefs of five stakeholder groups concerning the building of a healthcare facility in rural Uganda by an international NGO, with the goal of developing a potential framework. # Methods A qualitative study was conducted using focus groups, semi-structured interviews, and open-ended questionnaires. The five participating stakeholder groups included: community members, community leaders, healthcare workers, NGO leaders, and representatives from the Ugandan Ministry of Health. # Results All 40 participants reported interest in working together and four principal themes were identified: crucial building blocks of a healthcare facility; expectations regarding collaborative relationships; key deliverables desired by the community; and specific obstacles to sustainability. # Conclusions Participating stakeholders believe that the most important components of sustainable healthcare facilities are the establishment of two-way partnerships within the community and an emphasis on deliverables such as education, higher standards of care, and maintainable infrastructure. Unique obstacles must also be recognized. We propose a conceptual framework that may be applied to future public health interventions in resource-limited, international settings.

Abstract Background The assessment and treatment of pediatric patients in the out-of-hospital environment often presents unique difficulties and stress for EMS practitioners. Objective Use a mixed-methods approach to assess the current experience of EMS practitioners caring for critically ill and injured children, and the potential role of a simulation-based curriculum to improve pediatric prehospital skills. Methods Data were obtained from three sources in a single, urban EMS system: a retrospective review of local pediatric EMS encounters over one year; survey data of EMS practitioners’ comfort with pediatric skills using a 7-point Likert scale; and qualitative data from focus groups with EMS practitioners assessing their experiences with pediatric patients and their preferred training modalities. Results 2.1% of pediatric prehospital encounters were considered “critical,” the highest acuity level. A total of 136 of approximately 858 prehospital providers responded to the quantitative survey; 34.4% of all respondents either somewhat disagree (16.4%), disagree (10.2%), or strongly disagree (7.8%) with the statement: “I feel comfortable taking care of a critically ill pediatric patient.” Forty-seven providers participated in focus groups that resulted in twelve major themes under three domains. Specific themes included challenges in medication dosing, communication, and airway management. Participants expressed a desire for more repetition and reinforcement of these skills, and they were receptive to the use of high-fidelity simulation as a training modality. Conclusions Critically ill pediatric prehospital encounters are rare. Over one third of EMS practitioners expressed a low comfort level in managing critically ill children. High-fidelity simulation may be an effective means to improve the comfort and skills of prehospital providers.

Introduction: The World Health Organization recently recognized the importance of emergency and trauma care in reducing morbidity and mortality. Training programs are essential to improving emergency care in low-resource settings; however, a paucity of comprehensive curricula focusing specifically on pediatric emergency medicine (PEM) currently exists. The African Federation for Emergency Medicine (AFEM) developed a PEM curriculum that was pilot-tested in a non-randomized, controlled study to evaluate its effectiveness in nurses working in a public Tanzanian referral hospital. Methods: Fifteen nurses were recruited to participate in a two-and-a-half-day curriculum of lectures, skill sessions, and simulation scenarios covering nine topics; they were matched with controls. Both groups completed pre- and post-training assessments of their knowledge (multiple-choice test), self-efficacy (Likert surveys), and behavior. Changes in behavior were assessed using a binary checklist of critical actions during observations of live pediatric resuscitations. Results: Participant-rated pre-training self-efficacy and knowledge test scores were similar in both control and intervention groups. However, post-training, self-efficacy ratings in the intervention group increased by a median of 11.5 points (interquartile range [IQR]: 6–16) while unchanged in the control group. Knowledge test scores also increased by a median of three points (IQR: 0–4) in the nurses who received the training while the control group’s results did not differ in the two periods. A total of 1192 pediatric resuscitation cases were observed post-training, with the intervention group demonstrating higher rates of performance of three of 27 critical actions. Conclusion: This pilot study of the AFEM PEM curriculum for nurses has shown it to be an effective tool in knowledge acquisition and improved self-efficacy of pediatric emergencies. Further evaluation will be needed to assess whether it is currently effective in changing nurse behavior and patient outcomes or whether curricular modifications are needed.

Post-transplant cyclophosphamide (PTCy) is a promising graft-versus-host disease (GvHD) prophylaxis in haploidentical and matched unrelated donor hematopoietic stem cell transplantation (HSCT), but its role in matched sibling donor (MSD) transplants remains unclear.We conducted a retrospective study of 413 MSD-HSCT patients receiving peripheral blood stem cell (PBSC) grafts from January 2010 to January 2023. Patients were categorized into four groups: Group I (CNI + MTX or MMF), Group II (CNI + MTX or MMF + ATG), Group III (PTCy + ATG + CNI), and Group IV (PTCy + CNI + MMF). PTCy was associated with a significant reduction in grade II-IV [HR 0.6, p=0.01] and grade III-IV acute GvHD [HR 0.2, p=0.001] as well as all grade chronic GvHD [HR 0.5, p=0.007] and moderate-severe chronic GvHD [HR 0.4, p=0.001] compared to CNI+MTX (or MMF) containing regimens. PTCy did not increase relapse risk; PTCy reduced NRM [HR 0.3, p<0.002], leading to improved GvHD-free/relapse-free survival (GRFS) [HR 0.4, p<0.001]. PTCy was also associated with improved overall survival [HR 0.56, p=0.01]. Bloodstream infections are increased with PTCy [HR: 1.5, p=0.001]. The addition of ATG to PTCy did not further improve the GRFS and was associated with a higher incidence of clinically significant Cytomegalovirus (CMV) [HR 2.16, p=0.002] and Epstein-Barr virus reactivation (EBV) [HR 9.5, p<0.001] and a numerical increase in NRM [HR 1.7, p=0.2]. PTCy significantly appeared to improve GRFS in the MSD setting using PBSC grafts. The addition of ATG to PTCy increases csCMV and csEBV reactivation without further improving GRFS. Prospective trials and PTCy dose optimization are warranted., (Copyright © 2024 American Society of Hematology.)

