Search

Photoimmunotherapy (PIT) combines the specificity of antibodies with the cytotoxicity of light activatable photosensitizers (PS) and is a promising new cancer therapy. We designed and synthesized, in a highly convergent manner, the silicon phthalocyanine dye WB692-CB2, which is novel for being the first light-activatable PS that can be directly conjugated via a maleimide linker to cysteines. In the present study we conjugated WB692-CB2 to a humanized antibody with engineered cysteines in the heavy chains that specifically targets the prostate-specific membrane antigen (PSMA). The resulting antibody dye conjugate revealed high affinity and specificity towards PSMA-expressing prostate cancer cells and induced cell death after irradiation with red light. Treated cells exhibited morphological characteristics associated with pyroptosis. Mechanistic studies revealed the generation of reactive oxygen species, triggering a cascade of intracellular events involving lipid peroxidation, caspase-1 activation, gasdermin D cleavage and membrane rupture followed by release of pro-inflammatory cellular contents. In first in vivo experiments, PIT with our antibody dye conjugate led to a significant reduction of tumor growth and enhanced overall survival in mice bearing subcutaneous prostate tumor xenografts. Our study highlights the future potential of the new phthalocyanine dye WB692-CB2 as PS for the fluorescence-based detection and PIT of cancer, including local prostate tumor lesions, and systemic activation of anti-tumor immune responses by the induction of pyroptosis.

Abstract Purpose Convolutional Neural Networks (CNNs) have emerged as transformative tools in the field of radiation oncology, significantly advancing the precision of contouring practices. However, the adaptability of these algorithms across diverse scanners, institutions, and imaging protocols remains a considerable obstacle. This study aims to investigate the effects of incorporating institution-specific datasets into the training regimen of CNNs to assess their generalization ability in real-world clinical environments. Focusing on a data-centric analysis, the influence of varying multi- and single center training approaches on algorithm performance is conducted. Methods nnU-Net is trained using a dataset comprising 161 18F-PSMA-1007 PET images collected from four distinct institutions (Freiburg: n = 96, Munich: n = 19, Cyprus: n = 32, Dresden: n = 14). The dataset is partitioned such that data from each center are systematically excluded from training and used solely for testing to assess the model's generalizability and adaptability to data from unfamiliar sources. Performance is compared through a 5-Fold Cross-Validation, providing a detailed comparison between models trained on datasets from single centers to those trained on aggregated multi-center datasets. Dice Similarity Score, Hausdorff distance and volumetric analysis are used as primary evaluation metrics. Results The mixed training approach yielded a median DSC of 0.76 (IQR: 0.64–0.84) in a five-fold cross-validation, showing no significant differences (p = 0.18) compared to models trained with data exclusion from each center, which performed with a median DSC of 0.74 (IQR: 0.56–0.86). Significant performance improvements regarding multi-center training were observed for the Dresden cohort (multi-center median DSC 0.71, IQR: 0.58–0.80 vs. single-center 0.68, IQR: 0.50–0.80, p 0.05; Freiburg: multi-center 0.78, IQR: 0.53–0.87 vs. single-center 0.71, IQR: 0.53–0.83, p = 0.23). Conclusion CNNs trained for auto contouring intraprostatic GTV in 18F-PSMA-1007 PET on a diverse dataset from multiple centers mostly generalize well to unseen data from other centers. Training on a multicentric dataset can improve performance compared to training exclusively with a single-center dataset regarding intraprostatic 18F-PSMA-1007 PET GTV segmentation. The segmentation performance of the same CNN can vary depending on the dataset employed for training and testing.

Abstract Urothelial bladder cancer (UC) has a wide tumor biological spectrum with challenging prognostic stratification and relevant therapy-associated morbidity. Most molecular classifications relate only indirectly to the therapeutically relevant protein level. We improve the pre-analytics of clinical samples for proteome analyses and characterize a cohort of 434 samples with 242 tumors and 192 paired normal mucosae covering the full range of UC. We evaluate sample-wise tumor specificity and rank biomarkers by target relevance. We identify robust proteomic subtypes with prognostic information independent from histopathological groups. In silico drug prediction suggests efficacy of several compounds hitherto not in clinical use. Both in silico and in vitro data indicate predictive value of the proteomic clusters for these drugs. We underline that proteomics is relevant for personalized oncology and provide abundance and tumor specificity data for a large part of the UC proteome ( www.cancerproteins.org ).

