Search

Citrus tristeza virus (CTV) is a causal agent of diseases that have challenged the global citrus production for more than a century. The disease named ‘tristeza’, which means ‘sadness’ in Portuguese and Spanish, has spread by aphids and vegetative propagation, resulting in costly pandemics that reshaped the world citrus production by forcing the adaption of disease‐tolerant rootstocks. Furthermore, management of the second major CTV‐induced disease, stem pitting, became a unique example of the use of cross‐protection on a large nationwide scale, allowing many citrus growing regions to control the disease that could not be managed through horticultural practices. The information gathered in this review commemorates a hundred years of research on the virus and the respective diseases, which began with classical horticultural approaches and advanced toward the cutting‐edge molecular biology studies. In this regard, it is proper to mention that CTV research greatly benefited from close international collaboration between research institutions and scientists from the affected and nonaffected citrus areas. Moreover, despite the considerable initial losses caused by tristeza, the world's fresh fruit and juice concentrate citrus industries reemerged as highly productive following the research advancements, a situation that changed throughout Florida and Brazil in the past two decades or so with the outbreak of the devastating citrus greening (Huanglongbing) bacterial disease. This review encompasses past and recent advances in the CTV research positioning the citrus‐CTV pathosystem as a pivotal model system for investigating virus interactions with perennial woody hosts. The review will also serve as an updated version of the respective section on CTV in the Description of Plant Viruses that the Association of Applied Biologists manages. We dedicated this review to the 85th Birthday celebration of Prof. Moshe Bar‐Joseph, a world‐renowned plant pathologist whose half‐a‐century‐long career devoted to citrus diseases yielded many important, pioneering discoveries on CTV and other closteroviruses. Many of those are highlighted in this review. Prof. Bar‐Joseph retired from the Volcani Center, Agricultural Research Organization in Israel several years ago, yet he continues to be actively engaged in research and provides his expertise to citrus pathologists around the world in the present days. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is a globally pervasive and economically significant virus that negatively impacts citrus trees, leading to substantial reductions in fruit yield. CTV occurs within the phloem of infected plants, causing a range of disease phenotypes, such as stem pitting (SP), quick decline (QD), and other detrimental diseases. Research on CTV is challenging due to the large size of its RNA genome and the diversity of CTV populations. Comparative genomic analyses have uncovered genetic diversity in multiple regions of CTV isolates' genomes, facilitating the classification of the virus into distinct genotypes. Despite these challenges, notable advancements have been made in identifying and controlling CTV strains through serological and molecular methods. The following review concentrates on the techniques of nucleic acid identification and serological analysis for various CTV isolates, assisting in the comparison and evaluation of various detection methods, which are crucial for the effective management of CTV diseases, and so contributes to the innovation and development of CTV detection methods. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is a highly destructive viral pathogen posing a significant threat to citrus crops worldwide. Disease management and crop protection strategies necessitate the development of rapid and accurate detection methods. In this study, we employed Oxford Nanopore sequencing to detect CTV in Citrus unshiu samples. Subsequently, we developed a specific and sensitive detection assay combining CRISPR/Cas12a with reverse transcription-recombinase polymerase amplification. The CRISPR-Cas12a assay exhibited exceptional specificity for CTV, surpassing conventional RT-PCR by at least 10-fold in sensitivity. Remarkably, the developed assay detected CTV in field samples, with zero false negatives. This diagnostic approach is user-friendly, cost-effective, and offers tremendous potential for rapid onsite detection of CTV. Therefore, the CRISPR-Cas12a assay plays a significant role in managing and preserving citrus trees that are free from viruses in the industry. [ABSTRACT FROM AUTHOR]

A stem-pitting isolate of citrus tristeza virus (CTV), spreading in Hunan province of  China (HU-PSTS), was sequenced and indexed on indicator plants. Biological assays showed that HU-PSTS is a highly aggressive stem pitting isolate belonging to biogroup 5. Viral small RNAs (18-26 nt) of the isolate were deep sequenced by Illumina technology to gain genomic information on the CTV strain infecting the source plant. The reads mapping with 17 CTV reference genomes enabled us to re-assemble the genomes of VT, T68, T30 and T3 strains. Among the VT, the highest number of mapped reads (47-41%) was with SG29, T318A, CT11A, Nuaga and AT-1 genomes, whereas T68, T30 and T3 genomes were less represented (28-20%). Alignments with genomes belonging to T36 and RB strains revealed percentage of mapped reads ranging from 10 to 12%. This is the first sequenced genome of a CTV isolate from Hunan province. According to the results, further sequencing and bioindexing need to be developed to explore the potential of a local cross protective strategy.