Watermelon ( Citrullus lanatus ) and melon ( Cucumis melo ) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies ( Bemisia tabaci ) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus ( Opuntia auberi ) from Sonora, Mexico, and from one cactus ( O. cochenillifera ), lamb's ears ( Stachys byzantine ), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Cytomegalovirus (CMV) reactivation post-allogeneic hematopoietic cell transplantation (post-alloHCT) increases morbidity and mortality. We sought to determine the frequency of CMV seroconversion in patients pre-alloHCT and to investigate the impact on posttransplant outcomes. We retrospectively investigated 752 adult patients who underwent alloHCT at our center from January 2015 to February 2020 before the adoption of letermovir prophylaxis. CMV serology was assessed at consult and pretransplant. The cohort was divided into four groups based on pretransplant CMV seroconversion: negative to positive (Group 1), positive to negative (Group 2), consistently negative (Group 3), and consistently positive (Group 4). Eighty-nine patients (12%) had seroconverted from negative to positive, 17 (2%) from positive to negative, 151 (20%) were consistently seronegative, and 495 (66%) were consistently seropositive pretransplant. For the four CMV serostatus groups, cumulative incidence of CMV reactivation at 6 months posttransplant was 4.5%, 47.1%, 6.6%, and 76.6% for Groups 1, 2, 3, and 4, respectively (p < .0001). No differences between groups were seen regarding Grade III-IV acute graft-versus-host disease (GVHD) (p = .91), moderate/severe chronic GVHD (p = .41), or graft failure (p = .28). On multivariable analysis, there was no impact of CMV serostatus group on overall survival (p = .67), cumulative incidence of relapse (p = .83) or non-relapse mortality. alloHCT patients who demonstrate CMV seroconversion pretransplant from negative to positive have a very low risk of CMV reactivation posttransplant. The observed seroconversion may be due to passive CMV immunity acquired through blood products. Quantitative CMV immunoglobulin G/immunoglobulin M pretransplant may help differentiate between true seroconversion and passively transmitted CMV immunoglobulin., (© 2024 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Treosulfan has shown promise in allogeneic hematopoietic cell transplantation (HCT) for its myeloablative properties and low toxicity. In this single-center retrospective propensity score-matched cohort study we compared treosulfan- and busulfan-based conditioning in allogeneic HCT for patients with myelodysplastic syndrome (MDS). This study included 138 adults who underwent allogeneic HCT for MDS or chronic myelomonocytic leukemia at Princess Margaret Hospital, Toronto, from 2015 to 2022. Using propensity score matching, we compared transplant outcomes between 2 well-matched cohorts who received conditioning with either fludarabine-treosulfan (FT) (n = 46) or fludarabine-busulfan with total body irradiation (FBT200) (n = 92). A scoring system based on patient age, Karnofsky performance score, and hematopoietic cell transplant comorbidity index was used to assign patients based on fitness to low-dose (30 g/m 2 ) or high-dose (42 g/m 2 ) treosulfan: 32 (69.6%) received high-dose treosulfan. The racial composition of the 2 groups was similar, with 27.2% and 21.7% of FBT200 and FT recipients, respectively, identifying as non-Caucasian (P = .61). Primary outcomes were analyzed at a median follow-up of 747 days. Of all participants, 116 (84.0%) received graft-versus-host disease (GVHD) prophylaxis with post-transplant cyclophosphamide (PTCY) and antithymocyte globulin (ATG). Patients who received FT had a superior 2-year overall survival (OS) compared to those who received FBT200: 66.9% (95% confidence interval (CI): 46.1 to 81.2) versus 44.5% (95% CI: 34 to 54.4), hazard ratio (HR): 0.43, 95% CI: 0.22 to 0.84 (P = .013). In multivariate analysis (MVA), only the use of fresh grafts (P = .02) and FT (P = .01) were associated with improved OS. FT was associated with superior 2-year relapse-free survival (RFS) compared to FBT200: 63.1% (95% CI: 42.6 to 77.9) versus 39.1% (95% CI: 29.1 to 49.1), HR: 0.44 (95% CI: 0.24 to 0.81), P = .008. In MVA, the use of fresh grafts (P = .03) and FT (P = .009) were associated with improved RFS. Recipients of FT demonstrated superior 2-year graft-versus-host disease relapse-free survival (GRFS) compared to those who received FBT200: 57.4% (95% CI: 37.8 to 72.8) versus 35.1% (95% CI: 25.5 to 45). In MVA, only FT was associated with superior GRFS (P = .02). FT recipients exhibited markedly superior 1-year event-free survival compared to recipients of FBT200 in univariate analysis (40.3% (95% CI: 25.9 to 54.2) versus 9.2% (95% CI: 4.4 to 16.3), HR: 0.47 (95% CI: 0.30 to 0.72), P < .001) and MVA (P = .004). FT was associated with lower 1-year nonrelapse mortality compared to FBT200 in univariate analysis (9.9% (95% CI: 3.0 to 21.8) versus 29.7% (95% CI: 20.6 to 39.3), HR: 0.41 (95% CI: 0.17 to 0.96), P = .04) and MVA (P = .04). Our study utilized propensity score matching to demonstrate superiority of treosulfan- over busulfan-based conditioning in stem cell transplantation of patients with MDS and is the first to evaluate the performance of treosulfan-based conditioning in combination with ATG and PTCY. As such, it contributes to the increasing body of evidence supporting the safety of treosulfan, even at the dose of 42 g/m 2 ., (Copyright © 2024 The American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc. All rights reserved.)