Abstract Inhibition of epigenetic regulators by small molecules is an attractive strategy for cancer treatment. Recently, we characterised the role of lysine methyltransferase 9 (KMT9) in prostate, lung, and colon cancer. Our observation that the enzymatic activity was required for tumour cell proliferation identified KMT9 as a potential therapeutic target. Here, we report the development of a potent and selective KMT9 inhibitor (compound 4, KMI169) with cellular activity through structure-based drug design. KMI169 functions as a bi-substrate inhibitor targeting the SAM and substrate binding pockets of KMT9 and exhibits high potency, selectivity, and cellular target engagement. KMT9 inhibition selectively downregulates target genes involved in cell cycle regulation and impairs proliferation of tumours cells including castration- and enzalutamide-resistant prostate cancer cells. KMI169 represents a valuable tool to probe cellular KMT9 functions and paves the way for the development of clinical candidate inhibitors as therapeutic options to treat malignancies such as therapy-resistant prostate cancer.

Background: Duplex kidneys may be associated with additional pathologies with an indication for surgery. Various surgical approaches have been described. However, little is known about long-term outcomes and quality of life (QoL) for these patients. Objective: To present long-term outcomes and QoL data up to 30 yr after surgical treatment of duplex kidneys and associated pathologies. Design, setting, and participants: We collected clinical and operative data for all patients who underwent surgery for complicated duplex kidney at our institution from 1990 to 2018. All patients were invited for a follow-up examination or telephone interview. Outcome measurements and statistical analysis: We evaluated renal function, clinical outcomes, residual dilation of the upper urinary tract, and health-related QoL. Results and limitations: Of the 176 patients included, 173 were available for follow-up (mean 140.5 mo). Surgical treatment involved an upper-tract, lower-tract, or combined approach in 11%, 56%, and 33% of cases, respectively. Rates of perioperative complications (8%) and secondary surgery (10%) were low. Overall, 95% of our patients achieved full restitution. Renal function was preserved in all cases, with recurrent urinary tract infections reported by just 2% and urinary incontinence by 1%. Good health-related QoL was reported by 98% of patients. Those without full restitution included six patients who underwent total nephrectomy and two boys who underwent multiple surgeries and urinary diversion. Our results are limited by their retrospective nature, including partly incomplete data sets. Conclusions: Management of duplex kidneys and associated pathologies is complex and highly individual. By planning a personal approach for each patient it is possible to achieve full bodily integrity and good QoL for most of these patients. Patient summary: Almost all patients undergoing surgery for duplex kidneys and associated pathologies will lead a life without body impairment and good quality of life.This trial is registered in the German Clinical Trials Register as DRKS00022542.

Background: Direct-to-consumer (DTC) online prescription platforms (OPP) for sexual health represent a potential paradigm shift in the diagnosis and treatment for sexual dysfunctions in the way men seek care. Knowledge of patients' risk profile using these platforms is limited. Aim: To assess risk profiles of patients reaching out to health care professionals through their DTC. Methods: Anonymized data originally collected between February 2021 to May 2022 by a DTC platform in the men's health care space were retrospectively analyzed. Data included the content of patient requests through a communication function, as well as the corresponding responses by the attending physician on staff. Each request was then assessed by two independent urologists and categorized by the level of the risk profile as well as the need to refer the patient to further medical evaluation. Results: Of 585 patient requests, 531 (90.8%) were classified as low risk. In the high-risk group, 32 patients were recommended to schedule an urgent appointment at a specialist. Only three patients (0.5%) were advised to seek emergency care. The overall referral rate for both risk groups was 52.3%. The requests of 279 patients (47.7%) were assessed as digitally treatable. Almost all patients who were digitally treatable were low risk. Side effects accounted for only 9.6% of all requests in the low-risk group, compared with 46.3% in the high-risk group. Conclusion: Overall, low-risk levels in the requests of patients using a DTC platform were reported, with almost half of them suitable to be solved digitally, whereas the other half required referral to an in-person specialist.