Cross‐protection was first described a century ago. In practical terms, cross‐protection consists of the pre‐inoculation of plants with mild or attenuated viral isolates that protect the plants from subsequent infections with aggressive isolates. Experimentally, cross‐protection has been shown to apply to numerous virus and viroid species infecting numerous plant hosts, but the number of cases in which it has been successfully used for the control of the damage caused by viruses in crops is rather limited. Significant examples include citrus tristeza virus and zucchini yellow mosaic virus, and more recently, pepino mosaic virus (PepMV). PepMV is a pandemic virus affecting tomato crops worldwide. During the first decade of the current century, a number of mild PepMV isolates useful in cross‐protection were identified and characterized. Soon after, cross‐protection programs against PepMV were implemented in the Netherlands, Belgium, Morocco, and Spain. These programs were easily adopted by farmers, as no other efficient control methods were available and the losses caused by PepMV were unbearable for tomato producers. PepMV cross‐protection has been working exceedingly well during this time, although the potential interaction of the PepMV mild isolates with the recently emerging tomato brown rugose fruit virus (ToBRFV) may be threatening its viability. In this review, we describe our experience in deploying cross‐protection against PepMV in Spain. In our view, this is an underexploited technology that holds promise, but when it is used and how it is used requires careful thinking and preparation, as not all situations are as favourable for the use of cross‐protection as the PepMV pandemic has been. [ABSTRACT FROM AUTHOR]

Aphids affect citrus by causing leaf deformations and reducing fruit production. Additionally, aphids are a great concern due to their ability to transmit Citrus tristeza virus (CTV), the cause of tristeza, one of the main citrus diseases. In the last four years, citrus orchards in the south of Portugal (Algarve region) were sampled for aphid species identification and counting. Aphis spiraecola was the most abundant species, representing more than 80% of all identified aphids, and the damage (leaf deformation) it causes was directly proportional to its density. A. gossypii was the second most common species, followed by A. aurantii and Macrosiphum euphorbiae. The number of aphids in nymph stages was predominant over the adult stages (both wingless and winged) in all species. A. citricidus, the most efficient CTV vector, was not detected. The largest populations of A. spiraecola were observed in lemon and orange trees during spring (>100 individuals per shoot), with great damage observed in orange, lemon, and mandarin trees. A. gossypii was observed mainly in mandarin and tangor trees. There was a low activity of natural biological control agents, with the parasitism of A. spiraecola by Lysiphlebus spp. and Binodoxys spp. ranging from 0.3 to 1.5%. The numerical ratio ranged from 150 to 440 aphids per predator, and among these, syrphids were the most abundant, followed by lacewings and coccinellids (Scymnus). [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is found worldwide wherever citrus is cultivated, causing Citrus tristeza disease resulting in significant yield losses and sometimes the death of the plant. Transgenic citrus plants encoding CTV gene sequences have shown to exhibit pathogen-derived resistance to CTV. Exogenous application of double-stranded RNA (dsRNA) is an established strategy for plant virus control, making this method an attractive alternative to transgenic RNA interference (RNAi). The dsRNA molecules targeting the CP, p20, and p23 genes of CTV G8 strain were synthesized in vitro and topically applied onto the leaves of sweet orange (Citrus sinensis) infected with CTV strain G8. The exogenous application of all the dsRNAs reduced CTV titer at 10 days post application (dpa) as revealed by quantitative RT-PCR assay done at four different time points. These results provide a proof-of-concept for a non-transgenic approach of controlling CTV, a closterovirus, in a perennial fruit crop such as citrus. [ABSTRACT FROM AUTHOR]