In 2015, dual T cell depletion with antithymocyte globulin (ATG) and post-transplantation cyclophosphamide (PTCy) combined with cyclosporine A (CsA) replaced our prior institutional graft-versus-host disease (GVHD) prophylaxis regimen of 4.5 mg/kg ATG, CsA, and mycophenolate mofetil (MMF) (ATG-based) in 10/10 HLA-matched unrelated donor (MUD) peripheral blood allogeneic hematopoietic stem cell transplantation (allo-HCT). The initial ATG dose of 4.5 mg/kg [ATG(4.5)/PTCy] was reduced to 2 mg/kg [ATG(2)/PTCy] in 2018. This study compares the results obtained from 444 adults undergoing MUD allo-HCT at our institution who received ATG(4.5)/PTCy (n = 127) or ATG(2)/PTCy (n = 223) with those who received ATG-based prophylaxis without PTCy (n = 84). The rates of grade II-IV and grade III-IV acute GVHD (aGVHD) at day +100 and moderate/severe chronic GVHD (cGVHD) at 1 year were 35.7%, 21.6%, and 14.7%, respectively, in patients receiving ATG-based prophylaxis without PTCy; 16.5%, 4.9%, and 4.3% in patients receiving ATG(4.5)/PTCy; and 23.3% (P = .004), 8.0% (P < .001), and 14.1% (P =.006) in patients receiving ATG(2)/PTCy. One-year overall survival (OS), nonrelapse mortality (NRM), and GVHD-free relapse-free survival (GRFS) were 69.8%, 25.3%, and 52.0%, respectively, for patients receiving ATG-based prophylaxis without PTCy; 82.7%, 17.3%, and 59.8% for patients receiving ATG(4.5)/PTCy; and 78.3% (P = .446), 14.7% (P = 101), and 56.2% (P = .448) for patients receiving ATG(2)/PTCy. On univariate analyses, the use of ATG(2)/PTCy was associated with a lower risk of NRM (hazard ratio, .54; P = .023) compared with the use of ATG-based prophylaxis without PTCy. ATG(2)/PTCy prophylaxis effectively prevents GVHD and is associated with comparable relapse risk, OS, and GRFS as seen with ATG(4.5)/PTCy and ATG-based prophylaxis without PTCy., (Copyright © 2024 The American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc. All rights reserved.)

Background: Blinatumomab, a bispecific monoclonal antibody, effectively controls refractory B cell acute lymphoblastic leukemia (ALL) and promotes measurable residual disease (MRD) negativity. This study investigated the impact of pretransplant blinatumomab on allogeneic hematopoietic cell transplantation (HCT) outcomes in B cell ALL patients., Methods: We analyzed the effect of pretransplant blinatumomab on transplant outcomes of 117 adults undergoing allogeneic HCT for B cell ALL at Princess Margaret Hospital, Toronto, between 2010 and 2021. Outcomes assessed included overall survival (OS), graft-versus-host disease and relapse-free survival (GRFS), cumulative incidences of relapse (CIR), and nonrelapse mortality (NRM)., Results: The median follow-up was 36 months. Thirty-one participants (26.5%) received blinatumomab. Blinatumomab group had higher proportions of individuals with high disease risk index, primary induction failure and was more likely to receive dual T cell depletion with antithymocyte globulin and post-transplant cyclophosphamide. Two-year OS, GRFS, NRM, and CIR in the blinatumomab and nonblinatumomab groups were, respectively: 65.4% versus 45.6% (P = .05), 42.2% versus 17.3% (P = .01), 3.2% versus 43.0% (P = .007) and 34.4% versus 14.4% (P = .02). Blinatumomab was associated with a lower incidence of day-100 grade 2 to 4 and grade 3 to 4 acute graft-versus-host disease (aGVHD): 27.5% versus 56.7% (P = .009), and 10.9% versus 34.7% (P = .04), respectively. Multivariate analysis confirmed the association between pretransplant blinatumomab and improved OS and NRM., Conclusions: Pretransplant blinatumomab is associated with improved OS and lower risk of NRM in B cell ALL patients undergoing allogeneic HCT, likely reflecting lower burden of treatment-related toxicity in this population. Larger prospective trials are warranted to validate our findings., (Copyright © 2024 The American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc. All rights reserved.)

The HCT Frailty Scale is an easy prognostic tool composed of (a) Clinical Frailty Scale; (b) Instrumental Activities of Daily Living; (c) Timed-up-and-Go test; (d) Grip Strength; (e) Self-Health Rated Questionnaire; (f) Falls tests; (g) Albumin and C-reactive protein levels. This scale was designed to classify allogeneic hematopoietic cell transplant (alloHCT) candidates into fit, pre-frail and frail groups, irrespective of age. This study evaluates the ability of this frailty classification to predict overall survival (OS) and non-relapse mortality (NRM) in adult patients of all ages, in a prospective sample of 298 patients transplanted between 2018 and 2020. At first consultation, 103 (34.6%) patients were fit, 148 (49.7%) pre-frail, and 47 (15.8%) were frail. The 2-year OS and NRM of the three groups were 82.9%, 67.4%, and 48.3% (P < 0.001), and 5.4%, 19.2%, and 37.7% (P < 0.001). For patients younger than 60 years (n = 174), the 2-year OS and NRM of fit, pre-frail, and frail groups were 88.4%, 69.3% and 53.1% (P = 0.002), and 5.8%, 22.8%, and 34.8% (P = 0.005), respectively; and in patients older than 60 (n = 124), OS and NRM were 75.5%, 63.8% and 41.4% (P = 0.006), and 4.9%, 16.4%, and 42.1% (P = 0.001). In conclusion, frailty predicted worse transplant outcomes in both younger and older adults., (© 2023. The Author(s), under exclusive licence to Springer Nature Limited.)

Background: Reducing child mortality in low-income countries is constrained by a lack of vital statistics. In the absence of such data, verbal autopsies provide an acceptable method to determining attributable causes of death. The objective was to assess potential causes of pediatric postdischarge mortality in children younger than age 5 years (under-5) originally admitted for suspected sepsis using verbal autopsies., Methods: Secondary analysis of verbal autopsy data from children admitted to 6 hospitals across Uganda from July 2017 to March 2020. Structured verbal autopsy interviews were conducted for all deaths within 6 months after discharge. Two physicians independently classified a primary cause of death, up to 4 alternative causes, and up to 5 contributing conditions using the Start-Up Mortality List, with discordance resolved by consensus., Results: Verbal autopsies were completed for 361 (98.6%) of the 366 (5.9%) children who died among 6191 discharges (median admission age: 5.4 months [interquartile range, 1.8-16.7]; median time to mortality: 28 days [interquartile range, 9-74]). Most deaths (62.3%) occurred in the community. Leading primary causes of death, assigned in 356 (98.6%) of cases, were pneumonia (26.2%), sepsis (22.1%), malaria (8.5%), and diarrhea (7.9%). Common contributors to death were malnutrition (50.5%) and anemia (25.7%). Reviewers were less confident in their causes of death for neonates than older children (P < .05)., Conclusions: Postdischarge mortality frequently occurred in the community in children admitted for suspected sepsis in Uganda. Analyses of the probable causes for these deaths using verbal autopsies suggest potential areas for interventions, focused on early detection of infections, as well as prevention and treatment of underlying contributors such as malnutrition and anemia., (Copyright © 2023 by the American Academy of Pediatrics.)