Immunotoxins consist of an antibody or antibody fragment that binds to a specific cell surface structure and a cytotoxic domain that kills the cell after cytosolic uptake. Pseudomonas Exotoxin A (PE) based immunotoxins directed against a variety of tumor entities have successfully entered the clinic. PE possesses a KDEL-like motif (REDLK) that enables the toxin to travel from sorting endosomes via the KDEL-receptor pathway to the endoplasmic reticulum (ER), from where it is transported into the cytosol. There, it ADP-ribosylates the eukaryotic elongation factor 2, resulting in ribosome inhibition and finally apoptosis. One major problem of immunotoxins is their lysosomal degradation causing the need for much more immunotoxin molecules than finally required for induction of cell death. The resulting dose limitations and substantially increased side effects require new strategies to achieve improved cytosolic uptake. Here we generated an immunotoxin consisting of a humanized single chain variable fragment (scFv) targeting the prostate specific membrane antigen (PSMA) and the de-immunized PE variant PE24mut. This immunotoxin, hD7-1(VL-VH)-PE24mut, showed high and specific cytotoxicity in PSMA-expressing prostate cancer cells. We deleted the REDLK sequence to prevent transport to the ER and achieve endosomal entrapment. The cytotoxicity of this immunotoxin, hD7-1(VL-VH)-PE24mutΔREDLK, was greatly reduced. To restore activity, we added the endosomal escape enhancer SO1861 and observed an up to 190,000-fold enhanced cytotoxicity corresponding to a 57-fold enhancement compared to the initial immunotoxin with the REDLK sequence. A biodistribution study with different routes of administration clearly showed that the subcutaneous injection of hD7-1(VL-VH)-PE24mutΔREDLK in mice resulted in the highest tumor uptake. Treatment of mice bearing prostate tumors with a combination of hD7-1(VL-VH)-PE24mutΔREDLK plus SO1861 resulted in inhibition of tumor growth and enhanced overall survival compared to the monotherapies. The endosomal entrapment of non-toxic anti-PSMA immunotoxins followed by enhanced endosomal escape by SO1861 provides new therapeutic options in the future management of prostate cancer.

Abstract Background Urinary stone disease is a widespread disease with tremendous impact on those affected and on societies around the globe. Nevertheless, clinical and health care research in this area seem to lag far behind cardiovascular diseases or cancer. This may be due to the lack of an immediate deadly threat from the disease and therefore less public and professional interest. However, the patients suffer from recurring, sometimes intense pain and often must be treated in hospital. Long-term morbidity includes doubled rates of chronic kidney disease and arterial hypertension after at least one stone-related event. Observational studies, more specifically, registries and other electronic data sets have been proposed as a means of filling critical gaps in evidence. We propose a nationwide digital and fully automated registry as part of the German Ministry for Education and Research (BMBF) call for the "establishment of model registries”. Methods RECUR builds on the technical infrastructure of Germany’s Medical Informatics Initiative. Local data integration centres (DIC) of participating medical universities will collect pseudonymized and harmonized data from respective hospital information systems. In addition to their clinical data, participants will provide patient reported outcomes using a mobile patient app. Scientific data exploration includes queries and analysis of federated data from DICs of eleven participating sites. All primary patient data will remain at the participating sites at all times. With comprehensive data from this longitudinal registry, we will be able to describe the disease burden, to determine and validate risk factors, and to evaluate treatments. Implementation and operation of the RECUR registry will be funded by the BMBF for five years. Subsequently, the registry is to be continued by the German Society of Urology without significant costs for study personnel. Discussion The proposed registry will substantially improve the structural and procedural framework for patients with recurrent urolithiasis. This includes advanced diagnostic algorithms and treatment pathways. The registry will help us identify those patients who will most benefit from specific interventions to prevent recurrences. The RECUR study protocol and the registry’s technical architecture including full digitalization and automation of almost all registry-associated proceedings can be transferred to future registries. Trial registration This study is registered at the German Clinical Trial Register (Deutsches Register Klinischer Studien), DRKS-ID DRKS00026923 , date of registration January, 11th 2022.