Diaphorina citri , also known as the Asian citrus psyllid, is the main vector of ' Candidatus Liberibacter asiaticus ' (CLas) associated with citrus Huanglongbing. It has been reported that D. citri could also be infected by Citrus tristeza virus (CTV), a virus that has been previously reported to be vectored by certain aphid species. In this study, the CTV and CLas profiles in different organs, color variants, developmental stages, or sexes of D. citri insects were analyzed. Although no significant differences were found between nymphs and adults in CTV titers, we found that the third instar nymph of D. citri was more efficient in CTV and CLas acquisition compared to the fourth and fifth instars and adults. With the instars of D. citri development, the relationship between the acquiring of CTV and CLas by D. citri seemed to follow an inverse trend, with the titer of CLas increased and the titer of CTV decreased. No significant differences were observed between the 2 sexes of D. citri in acquiring either CTV or CLas titers in the field. However, no differences were drawn among the 3 color morph variants for CTV titers. CTV titers in the midguts of adult D. citri were significantly higher than those in the salivary glands. Both CTV-positive incidence and CTV titers in the midguts of adult D. citri increased with increasing exposure periods. This study provides new data to deepen our understanding of the CTV-involved interaction between D. citri and CLas. [ABSTRACT FROM AUTHOR]

Citrus crop in Chlef valley showed many cases of decline and other typical symptoms of tristeza disease in old and young trees grafted on various rootstock and seedlings acquired from multiple origins in the valley. In order to decipher the reasons of the this citrus quick decline syndrome, a large scale survey of citrus tristeza virus (CTV) and its aphid vectors was carried out from the spring of 2016 to the autumn of 2019 in order to evaluate its current situation in term of distribution and strains. Samples collected from 93 orchards located in 21 localities were tested by DTBIA/DAS-ELISA. The analyses have confirmed the presence of CTV in 54 samples through the study area. Some of the CTV sources were chosen for further molecular genotype characterization associated with the CTV isolates now spreading in the Chlef area. Characterization with multiple molecular markers M.M.M.s and CP gene sequencing showed the presence of the T30 and VT genotypes. This result allowed confirmation of the presence of a virulent strain belonging to the VT genotype. The other CTV isolates were close to those recorded in Mitidja region, with nucleotide identity of 98,6 to 99,1% with the worldwide T30 mild CTV isolates. This early finding of a strain belonging to the severe VT genotype beside to efficient aphid vectors is an issue for Algerian citrus producers and needs rapid actions to be taken by the National phytosanitary services, extending the surveillance to other citrus production regions and uprooting the infected trees. [ABSTRACT FROM AUTHOR]

Citrus is one of the most genetically diverse fruit trees used by humans, and yet few rootstock breeders have ventured beyond a narrow range of parents. For the last 25 years we have explored wider graft and sexual compatibility within the citrus subfamily (Aurantioideae) than any previous attempts, and have identified new genera and species for rootstock breeding. Whilst the vast majority of this work has met with failure, it has identified factors such as sexual incompatibility, late-acting lethality and poor field adaptation as the reasons why many citrus relatives are not currently amenable to rootstock breeding. A major breakthrough early in the program was the discovery that Oceania citrus species are extremely sensitive to Citrus tristeza virus (CTV) when used as rootstocks, and the realisation that resistance must be introgressed if we are to ever discover useful traits masked by this disease sensitivity. Bridging hybrids were required to transfer this virus resistance and a newly discovered species (Citrus wakonai) was employed to speed-up the process. After three generations of crossing, our "extreme hybrids" with Oceania parentage now show commercial performance equivalent to industry standards. By providing citrus growers with a range of high-performance rootstocks from extremely complex genetic backgrounds we can increase the biological diversity of orchards without compromising production. Our hope is that these "extreme hybrids" may help in the battle against Huanglongbing (HLB) disease. [ABSTRACT FROM AUTHOR]