The choice between an older matched sibling donor (MSD) and a younger matched unrelated donor (MUD) in allogeneic hematopoietic cell transplantation (HCT) remains a subject of ongoing debate. In this single-center retrospective study of 377 patients who received peripheral blood stem cell (PBSC) transplants for acute myeloid leukemia (AML) or myelodysplastic syndrome (MDS), we compared outcomes of 85 patients who received grafts from MSDs age >60 years and 292 patients who received grafts from MUDs age <30 years. Compared to recipients of MSD transplants, recipients of MUD transplants were younger and more likely to receive dual T cell depletion (TCD), a higher CD34 + cell dose, and a fresh graft. Recipients of MSD transplants were maintained on immunosuppressive therapy longer than those who received MUD grafts. We found no differences in overall survival, relapse-free survival, graft-versus-host disease (GVHD)-free and relapse-free survival, nonrelapse mortality, relapse, engraftment, graft failure, and acute GVHD between recipients of MSD grafts and recipients of MUD grafts. We report a higher 30-day incidence, but not 1-year incidence, of bloodstream infections among recipients of MUD transplants compared to subjects who received their grafts from a MSD. The incidence of moderate-severe chronic GVHD was higher in MSD graft recipients compared with MUD graft recipients in univariate analysis, but not in multivariate analysis. Although this difference could reflect the greater use of dual TCD, known to be associated with very low rates of chronic GVHD in MUD transplant recipients, the incidence of moderate-severe chronic GVHD was no different between MSD and MUD transplant recipients following propensity score matching, suggesting that other variables could be responsible. Taken together, our data suggest that in patients with AML or MDS who receive PBSC transplants, such factors as convenience, ease of access, and costs should be considered when selecting an older MSD over a younger MUD., (Copyright © 2023 The American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc. All rights reserved.)

Purpose: Allogeneic stem cell transplant (allo-HSCT) patients are at risk of malnutrition and weight loss from impaired oral intake resulting from gastrointestinal toxicities, dysgeusia, and psychological effects., Methods: A retrospective review of 264 adult patients transplanted at Princess Margaret Cancer Centre who achieved relapse-free survival up to 3 months after allo-HSCT was performed., Results: Overall incidence of patients who experienced WL (WL) ≥ 10% from HSCT to 3-month post-transplant was 45.9% and from HSCT to 6 months was 56.6%. Patients with ≥ 10% WL from allo-HSCT at 3 months and 6 months had similar 2-year overall survival (OS) compared to those with < 10% WL, 55.7% vs 62.8% (HR = 1.38, p = 0.11) and 71.1% vs 77.2% (HR = 1.37, p = 0.27), respectively. Patients with ≥ 10% WL 3 and 6 months from allo-HSCT also had similar 2-year relapse-free survival (RFS) compared to those with < 10% WL, 48.1% vs 55.8% (HR = 1.26, p = 0.22), and 62.7% vs 69.8% (HR = 1.29, p = 0.31), respectively. The 2-year transplant-related mortality (TRM) was higher for those with ≥ 10% WL from allo-HSCT to 3 months, 35.4% vs 16.9% (HR = 2.39, p = 0.0007) and 6 months, 22% vs 8% (HR = 3.1, p = 0.0034). Although statistical significance was not observed for OS or RFS, patients who experienced ≥ 10% WL 3- and 6-months post allo-HSCT experienced higher 2-year TRM. These results highlight the importance of early intervention and close monitoring of weight post allo-HSCT., Conclusion: Approaches to WL post allo-HSCT should be multifaceted and include members of the interdisciplinary team in order to decrease TRM., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

This pilot examines a self-distancing augmentation to exposure. Nine youth with anxiety (ages 11-17; 67% female) completed treatment. The study employed a brief (eight session) crossover ABA/BAB design. Exposure difficulty, engagement with exposure, and treatment acceptability were examined as primary outcome variables. Visual inspection of plots indicated that youth completed more difficult exposures during augmented exposure sessions [EXSD] than classic exposure sessions [EX] by therapist- and youth-report and that therapists reported higher youth engagement during EXSD than EX sessions. There were no significant differences between EXSD and EX on exposure difficulty or engagement by therapist- or youth-report. Treatment acceptability was high, although some youth reported that self-distancing was "awkward". Self-distancing may be associated with increased exposure engagement and willingness to complete more difficult exposures, which has been linked to treatment outcomes. Future research is needed to further demonstrate this link, and link self-distancing to outcomes directly., (© 2023. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Background: Doxorubicin (Doxo) is a widely prescribed drug against many malignant cancers. Unfortunately, its utility is limited by its toxicity, in particular a progressive induction of congestive heart failure. Doxo acts primarily as a mitochondrial toxin, with consequent increased production of reactive oxygen species (ROS) and attendant oxidative stress, which drives cardiac dysfunction and cell death. A diet containing a special mixture of all essential amino acids (EAAs) has been shown to increase mitochondriogenesis, and reduce oxidative stress both in skeletal muscle and heart. So, we hypothesized that such a diet could play a favorable role in preventing Doxo-induced cardiomyocyte damage., Methods: Using transmission electron microscopy, we evaluated cells' morphology and mitochondria parameters in adult mice. In addition, by immunohistochemistry, we evaluated the expression of pro-survival marker Klotho, as well as markers of necroptosis (RIP1/3), inflammation (TNFα, IL1, NFkB), and defense against oxidative stress (SOD1, glutathione peroxidase, citrate synthase)., Results: Diets with excess essential amino acids (EAAs) increased the expression of Klotho and enhanced anti-oxidative and anti-inflammatory responses, thereby promoting cell survival., Conclusion: Our results further extend the current knowledge about the cardioprotective role of EAAs and provide a novel theoretical basis for their preemptive administration to cancer patients undergoing chemotherapy to alleviate the development and severity of Doxo-induced cardiomyopathy.