Computed tomography (CT) is used to diagnose urolithiasis, a prevalent condition. In order to establish the strongest foundation for the quantifiability of urolithiasis, this study aims to develop semi-automated urolithiasis segmentation methods for CT images that differ in terms of surface-partial-volume correction and adaptive thresholding. It also examines the diagnostic accuracy of these methods in terms of volume and maximum stone diameter. One hundred and one uroliths were positioned in an anthropomorphic phantom and prospectively examined in CT. Four different segmentation methods were developed and used to segment the uroliths semi-automatically based on CT images. Volume and maximum diameter were calculated from the segmentations. Volume and maximum diameter of the uroliths were measured independently by three urologists by means of electronic calipers. The average value of the urologists´ measurements was used as a reference standard. Statistical analysis was performed with multivariate Bartlett's test. Volume and maximum diameter were in very good agreement with the reference measurements (r>0.99) and the diagnostic accuracy of all segmentation methods used was very high. Regarding the diagnostic accuracy no difference could be detected between the different segmentation methods tested (p>0.55). All four segmentation methods allow for accurate characterization of urolithiasis in CT with respect to volume and maximum diameter of uroliths. Thus, a simple thresholding approach with an absolute value may suffice for robust determination of volume and maximum diameter in urolithiasis.

Introduction The Prostate Imaging Reporting and Data System (PI-RADS) standardises reporting of prostate MRI for the detection of clinically significant prostate cancer. We provide the protocol of a planned living systematic review and meta-analysis for (1) diagnostic accuracy (sensitivity and specificity), (2) cancer detection rates of assessment categories and (3) inter-reader agreement.Methods and analysis Retrospective and prospective studies reporting on at least one of the outcomes of interest are included. Each step that requires literature evaluation and data extraction is performed by two independent reviewers. Since PI-RADS is intended as a living document itself, a 12-month update cycle of the systematic review and meta-analysis is planned.This protocol is in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses—Protocols statement. The search strategies including databases, study eligibility criteria, index and reference test definitions, outcome definitions and data analysis processes are detailed. A full list of extracted data items is provided.Summary estimates of sensitivity and specificity (for PI-RADS ≥3 and PI-RADS ≥4 considered positive) are derived with bivariate binomial models. Summary estimates of cancer detection rates are calculated with random intercept logistic regression models for single proportions. Summary estimates of inter-reader agreement are derived with random effects models.Ethics and dissemination No original patient data are collected, ethical review board approval, therefore, is not necessary. Results are published in peer-reviewed, open-access scientific journals. We make the collected data accessible as supplemental material to guarantee transparency of results.PROSPERO registration number CRD42022343931.

Despite decades of research and successful improvements in diagnosis and therapy, prostate cancer (PC) remains a major challenge. In recent years, it has become clear that PC stem cells (PCSCs) are the driving force in tumorigenesis, relapse, metastasis, and therapeutic resistance of PC. In this minireview, we discuss the impact of PCSCs in the clinical practice. Moreover, new therapeutic approaches to combat PCSCs are presented with the aim to achieve an improved outcome for patients with PC.