Abstract Background Citrus tristeza virus (CTV) is one of the most serious threats to the citrus industry, and is present in both wild and cultivated citrus. The origin and dispersal patterns of CTV is still poorly understood in China. Methods In this study, 524 CTV suspected citrus samples from China were collected, including 354 cultivated citrus samples and 174 wild citrus samples. Finally, 126 CTV coat protein sequences were obtained with time-stamped from 10 citrus origins in China. Bayesian phylodynamic inference were performed for CTV origin and dispersal patterns study in China. Result We found that CTV was mainly distributed in southern and coastal areas of China. The substitution rate of CTV was 4.70 × 10− 4 subs/site/year (95% credibility interval: 1.10 × 10− 4 subs/site/year ~ 9.10 × 10− 4 subs/site/year), with a slight increasing trend in CTV populations between 1990 and 2006. The CTV isolates in China shared a most common recent ancestor around 1875 (95% credibility interval: 1676.57 ~ 1961.02). The CTV in China was originated from wild citrus in Hunan and Jiangxi, and then spread from the wild citrus to cultivated citrus in the growing regions of Sichuan, Chongqing, Hubei, Fujian, Zhejiang, Guangxi and Guangdong provinces. Conclusions This study has proved that CTV in China was originated from wild citrus in Hunan and Jiangxi. The spatial-temporal distribution and dispersal patterns has uncovered the population and pandemic history of CTV, providing hints toward a better understanding of the spread and origin of CTV in China.

Citrus tristeza virus (CTV) is a globally pervasive and economically significant virus that negatively impacts citrus trees, leading to substantial reductions in fruit yield. CTV occurs within the phloem of infected plants, causing a range of disease phenotypes, such as stem pitting (SP), quick decline (QD), and other detrimental diseases. Research on CTV is challenging due to the large size of its RNA genome and the diversity of CTV populations. Comparative genomic analyses have uncovered genetic diversity in multiple regions of CTV isolates’ genomes, facilitating the classification of the virus into distinct genotypes. Despite these challenges, notable advancements have been made in identifying and controlling CTV strains through serological and molecular methods. The following review concentrates on the techniques of nucleic acid identification and serological analysis for various CTV isolates, assisting in the comparison and evaluation of various detection methods, which are crucial for the effective management of CTV diseases, and so contributes to the innovation and development of CTV detection methods.

Diploid Citrus × Poncirus hybrids have significantly contributed to citrus rootstock evaluation. In Türkiye, common sour orange rootstock is used in many different climates and soil conditions at almost 85% of citrus plantations, but this rootstock is susceptible to Citrus tristeza virus disease. This study was conducted to improve new rootstock genotypes by traditional hybridization. Common sour orange (CSO) and Common mandarin (Citrus deliciosa Ten.) (CM) were crossed with Troyer citrange (TC) while King mandarin (KM) was crossed with Carrizo citrange (CC). Embryos obtained from crosses were taken on 110, 120 and 130 days after artificial pollination (DAP), and were germinated on MT culture media. The embryos of 120 DAP of combinations had the highest germination rate within CSO×TC, 95.15%; CM×TC, 96.25%; KM×CC, 95.23%. The trifoliate rates for each combination at subculture (CSO×TC, 17.40%; CM×TC, 11.11%; KM×CC; 6.17%) were obtained from 110 DAP embryos. Survival rates of the genotypes were ranged between 72.13% and 90.28% in subculture and varied from 40.17% and 64.71% in the greenhouse. As a result of the ploidy analysis by flow cytometry, the nuclear DNA content of diploid genotypes were found between 0.78 pg/2C and 0.93 pg/2C. One of the genotypes derived from CM×TC hybridization on 120 DAP was determinated as a triploid plant. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is one of the most destructive diseases affecting citrus and is a major cause of reductions in citrus yield. CTV epidemics have caused the death of millions of citrus trees globally. The present study aims to evaluate citrus cultivars against CTV and its vector (aphid) population. The highest levels of infection and vector population were recorded in Mangal Singh, whereas the lowest were found in the early fruiter (20%). Early fruiter had a maximum level of tolerance against Citrus tristeza virus. CTV is replicated in the phloem cells of plants and is transmitted by the aphid specie Aphis gossypii. Thus, the maximum vector population mirrors the highest infection. Chemical plant nutrients, including micro-mix (Zn, Fe, Cu, Mn), NPK, zinc, and the insecticide Lufenoron, were used to limit the impact of CTV and A.gossyii. Lufenuron caused maximum disease inhibition, followed by the plant nutrients zinc, NPK, and micro-mix, respectively. However, Lufenoron significantly decreased the population of Aphis gossypi. The results indicate that the early fruiter has the lowest percent disease index and vector population. Moreover, Lufenuron is the best solution for controlling vector population and disease inhibition. [ABSTRACT FROM AUTHOR]