Background: Allogeneic hematopoietic stem cell transplantation (allo-HCT) is currently the only curative treatment for patients with chronic lymphocytic leukemia (CLL)., Methods: We analyzed the outcomes of 93 patients (median age: 52 years) who underwent allo-HCT at our center between 1989 and 2019., Results: After a median follow-up of 35 months, relapse was observed in 15.1% (n = 14) patients. The estimated 2-year non-relapse mortality, relapse-free survival, and overall survival (OS) were 38.1%, 54.2%, and 58.7%, respectively. The ECOG performance status ≥ 2 (hazard ratio [HR]: 4.1; p = .001) and use of total body irradiation (in a myeloablative conditioning regimen; HR: 2.64; p = .005) were predictive of poor OS after multivariable analysis. The occurrence of sinusoidal obstruction syndrome/veno-occlusive disease post-transplant was associated with poor survival (p = .001)., Conclusion: Although the use of kinase and bcl2 inhibitors may result in a decrease in the number and need of transplants, allo-HCT remains a viable option in selected patients with high-risk CLL and good performance status.

The outcomes of allogeneic hematopoietic cell transplantation (HCT) in older patients are not well defined. We retrospectively analyzed the outcomes of 332 patients, with the median age of 65 years (range, 60-76), between 2014 and 2019. We categorized them to 3 age groups (G): G1, 60-65 years (n = 175); G2, > 65-70 years (n = 127); and G3, > 70 years (n = 30). The median length of hospitalization during the initial HCT period was 30 days, with a significant difference when stratified by age (p = 0.049). Overall, 183 (58.7%) patients were re-hospitalized within the first 6 months post HCT, and 60 (21.6%) in the second 6-month period. The 2-year OS was 56% in G1, 53% in G2, and 34% in G3 (p = 0.05). The 2-year event-free survival (EFS) was 54% for G1, 49% for G2, and 31% for G3 (p = 0.04). Non-relapse mortality (NRM) at 2 years was 25% in G1, 36% in G2, and 52% in G3 (p = 0.008). In multivariable analysis, patients aged 60-65 years had significantly better EFS (p = 0.04) and had a trend toward lower NRM (p = 0.05) than those aged > 70 years. Re-admission in the first 6 months post HCT had a significant impact on OS, EFS, and NRM. HCT-specific comorbidity index > 3 had significantly affected NRM. Finally, age had a significant influence on length of hospitalization during HCT. In conclusion, patients aged > 70 years have an inferior EFS and higher NRM. This likely related to higher rate of re-admissions due to infectious complications (84%)., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

This prospective study designs an HCT Frailty Scale to classify alloHCT candidates into groups of frail, pre-frail, and fit, and to be implemented in the first consultation at no additional cost. The present scale is composed of the following eight variables: Clinical Frailty Scale, Instrumental Activities of Daily Living, Timed Up and Go Test, Grip Strength, Self-Health Rated, Falls, Albumin, and C-Reactive Protein. The Frailty score of a patient is the weighted sum of scores for each item, with weights assigned according to the hazard ratios of a multivariable Cox proportional hazards model estimated and validated with data on OS as the dependent variable, and the scores of the eight variables as explanatory ones, from 298 adults split into training (n = 200) and validation (n = 98) sets. For clinical use, the scale scores were transformed into three categories: scale score ≤1: fit; 15.5 frail. The estimated probabilities of 1-year OS in each group of frailty, were, respectively: 83.7%, 48.5%, and 16.5% (p < 0.001). In the validation cohort, the respective values were 90.3%, 69.5%, and 46.2% (p < 0.001). Pending further external validations, the HCT Frailty Scale is a low cost-highly informative prognostic signal of outcomes at the pre-transplant stage., (© 2022. The Author(s), under exclusive licence to Springer Nature Limited.)

Background: It is unknown how body fat distribution modulates the cardiometabolic risk of testicular cancer survivors after cisplatin-based chemotherapy., Methods: For 455 patients enrolled in the Platinum Study at Memorial Sloan Kettering Cancer Center, visceral (VAT) and subcutaneous (SAT) adipose tissue was quantified on prechemotherapy computed tomography. The VAT-to-SAT ratio was calculated as a quantitative measure of central adiposity. Endpoints were incidence of new posthemotherapy cardiometabolic disease (new antihypertensive, lipid-lowering, or diabetes medication), and postchemotherapy Framingham risk scores. Cox models and linear regression with interaction terms were applied. Postchemotherapy body fat distribution was analyzed in 108 patients. All statistical tests were 2-sided., Results: The baseline median age was 31 years (interquartile range [IQR] = 26-39 years), body mass index (BMI) was 26 kg/m2 (IQR = 24-29 kg/m2), and the VAT-to-SAT ratio was 0.49 (IQR = 0.31-0.75). The median follow-up was 26 months (IQR = 16-59 months). Higher prechemotherapy VAT-to-SAT ratios inferred a higher likelihood of new cardiometabolic disease among patients with a BMI of 30 kg/m2 or greater (age-adjusted hazard ratio = 3.14, 95% confidence interval = 1.02 to 9.71, P = .047), but not other BMI groups. The prechemotherapy VAT-to-SAT ratio was associated with postchemotherapy Framingham risk scores in univariate regression analysis (exp(β)-estimate: 2.10, 95% confidence interval = 1.84 to 2.39, P < .001); in a multivariable model, this association was stronger in younger vs older individuals. BMI increased in most patients after chemotherapy and correlated with increases in the VAT-to-SAT ratio (Spearman r = 0.39, P < .001)., Conclusions: In testicular cancer survivors, central adiposity is associated with increased cardiometabolic risk after cisplatin-based chemotherapy, particularly in obese or young men. Weight gain after chemotherapy occurs preferentially in the visceral compartment, providing insight into the pathogenesis of cardiovascular disease in this population., (© The Author(s) 2022. Published by Oxford University Press.)