BackgroundAntithrombotic therapy is complex and requires informed decisions and high therapy adherence. Several mobile phone apps exist to either support physicians in the management of antithrombotic therapies or to educate and support patients. For the majority of these apps, both their medical evidence and their development background are unknown. ObjectiveThis review aims to investigate the available literature describing high-quality apps for managing antithrombotic therapy based on professional scientific information. MethodsKeywords and Medical Subject Heading terms were used to search MEDLINE via PubMed and Ovid between December 2019 and January 2022. Inclusion criteria were the availability of full text and publications in the English language. Apps that solely focused on atrial fibrillation were excluded. Qualitative findings were thematically synthesized and reported narratively. ResultsOut of 149 identified records, 32 were classified as eligible. We identified four groups: (1) apps for patients supporting self-management of vitamin K antagonists, (2) apps for patients increasing therapy adherence, (3) educational apps for patients, and (4) apps for physicians in supporting guideline adherence. ConclusionsThroughout the evaluated data, patients from all age groups receiving antithrombotic drugs expressed the desire for a digital tool that could support their therapy management. In addition, physicians using mobile guideline-based apps may have contributed to decreased adverse event rates among their patients. In general, digital apps encompassing both user-friendly designs and scientific backgrounds may enhance the safety of antithrombotic therapies. However, our evaluation did not identify any apps that addressed all antithrombotic drugs in combination with perioperative stratification strategies. Currently, strict regulations for smartphone apps seem to negatively affect the development of new apps. Therefore, new legal policies for medical digital apps are urgently needed.

Abstract Purpose Intraoperative identification of prostate cancer (PCa) lymph node (LN) metastases (LNM) detected by preoperative PSMA PET/CT may be facilitated by PSMA radio-guided surgery (RGS) with use of a γ-probe. Earlier we demonstrated excellent performance of the 111In-labelled PSMA ligand DKFZ-617 ([111In]In-PSMA-617) in RGS for ex situ distinction of LN vs LNM at lymphadenectomy (LA) at a single LN level. In comparison with indium-111, technetium-99m has better physical properties for γ-probe measurements, better availability and lower radiation exposure for patients and medical personnel. Against this background, we evaluated the uptake of 99mTc-PSMA-I&S ligand at the level of single LN and its power to discriminate between unaffected LN and LNM. Methods Six patients with PCa with the suspicion of LNM on preoperative PSMA-PET/CT underwent [99mTc]Tc-PSMA-I&S RGS (4 salvage LA, 2 primary LA) with intravenous injection of [99mTc]Tc-PSMA-I&S 24 h prior to surgery. Resected samples were isolated manually aiming at the level of single LN. Uptake measurements were done ex situ with a high-purity germanium detector. Receiver operating characteristic (ROC) analysis was performed based on [99mTc]Tc-PSMA-I&S uptake expressed as lean body mass standard uptake value (SUL). Results Separation of the tissue samples from 73 subregions resulted in 498 single samples. After final histopathology 356 LN, 160 LNM und 11 non-nodal PCa samples were identified. Median SUL of tumor-free samples (0.26) and samples with cancer (3.5) was significantly different (p

IntroductionAn accurate delineation of the intraprostatic gross tumor volume (GTV) is of importance for focal treatment in patients with primary prostate cancer (PCa). Multiparametric MRI (mpMRI) is the standard of care for lesion detection but has been shown to underestimate GTV. This study investigated how far the GTV has to be expanded in MRI in order to reach concordance with the histopathological reference and whether this strategy is practicable in clinical routine.Patients and MethodsTwenty-two patients with planned prostatectomy and preceded 3 Tesla mpMRI were prospectively examined. After surgery, PCa contours delineated on histopathological slides (GTV-Histo) were superimposed on MRI using ex-vivo imaging as support for co-registration. According to the PI-RADSv2 classification, GTV was manually delineated in MRI (GTV-MRI) by two experts in consensus. For volumetric analysis, we compared GTV-MRI and GTV-Histo. Subsequently, we isotropically enlarged GTV-MRI in 1 mm increments within the prostate and also compared those with GTV-Histo regarding the absolute volumes. For evaluating the spatial accuracy, we considered the coverage ratio of GTV-Histo, the Sørensen–Dice coefficient (DSC), as well as the contact with the urethra.ResultsIn 19 of 22 patients MRI underestimated the intraprostatic tumor volume compared to histopathological reference: median GTV-Histo (4.7 cm3, IQR: 2.5–18.8) was significantly (p