"Candidatus Liberibacter asiaticus" (CLas) is a notorious agent that causes Citrus Huanglongbing (HLB), which is transmitted by Diaphorina citri (D. citri). We recently found that the acquisition and transmission of CLas by D. citri was facilitated by Citrus tristeza virus (CTV), a widely distributed virus in the field. In this study, we further studied whether different CTV strains manipulate the host preference of D. citri, and whether endosymbionts variation is related to CTV strains in D. citri. The results showed that the non-viruliferous D. citri preferred to select the shoots infected with CTV, without strain differences was observed in the selection. However, the viruliferous D. citri prefered to select the mixed strain that is similar to the field's. Furthermore, D. citri effectively acquired the CTV within 2-12 h depending on the strains of the virus. The persistence period of CTV in D. citri was longer than 24 days, without reduction of the CTV titers being observed. These results provide a foundation for understanding the transmission mode of D. citri on CTV. During the process of CTV acquisition and persistence, the titers of main endosymbionts in D. citri showed similar variation trend, but their relative titers were different at different time points. The titers of the "Candidatus Profftella armatura" and CTV tended to be positively correlated, and the titers of Wolbachia and "Candidatus Carsonella ruddii" were mostly negatively related with titers of CT31. These results showed the relationship among D. citri, endosymbionts, and CTV and provided useful information for further research on the interactions between D. citri and CLas, which may benefit the development of approaches for the prevention of CLas transmission and control of citrus HLB. [ABSTRACT FROM AUTHOR]

The control of tristeza quick decline (QD) of citrus is based on the use of rootstocks that are tolerant or resistant to the Citrus tristeza virus (CTV), but some of them show bio-agronomic limits. The application of cross-protection (CP) has been insufficiently explored. The present study examined the possibility of QD control by cross-protection (CP) following reports showing the dependence of the CP strategy on the close genetic relationships between the protective and challenging CTV isolates. Taking advantage of deep sequencing technologies, we located six naturally infected trees harboring no-seedling yellow (no-SY) and no QD decline (mild) VT isolates and used these for challenge inoculation with three QD VT isolates. Symptom monitoring showed that all six Sicilian mild no-SY isolates, based on their genomic relatedness and mild symptoms reactions, provide effective protection against the three severe local VT isolates. The differences between the six mild and three severe isolates were confined to just a few nucleotide variations conserved in eight positions of three CTV genes (p23, p33, and Orf1a). These results confirm that the superinfection exclusion (SIE mechanism) depends on close genetic relatedness between the protective and challenging severe VT strain isolates. Ten years of investigation suggest that CP could turn into an efficient strategy to contain CTV QD infections of sweet orange trees on SO rootstock. [ABSTRACT FROM AUTHOR]

Background: Citrus tristeza virus (CTV) is one of the most serious threats to the citrus industry, and is present in both wild and cultivated citrus. The origin and dispersal patterns of CTV is still poorly understood in China. Methods: In this study, 524 CTV suspected citrus samples from China were collected, including 354 cultivated citrus samples and 174 wild citrus samples. Finally, 126 CTV coat protein sequences were obtained with time-stamped from 10 citrus origins in China. Bayesian phylodynamic inference were performed for CTV origin and dispersal patterns study in China. Result: We found that CTV was mainly distributed in southern and coastal areas of China. The substitution rate of CTV was 4.70 × 10− 4 subs/site/year (95% credibility interval: 1.10 × 10− 4 subs/site/year ~ 9.10 × 10− 4 subs/site/year), with a slight increasing trend in CTV populations between 1990 and 2006. The CTV isolates in China shared a most common recent ancestor around 1875 (95% credibility interval: 1676.57 ~ 1961.02). The CTV in China was originated from wild citrus in Hunan and Jiangxi, and then spread from the wild citrus to cultivated citrus in the growing regions of Sichuan, Chongqing, Hubei, Fujian, Zhejiang, Guangxi and Guangdong provinces. Conclusions: This study has proved that CTV in China was originated from wild citrus in Hunan and Jiangxi. The spatial-temporal distribution and dispersal patterns has uncovered the population and pandemic history of CTV, providing hints toward a better understanding of the spread and origin of CTV in China. [ABSTRACT FROM AUTHOR]