The implementation of dual T-cell depletion comprising 4.5 mg/kg of antithymocyte globulin (ATG), post-transplantation cyclophosphamide, and cyclosporine A for reduced-intensity allogeneic hematopoietic cell transplantation (HCT) independent of donor source in 2015 significantly improved graft-versus-host disease (GVHD) control at our Institution. Further advances were made between 2017 to 2020 in supportive care of allogeneic HCT recipients and were the subject of this study, with 651 adults included. Transplant outcomes were compared between patients who underwent transplantation during Period 1 (2017-2018) and Period 2 (2019-2020). Main changes implemented during the study period were reduction of ATG dose from 4.5 to 2 mg/kg in matched unrelated donor transplants, abandoning of dual T-cell depletion in matched related donor transplants, combining dual T-cell depletion with myeloablative conditioning for selected patients, and reduction of the target therapeutic cyclosporine level from 200 to 400 ng/L to 150 to 250 ng/L. Other improvements included addition of ursodiol until day 100, implementation of a double responsible physician model, and personalized patient supportive care plan focused on activity and calorie intake. The reduction in intensity of GVHD prophylaxis provided comparable acute GVHD and moderate-severe chronic GVHD between both time periods. Altogether the described improvements in transplant methodology and supportive care showed that compared to Period 1, patients transplanted in Period 2 had superior 1-year overall survival, relapse-free survival, and non-relapse mortality and showed a trend toward better GVHD- and relapse-free survival, without an increase in relapse risk. This study reports the results of outcomes-directed improvements in transplantation design, GVHD prophylaxis, and supportive care, highlighting how transplantation outcomes can be improved through careful modifications in response to meticulously monitored outcomes., (Copyright © 2022 The American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc. All rights reserved.)

Introduction: Increasing survival of patients with multiple myeloma (MM) has resulted in an increased recognition of therapy-related hematological malignancies (t-MDS/AML, t-ALL, and t-CMML). There are limited data on the role of allogeneic hematopoietic stem cell transplantation (HCT) in this patient population., Patients and Methods: We retrospectively reviewed patients who underwent HCT for t-MDS/AML, t-ALL, and t-CMML developing after receiving treatment for MM at our center. Patients were analyzed for myeloma characteristics and therapy, time to diagnosis of therapy-related hematological neoplasms, clinical, laboratory characteristics, transplant details, relapse-free survival (RFS), and overall survival (OS)., Results: Twenty patients underwent HCT for therapy-related hematological malignancies after MM (t-MDS/AML = 13, t-ALL = 6, t-CMML = 1). Median(range) age at time of transplant was 62.5 (49-73) years and 70% (n = 14) were male. The most common cytogenetic abnormality was complex/monosomal karyotype in 30% (n = 6) followed by monosomy/deletion of chromosome 5 or 7 in 15% (n = 3) of patients each. Donors were human leukocyte antigen matched (10/10 or 6/6) siblings in 30% (n = 6), unrelated in 60% (n = 12) and haploidentical in 10% (n = 2) patients. Estimated 2-year OS and RFS for the whole cohort were 53.1% and 47.2% respectively. There was a trend toward better survival in patients with t-ALL when compared to t-MDS/AML; however, the difference was not statistically significant. We did not find any pre-transplant or post-transplant factors that were predictive of survival outcomes after multivariate analysis., Conclusions: Allogeneic HCT provides substantial long-term disease-free survival in a proportion of patients with MM-associated therapy-related hematological malignancies. Multicenter studies with more patients and longer follow-up may provide additional information about factors affecting outcomes., (© 2022 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

In donor selection for allogeneic stem cell transplant, several factors are considered for potential impact on transplant outcome. Previous publications suggested single HLA-mismatched unrelated donors (MMUD) may be equivalent to 10/10 matched unrelated donors (MUDs). We retrospectively examined factors affecting outcome in a single-center study using ATG followed by post-transplant cyclophosphamide, termed ATG-PTCy, GvHD prophylaxis. Fifty-two patients who received grafts from MMUD and 188 patients transplanted from MUD between January 2015 and December 2019, at Princess Margaret Cancer Centre, Canada, were enrolled. All patients received reduced-intensity conditioning. Overall survival for 9/10 recipients at 2 years was significantly worse, 37.2% versus 68.5% for 10/10 MUDs, p < .001, as were NRM at 1 year 39.5% versus 11.7%, p < .001, and GRFS at 2 years 29.8% versus 58.8%, p < .001, respectively, potentially due to higher incidence of infections including CMV. By multivariable analysis, factors correlating with survival negatively were DRI, and MMUD, whereas for NRM MMUD and increasing age were unfavorable. For GRFS significant unfavorable factors included donor age ≤32 years, female donor to male recipient, DRI high-very high and MMUD. These data suggest that MMUD, primarily HLA-A and HLA-B MMUD, confer significantly inferior outcome despite use of ATG-PTCy. Further development of novel conditioning regimens and GvHD prophylaxis is needed to mitigate these risks., (© 2021 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Background/objective: Existing literature on allogeneic hematopoietic stem cell transplantation (allo-HSCT) in therapy-related acute myeloid leukemia (t-AML) is confounded by the inclusion of patients with secondary AML and t-MDS. We aim to report our 20-year experience of HSCT in t-AML., Methods: We retrospectively reviewed patients with t-AML who underwent HSCT. Patients were analyzed for prior malignancy, therapy, time to diagnosis of t-AML, transplant details, relapse-free survival (RFS), overall survival (OS), and predictors of outcomes., Results: In total, 68 patients (59.9% female; median age, 56.5 years) underwent HSCT. Acute and chronic graft-versus-host disease (GVHD) occurred in 39 (57.4%) and 23 (33.8%) patients, respectively. Cumulative incidence of relapse, nonrelapse mortality, RFS, and OS at 2 years were 17.9%, 34.5%, 47.6%, and 49.3%, respectively. Significant predictors of reduced OS were presence of 11q23 rearrangement (hazard ratio [HR], 3.24), using induction regimens other than FLAGI-da or 7 + 3 (HR, 3.65), haploidentical donors (HR, 3.48), Eastern Cooperative Oncology Group performance status 2 or higher (HR, 5.83), and using cyclosporine A-methotrexate as GVHD prophylaxis (HR, 2.41). A significant decrement in survival was seen with an increasing number of any of these prognostic factors., Conclusion: Outcomes of t-AML are satisfactory after allo-HSCT. Patients with t-AML with good-risk karyotypes, good performance status, having HLA-matched donors, and receiving intensive induction regimens have better outcomes after HSCT.