IntroductionLower urinary tract symptoms (LUTS) due to overactive bladder (OAB) are caused by spontaneous detrusor contractions. Medical treatment with muscarinic receptor antagonists or β3-adrenoceptor agonists aims to inhibit detrusor contractions, but overall results are unsatisfactory. Consequently, improved understanding of bladder smooth muscle contraction and identification of novel compounds for its inhibition are needed to develop alternative options. A role of the GTPase Rac1 for smooth muscle contraction has been reported from the prostate, but is unknown in the human detrusor. Here, we examined effects of the Rac inhibitors NSC23766, which may also antagonize muscarinic receptors, and EHT1864 on contraction of human detrusor tissues.MethodsFemale and male human detrusor tissues were obtained from radical cystectomy. Effects of NSC23766 (100 µM) and EHT1864 (100 µM) on detrusor contractions were studied in an organ bath.ResultsElectric field stimulation induced frequency-dependent contractions of detrusor tissues, which were inhibited by NSC23766 and EHT1864. Carbachol induced concentration-dependent contractions. Concentration response curves for carbachol were shifted to the right by NSC23766, reflected by increased EC50 values, but unchanged Emax values. EHT1864 reduced carbachol-induced contractions, resulting in reduced Emax values for carbachol. The thromboxane analog U46619 induced concentration-dependent contractions, which remained unchanged by NSC23766, but were reduced by EHT1864.ConclusionsNSC23766 and EHT1864 inhibit female and male human detrusor contractions. NSC23766, but not EHT1864 competitively antagonizes muscarinic receptors. In addition to neurogenic and cholinergic contractions, EHT1864 inhibits thromboxane A2-induced detrusor contractions. The latter may be promising, as the origin of spontaneous detrusor contractions in OAB is noncholinergic. In vivo, both compounds may improve OAB-related LUTS.

Background: Cancer-specific survival (CSS) within high-risk non-metastatic prostate cancer varies dramatically. It is likely that within this heterogenous population there are subgroup(s) at extraordinary risk, burdened with an exaptational poor prognosis. Establishing the characteristics of these group(s) would have significant clinical implications since high quality preoperative risk stratification remains the cornerstone of therapeutic decision making to date.Objective: To stratify high-risk prostate cancer based on preoperative characteristics and evaluate cancer specific survival after radical prostatectomy.Method: The EMPaCT multi-center database offers an international population of non-metastatic high-risk prostate cancer. Preoperative characteristics such as age, biopsy Gleason score, PSA and clinical stage were subcategorized. A multivariate analysis was performed using predictors showing significant survival heterogeneity after stratification, as observed by a univariate analysis. Based upon the hazard ratios of this multivariate analysis, a proportional score system was created. The most ideal group distribution was evaluated trough different score cut-off's. The predictive value was tested by the herald C index.Results: An overall 5-years CSS of 94% was noted within the entire high-risk cohort (n = 4,879). Except for age, all preoperative risk factors showed a significantly differing CSS. Multivariate analysis indicated, T4 stage as being the strongest predictor of CSS (HR: 3.31), followed by ISUP grade 5 group (HR 3,05). A score system was created by doubling the hazard ratios of this multivariate analysis and rounding off to the nearest complete number. Multivariate analysis suggested 0, 4, 8, and 12 pts as being the most optimal group distribution (p-value: 0.0015). Five-years CSS of these groups were 97, 93, 87, and 70%, respectively. The calculated Herald C-index of the model was 0.77.Conclusion: An easy-to-use pre-operative model for risk stratification of newly diagnosed high-risk prostate cancer is presented. The heterogeneous CSS of high-risk non-metastatic prostate cancer after radical prostatectomy is illustrated. The model is clinically accessible through an online calculator, presenting cancer specific survival based on individualized patient characteristics.