Introduction Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied. Materials and Methods In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5'AAAGAAGGCGACGATGTTGT3') and CPR (5'AGCTCCGGTCCAAGAAATCTG3') designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5. Results and Discussion CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IRNorth1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively. Conclusion An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position. [ABSTRACT FROM AUTHOR]

Long noncoding RNAs (IncRNAs) are commonly defined as transcripts that lack protein-coding capacity and are longer than 200 nucleotides. Since the emergence of next-generation sequencing technologies in this century, thousands of IncRNAs have been identified from nearly all living organisms. Notably, various pathogens also express their own IncRNAs in host cells during infection. In plants, many IncRNAs exhibit dynamic expression patterns in response to environmental stimuli, including pathogen attacks. In contrast to well-established methods in identifying such IncRNAs, the current understanding of IncRNAs' functional mechanisms is in its infancy. Some IncRNAs serve as precursors for generating small RNAs or serve as target mimics to sequester functional small RNAs, which have been extensively reviewed in the literature. This review focuses on the emerging evidence supporting that certain IncRNAs function as negative or positive regulators of plant immunity. A common theme is that those regulations rely on specific interactions between IncRNAs and key regulatory proteins. Viroids as single-stranded circular noncoding RNAs provide a handle to investigate how RNA local motifs render interaction specificity between IncRNAs and regulatory proteins. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) produces the most damaging disease of citrus worldwide and is a continuous threat to the citrus industry. It is primarily spread through infected root-stock and brown citrus aphid in a semi-persistent manner. Infected trees produce small sized and poor quality fruit, and in severe cases tree dies. Sour orange rootstock is highly susceptible to CTV. Several mild and severe strains have been identified which produce from invisible-to-visible symptoms in diseased plants. Existence of multiple CTV strains in nature is a challenge for CTV management. Symptomless infection in certain citrus species results in the inoculum build up and further spread of the disease. Breeding for CTV resistance genes is a long and time-consuming process that takes 8-10 years before a CTV resistant variety is developed. Genomic manipulation of CTV genome is challenging due to its larger genome size. Modern biotechnological tools can be used to control this disease and to prevent its spread in the future. However, CTV offers a valuable research tool for its role as a stable marker in genetic transformation of plants. This review highlights the challenges in developing resistant citrus cultivars against CTV and future prospects of CTV and is an update to the research status of CTV. [ABSTRACT FROM AUTHOR]

This study aims to determine the composition of the essential oil of Pistacia lentiscus leaves by gas chromatographymass spectrometry (GC/MS) and to test its insecticidal activity against the larvae of Aphis spiraecola, which represents a serious threat to citrus production and cause most economic loss for the citrus culture. The essential oil of lentisk leaves was isolated by hydrodistillation using a Clevenger-type, the chemical composition was determined by GC/MS. The insecticidal activity of essential oil was determined by using the contact method against A. spiraecola larvae. A total of 74 compounds were identified, corresponding to chromatographic peaks representing 89.6% of the total area of all peaks. The most abundant compounds were monoterpene hydrocarbons (54.2%) with 8.8% p-cymene and 7.2% a-pinene. The insecticidal assay revealed an interesting insecticidal activity against the larvae of A. spiraecola with an LD50 of 0.2 µL. This study introduces and supports the use of the essential oil of P. lentiscus as a biopesticide and open new ways for its future exploitation in phytosanitary industries. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is a virus that already caused great losses in citrus producing regions. The cell wall of plant cells plays an important role in the defence response to viruses. Following several studies indicating that cell wall enzyme transcripts of callose synthase 7 (calS7) and xyloglucan endotransglucosylase 9 (xth9) are modified during a viral infection, transcript expression of calS7 isoform x5 (calS7x5) and xth9 was evaluated over time in Citrus × sinensis 'Valencia Late' (VL) and Citrus × clementina 'Fina' (CL), infected with the severe CTV isolate T318A, by quantitative (q) PCR. qPCR analysis of healthy and CTV infected citrus was performed at 15 days, 10 months and at 31 months post-inoculation (dpi/mpi), respectively. The CTV titer, evaluated at the three time-points by qPCR, increased over time in bark tissues, with VL plants exhibiting a titer about 5 times higher than CL 31 mpi. CTV infection did not cause significant changes in calS7x5 gene expression over time in both citrus cultivars. However, CTV infection was associated with significant up-regulation of xth9 in VL compared to controls 31 mpi. This study highlights that CTV infection can affect the expression of specific cell wall-associated genes over time and that this influence was distinct for VL and CL. This study provides further insight into the CTV-citrus host interaction, with the long-term response of VL to a severe CTV isolate involving a high expression of the xth9 gene. [ABSTRACT FROM AUTHOR]