During 2020, the concurrent novel COVID-19 pandemic lead to widespread cryopreservation of allogeneic hematopoietic cell transplant grafts based on National Marrow Donor Program and European Society of Blood and Marrow Transplantation recommendations, in order to secure grafts before the start of conditioning chemotherapy. We sought to examine the impact of this change in practice on patient outcomes. We analyzed the outcomes of 483 patients who received hematopoietic stem cell transplantation (HSCT) between August 2017 and August 2020, at Princess Margaret Cancer Centre, Canada, in the retrospective study, comparing the outcomes between those who received cryopreserved or fresh peripheral blood stem cell grafts. Overall compared with those who received fresh grafts (n = 348), patients who received cryopreserved grafts (n = 135) had reduced survival and GRFS, reduced incidence of chronic graft-versus-host disease (GvHD), delay in neutrophil engraftment, and higher graft failure (GF), with no significant difference in relapse incidence or acute GvHD. However, recipients of cryopreserved matched-related donor HSCT showed significantly worse OS, NRM, GRFS compared with fresh grafts. Multivariable analysis of the entire cohort showed significant impact of cryopreservation on OS, relapse, cGvHD, GF, and GRFS. We conclude that cryopreservation was associated with inferior outcomes post-HSCT, possibly due to the combination of ATG and post-transplant cyclophosphamide impacting differential tolerance to cryopreservation on components of the stem cell graft; further studies are warranted to elucidate mechanisms for this observation., (© 2021 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

This study compares the outcomes before and after reducing the ATG dose from 4.5 to 2 mg/kg, in a combination of PTCy and CsA for GVHD prevention, in 250 patients treated with HLA matched RIC PB-alloHCT (70% received 4.5 mg/kg and 30% received 2 mg/kg). The incidences of grade II-IV and III-IV aGVHD at day +100, and moderate/severe cGVHD at 1-year were 12.6% vs. 20% ( p  = 0.431), 3.6% vs. 4.5% ( p  = 0.935), and 10.9% vs. 26.1% ( p  = 0.480), respectively. PTLD (9.1% vs. 1.3%, p  = 0.026) and viral infections (30.3% vs. 12%; p  = 0.001) were lower for those treated with 2 mg/kg of ATG. The reduction of the ATG dose resulted in a comparable OS (2-year: 64.7% vs. 64.7%), GRFS (2-year: 48.0% vs. 44.5%), RFS (2-year: 57.0% vs. 62.0%), and NRM (2-year: 17.8 vs. 14.9). The use of (2 mg/kg) ATG-PTCy-CsA for HLA matched RIC alloHCT results in lower viral infections, and incomparable GVHD preventive effect and survival rates.

Introduction: Allogeneic hematopoietic cell transplantation (HCT) can be curative for acute myeloid leukemia (AML). Novel therapies may render patients' bone marrow hypocellularity and lead to prolonged post-therapy pancytopenia. Patients' bone marrow cellularity (BMC) at pretransplant assessment and post-treatment pancytopenia (classification CR-incomplete [CRi]) may manifest AML persistence., Methodology: We retrospectively examined the impact of BMC and ELN response (ELNr) on a single-center cohort of 337 patients who underwent allogeneic HCT for AML in CR1., Results: Median follow-up was 33 months. Overall survival (OS) for the whole cohort was 55.8% at 2 years, while cumulative incidence of relapse (CIR) was 20.8%, and non-relapse mortality was 27.5%. OS and CIR were not significantly different between BMC groups; and neither was ELNr. ELNr CRi was associated with BMC aplastic and hypocellular marrow states (P < 2.6e-8). Multivariate analysis confirmed neither BMC nor attainment of ELNr CR vs CRi affected OS or relapse. Significant factors for survival included age at transplant, cytogenetic risk, development of acute Gr II-IV GvHD, and moderate-severe chronic GvHD, while cytogenetic risk and chronic GvHD affected relapse., Conclusion: Neither ELNr status nor pretransplant BMC influenced relapse post-HCT or OS. Hypocellularity and CRi are not negative prognostic factors for post-HCT outcomes of AML., (© 2021 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Background: Many patients who have been suffering by Covid-19 suffer of long-Covid syndrome, with symptoms of fatigue and muscular weakness that characterize post-acute sequelae SARS-CoV-2 infection (PASC). However, there is limited knowledge about the molecular pathophysiology, and about the serum profile of these patients. Methods: We studied the blood serum profile of 75 selected patients, with previous confirmed Covid-19, 2 months after hospital discharge, who reported new-onset fatigue, muscle weakness and/or dyspnea not present prior to the virus infection and independently from concomitant diseases and/or clinical conditions. Results: All patients had very high serum concentrations of ferritin and D-Dimer. 87 and 72% of patients had clinically significant low levels of hemoglobin and albumin, respectively. Seventy three percentage had elevations in erythrocyte sedimentation rate and CRP. Twenty seven percentage had elevations in LDH. Conclusions: The co-existence of patient symptoms along with blood markers of coagulation, protein disarrangement and inflammation suggests ongoing alterations in the metabolism, promoting an inflammatory/hypercatabolic state which maintains a vicious circles implicated in the persistence of PASC. The persistence of altered D-Dimer levels raises the possibility of long-term risks of thromboembolic disease. All these markers levels should be accurately evaluated in the long-term follow-up, with individualized consideration for prophylactic nutritional, anti-inflammatory and/or anticoagulant therapy if indicated., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Pasini, Corsetti, Romano, Scarabelli, Chen-Scarabelli, Saravolatz and Dioguardi.)

Haploidentical hematopoietic cell transplantation (HaploHCT) is an alternative treatment option for patients without a suitable 10/10 HLA matched donor. We share an updated experience at our center of using in vivo dual T-cell depletion with anti-thymocyte globulin (ATG) and post-transplantation cyclophosphamide (PTCy) in peripheral blood haploHCT and report the impact of reducing the dose of ATG from 4.5 mg/kg to 2 mg/kg on post-transplantation complications and outcomes. Ninety-five consecutive adults underwent haploHCT at our center between August 2016 and February 2020, all of whom were included in the study. Nine (9.5%) patients received myeloablative conditioning, and 86 (90.5%) patients underwent reduced-intensity haploHCT. All patients received thymoglobulin, PTCy and cyclosporine (CsA) for graft-versus-host disease (GVHD) prophylaxis: Sixty (63.2%) patients received 4.5 mg/kg, and 35 (36.8%) patients received 2 mg/kg of ATG. Clinical information was collected retrospectively and updated in June 2020. The median age was 57 (18-73), and acute myeloid leukemia was the most prevalent diagnosis (58.9%). The day 100 cumulative incidence of grade II-IV and grade III-IV aGVHD, and 1-year moderate/severe cGVHD were 22.3%, 11.1%, and 20.2%, respectively. Those patients who received 2 mg/kg of ATG had higher incidence of grade III-IV aGVHD (23.9% vs 3.5%, P = .006) and comparable moderate/severe cGVHD (1-year 20.6% vs 19.8%, P = .824) than those patients who received 4.5 mg/kg. Overall, the 18-month overall survival (OS), relapse-free survival (RFS), and non-relapse mortality (NRM) were 43.8%, 38.4%, and 40.2%, respectively. The reduction of the ATG dose did not have a significant impact in OS (hazard ratio [HR] 1.06, P = .847), RFS (HR 0.984, P = .955), and in NRM (HR 1.38; P = .348). The reduction of the ATG resulted in a negative impact on aGVHD without conferring any benefit in OS, RFS, and NRM. Consequently, the ATG dose used at our institution in combination with PTCy and CsA for haploHCT continues to be 4.5 mg/kg., (Crown Copyright © 2021. Published by Elsevier Inc. All rights reserved.)