Background: Prostate smooth muscle contraction plays an important role for pathophysiology and treatment of male lower urinary tract symptoms (LUTS) but is incompletely understood. Because the efficacy of available medication is limited, novel options and improved understanding of prostate smooth muscle contraction are of high demand. Recently, a possible role of polo-like kinase 1 (PLK1) has been suggested for smooth muscle contraction outside the lower urinary tract. Here, we examined effects of PLK inhibitors on contraction of human prostate tissue.Methods: Prostate tissues were obtained from radical prostatectomy. RT-PCR, Western blot and immunofluorescence were performed to detect PLK expression and phosphorylated PLK. Smooth muscle contractions were induced by electric field stimulation (EFS), α1-agonists, endothelin-1, or the thromboxane A2 analog U46619 in organ bath.Results: RT-PCR, Western blot, and immunofluorescence suggested expression of PLK1 in the human prostate, which may be located and active in smooth muscle cells. EFS-induced contractions of prostate strips were reduced by SBE 13 (1 μM), cyclapolin 9 (3 μM), TAK 960 (100 nM), and Ro 3280 (100 nM). SBE 13 and cyclapolin 9 inhibited contractions by the α1-agonists methoxamine, phenylephrine, and noradrenaline. In contrast, no effects of SBE 13 or cyclapolin 9 on endothelin-1- or U46619-induced contractions were observed.Conclusion: Alpha1-adrenergic smooth muscle contraction in the human prostate can be inhibited by PLK inhibitors. PLK-dependent signaling may be a new pathway, which promotes α1-adrenergic contraction of prostate smooth muscle cells. As contractions by endothelin and U46619 are not susceptible to PLK inhibition, this reflects divergent regulation of adrenergic and non-adrenergic prostate smooth muscle contraction.

Pharmacology of the lower urinary tract provides the basis for medical treatment of lower urinary tract symptoms (LUTS). Therapy of LUTS addresses obstructive symptoms (frequently explained by increased prostate smooth muscle tone and prostate enlargement) in patients with benign prostate hyperplasia (BPH) and storage symptoms in patients with overactive bladder (OAB). Targets for medical treatment include G protein-coupled receptors (α1 -adrenoceptors, muscarinic acetylcholine receptors, β3-adrenoceptors) or intracellular enzymes (5α-reductase; phosphodiesterase-5, PDE5). Established therapies of obstructive symptoms aim to induce prostate smooth muscle relaxation by α1 -blockers or PDE5 inhibitors, or to reduce prostate growth and volume with 5α-reductase inhibitors. Available options for treatment of OAB comprise anitmuscarinics, β3 -adrenoceptor agonists, and botulinum toxin A, which improve storage symptoms by inhibition of bladder smooth muscle contraction. With the recent approval of β3 -antagonists, PDE inhibitors, and silodosin for therapy of LUTS, progress from basic research of lower urinary tract pharmacology was translated into new clinical applications. Further targets are in preclinical stages of examination, including modulators of the endocannabinoid system and transient receptor potential (TRP) channels.

Aim: To determine the impact of the extent of lymph node invasion (LNI), on long-term oncological outcomes after radical prostatectomy (RP). Material and methods: In this retrospective study we examined the data of 1249 high-risk, non-metastatic PCa patients treated with RP and pelvic lymph node dissection (PLND) between 1989 and 2011 at 8 different tertiary institutions. We fitted univariate and multivariate cox models to assess independent predictors of cancer specific survival (CSS) and overall survival (OS). The number of positive LN was dichotomized according to the most informative cut-off predicting CSS. Kaplan-Meier curves assessed CSS and OS rates. Only patients with at least 10 LNs removed at PLND were included. This cut-off was chosen as a surrogate for a well performed PNLD.Results: Mean age was 65 years (median: 66, IQR 60-70). Positive surgical margins were present in 53.7% (n=671). Final Gleason score was 2-6 in 12.7% (n=158), 7 in 52% (n=649) and 8-10 in 35.4% (n=442). The median number of LNs removed during PLND was 15 (IQR 12-17). Of all patients, 1128 (90.3%) had 0-3 positive LNs, while 126 (9.7%) had ≥4 positive LNs. Patients with 0-3 positive LNs had significantly better CSS outcome at 10-year follow-up compared to patients with ≥4 positive LNs (87% vs. 50%; p < 0.0001). Similar results were obtained for OS, with a 72% vs. 37% (p

Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients' adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1-10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under experimental conditions.

BACKGROUND: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. OBJECTIVE: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. METHODS: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). RESULTS: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. CONCLUSIONS: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.