A synoptic review of plant disease epidemics and outbreaks was made using two complementary approaches. The first approach involved reviewing scientific literature published in 2021. in which quantitative data related to new plant disease epidemics or outbreaks were obtained via surveys or similar methodologies. The second approach involved retrieving new records added in 2021 to the CABI Distribution Database. which contains over a million global geographic records of organisms from over 50,000 species. The literature review retrieved 186 articles. describing studies in 62 categories (pathogen species/species complexes) across more than 40 host species on six continents. Pathogen species with more than five articles were Bursaphelenchus xylophilus, 'Candidatus Liberibacter asiaticus', cassava mosaic viruses, citrus tristeza viruses, Erwinia amylovora, Fusarium spp. complexes. F oxysporum f. sp. cubense. Magnaporthe oryzae. maize lethal necrosis co-infecting viruses, Meloidogyne spp. complexes, Pseudomonas Syringae pvs., Puccinia striiformis f. sp. tritici. Xylella fastidiosa, and Zymoseptoria tritici. Automated searches of the CABI Distribution Database identified 617 distribution records new in 2021 of 283 plant pathogens. A further manual review of these records confirmed 15 pathogens reported in new locations: apple haminerhead viroid, apple rubbery wood viruses, Aphelenchoides besseyi. Biscognictuxia mediterranea, ' Ca. Liberibacter asiaticus', citrus tristeza virus, Colletotrichum siamense, cucurbit chlorotic yellows virus, Erwinia rhapontici, Erysiphe corylacearum, F. oxysporum f. sp. cubense Tropical race 4, Globodera roslochiensis. Nothophonia quercina, potato spindle tuber viroid, and tomato brown rugose fruit virus. Of these, four pathogens had at least 25% of all records reported in 2021. We assessed two of these pathogens-tomato brown rugose fruit virus and cucurbit chlorotic yellows virus-to be actively emerging in/spreading to new locations. Although three important pathogens-'Ca. Liberibacter asiaticus', citrus tristeza virus, and E oxysporum f. sp. cubense-were represented in the results of both our literature review and our interrogation of the CABI Distribution Database, in general. our dual approaches reveajed distinct sets of plant disease outbreaks and new records, with little overlap. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is one of the economically destructive viruses affecting citrus trees worldwide, causing significant losses in fruit production. Comparative genomic studies have shown genetic diversity in various regions of the genome of CTV isolates, which has classified the virus into several genotypes. In recent years, some orange citrumelo-tolerant rootstocks showed yellowing, decline, and vein clearing in northern Iran (Mazandaran province, Sari). We confirmed the presence of CTV in the symptomatic trees by reverse transcription PCR (RT-PCR). The complete genome of a Sari isolate of CTV (Sari isolate) was sequenced using next-generation sequencing (NGS) technology. In addition, phylogenetic analysis, differential gene expression of the virus and identification of its variants in a population were studied. We obtained the final contigs of the virus (nt) and annotated all genomes to viral ORFs, untranslated regions (UTRs), intergenic regions, and 5' and 3' ends of the genome. Phylogenetic analysis of the Sari isolate and other genotypes of CTV showed that the Sari isolates were placed in a distinct cluster without a sister group. Based on the number of specific transcripts (TPM) in CTV RNA -Seq, P13 was the most highly expressed gene related to the host range of the virus and its systemic infection. The ORFs of the polyprotein, P33, and P18 showed variation in a single population of the sari isolate. The CTV has a potential for variation in a population in a host, and these variations may contribute to the best fit of the CTV in different situations. In Iran, whole genome sequencing of the CTV was performed for the first time, and we gained new insights into CTV variation in a population. [ABSTRACT FROM AUTHOR]