Chronic heart failure (CHF) is a disease with important clinical and socio-economic ramifications. Malnutrition and severe alteration of the protein components of the body (protein disarrangements), common conditions in CHF patients, are independent correlates of heart dysfunction, disease progression, and mortality. Autophagy, a prominent occurrence in the heart of patients with advanced CHF, is a self-digestive process that prolongs myocardial cell lifespan by the removal of cytosolic components, such as aging organelles and proteins, and recycles the constituent elements for new protein synthesis. However, in specific conditions, excessive activation of autophagy can lead to the destruction of molecules and organelles essential to cell survival, ultimately leading to organ failure and patient death. In this review, we aim to describe the experimental and clinical evidence supporting a pathophysiological role of nutrition and autophagy in the progression of CHF. The understanding of the mechanisms underlying the interplay between nutrition and autophagy may have important clinical implications by providing molecular targets for innovative therapeutic strategies in CHF patients.

BACKGROUND In humans, wood dust is a carcinogen. Indeed, a strong association between wood dust and lung cancer risk has been reported in woodworkers, as well as in the general population. CASE REPORT The patient was a 58-year-old man with follicular B-cell lymphoma. In the 10 years preceding the cancer diagnosis, he lived within 1/4 mile of a paper mill, where wood was processed. Computed tomography of the chest, abdomen, and pelvis revealed right hilar, mediastinal, abdominal, and retroperitoneal lymphadenopathy, bilateral pleural effusions, and a large soft-tissue mass infiltrating the small bowel mesentery. Analysis of the pleural fluid revealed the presence of a web of thin filopodia-like filaments, which trapped clusters of mesothelial cells and atypical lymphocytes. Single tubular filaments, morphologically similar to tunneling nanotubes, were seen originating from atypical lymphocytes and reaching neighboring cells. Furthermore, long, thick, cylindrical fibers of unknown nature, probably from the external environment, were also observed. CONCLUSIONS Because the patient lived in an unhealthy environment for many years, the possibility that his clinical condition was related to exposure to toxic emissions should be entertained. Considered in this context, the foreign fibers in his pleural fluid could be a direct consequence of inhalation of contaminants in the polluted air.

Chronic diseases are characterised by altered autophagy and protein metabolism disarrangement, resulting in sarcopenia, hypoalbuminemia and hypo-haemoglobinaemia. Hypo-haemoglobinaemia is linked to a worse prognosis independent of the target organ affected by the disease. Currently, the cornerstone of the therapy of anaemia is iron supplementation, with or without erythropoietin for the stimulation of haematopoiesis. However, treatment strategies should incorporate the promotion of the synthesis of heme, the principal constituent of haemoglobin (Hb) and of many other fundamental enzymes for human metabolism. Heme synthesis is controlled by a complex biochemical pathway. The limiting step of heme synthesis is D-amino-levulinic acid (D-ALA), whose availability and synthesis require glycine and succinil-coenzyme A (CoA) as precursor substrates. Consequently, the treatment of anaemia should not be based only on the sufficiency of iron but, also, on the availability of all precursor molecules fundamental for heme synthesis. Therefore, an adequate clinical therapeutic strategy should integrate a standard iron infusion and a supply of essential amino acids and vitamins involved in heme synthesis. We reported preliminary data in a select population of aged anaemic patients affected by congestive heart failure (CHF) and catabolic disarrangement, who, in addition to the standard iron therapy, were treated by reinforced therapeutic schedules also providing essential animo acids (AAs) and vitamins involved in the maintenance of heme. Notably, such individualised therapy resulted in a significantly faster increase in the blood concentration of haemoglobin after 30 days of treatment when compared to the nonsupplemented standard iron therapy.

Introduction: Therapy-related acute lymphoblastic leukemia (t-ALL) is an increasingly recognized subset of therapy-related acute leukemia. There are limited data on the role of allogeneic hematopoietic stem cell transplantation (HSCT) in t-ALL. Recent reports suggest comparable outcomes of t-ALL with de novo ALL after HSCT., Patients and Methods: We retrospectively reviewed all patients of t-ALL who underwent HSCT at our center. Patients were analyzed for prior malignancy, therapy, time to diagnosis of t-ALL, clinical, laboratory characteristics, transplant details, relapse-free survival (RFS), and overall survival (OS)., Results: Eighteen patients (M:F ratio 1:1; Median age 44 years) underwent HSCT for t-ALL. Median latent period from primary malignancy to t-ALL was 44.8 months. 11q23 rearrangement and t(9;22) were present in 33.3% and 22.2% patients, respectively. Stem cell donors were matched related, matched unrelated, and haploidentical in 27.8% (n = 5), 55.6% (n = 10), and 16.7% (n = 3) patients, respectively. Five patients died before D+ 100 (27.8%). Estimated 2-year RFS and OS were 47.1% and 51.8%, respectively. We did not find any pretransplant and post-transplant risk factors that were predictive of improved OS or RFS after multivariate analysis., Conclusions: Allogeneic HSCT outcomes in t-ALL were comparable to HSCT outcomes in de novo ALL. Multicenter studies with more patients and longer follow-up may provide factors affecting outcome and survival., (© 2020 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)