The citrus systemic diseases, including citrus Huanglongbing (caused by Candidatus Liberibacter asiaticus (CLas)), citrus tristeza (caused by citrus tristeza virus (CTV)), citrus tatter leaf (caused by citrus tatter leaf virus (CTLV)), and citrus exocortis (caused by citrus exocortis viroid (CEVd)), are threats to citrus production in Taiwan. Reliable diagnostic methods are important for the management of these systemic diseases. In this study, we developed a multiplex reverse transcription–polymerase chain reaction (RT-PCR) assay to detect four pathogens simultaneously. Herein, the specific amplicons from each pathogen (295 bp for CLas, 468 bp for CTV, 120 bp for CTLV, and 196 bp for CEVd) were successfully produced using the optimized multiplex RT-PCR described here. The sensitivity evaluation showed that low titers of pathogens could be detected using this multiplex RT-PCR. Compared with the published simplex assays, the detection of field samples using the multiplex RT-PCR developed in this study showed a better performance. The detections using multiplex RT-PCR revealed that these four citrus systemic pathogens were commonly found in fields, and 30.0% of field samples were mix-infected. To our knowledge, this is the first study of a survey of the four important citrus systemic diseases in Taiwan, and it provides insights for improving disease management. Therefore, the multiplex RT-PCR assay provides a useful method for routine disease surveying and the production of pathogen-free citrus plants. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV, family Closteroviridae) is an economically important pathogen of citrus. CTV resides in the phloem of the infected plants and induces a range of disease phenotypes, including stem pitting and quick decline as well as a number of other deleterious syndromes. To uncover the biological processes underlying the poorly understood damaging symptoms of CTV, we profiled the transcriptome of sweet orange (Citrus sinensis) phloem-rich bark tissues of non-infected, mock-inoculated trees and trees singly infected with two distinct variants of CTV, T36 or T68-1. The T36 and T68-1 variants accumulated in the infected plants at similar titers. With that, young trees infected with T68-1 were markedly repressed in growth, while the growth rate of the trees infected with T36 was comparable to the mock-inoculated trees. Only a small number of differentially expressed genes (DEGs) were identified in the nearly asymptomatic T36-infected trees, whereas almost fourfold the number of DEGs were identified with the growth-restricting T68-1 infection. DEGs were validated using quantitative reverse transcription-PCR. While T36 did not induce many noteworthy changes, T68-1 altered the expression of numerous host mRNAs encoding proteins within significant biological pathways, including immunity and stress response proteins, papain-like cysteine proteases (PLCPs), cell-wall modifying enzymes, vascular development proteins and others. The transcriptomic alterations in the T68-1- infected trees, in particular, the strong and persistent increase in the expression levels of PLCPs, appear to contribute to the observed stem growth repression. On the other hand, analysis of the viral small interfering RNAs revealed that the host RNA silencing-based response to the infection by T36 and that by T68-1 was comparable, and thus, the induction of this antiviral mechanism may not contribute to the difference in the observed symptoms. The DEGs identified in this study promote our understanding of the underlying mechanisms of the yet unexplained growth repression induced by severe CTV isolates in sweet orange trees. [ABSTRACT FROM AUTHOR]

Diaphorina citri Kuwayama (D. citri) is an insect vector of phloem-limited 'Candidatus Liberibacter asiatus' (CLas), the presumed pathogen of citrus Huanglongbing (HLB). Recently, our lab has preliminarily found it acquired and transmitted Citrus tristeza virus (CTV), which was previously suggested to be vectored by species of aphids. However, the influences of one of the pathogens on the acquisition and transmission efficiency of the other pathogen remain unknown. In this study, CLas and CTV acquisition and transmission by D. citri at different development stages under field and laboratory conditions were determined. CTV could be detected from the nymphs, adults, and honeydew of D. citri but not from the eggs and exuviates of them. CLas in plants might inhibit CTV acquisition by D. citri as lower CTV–positive rates and CTV titers were detected in D. citri collected from HLB-affected trees compared to those from CLas–free trees. D. citri were more likely to obtain CTV than CLas from host plants co-infected with the two pathogens. Intriguingly, CTV in D. citri facilitated the acquisition and transmission of CLas, but CLas carried by D. citri had no significant effect on the transmission of CTV by the same vector. Molecular detection and microscopy methods confirmed the enrichment of CTV in the midgut after a 72-h acquisition access period. Collectively, these results raise essential scientific questions for further research on the molecular mechanism of pathogen transmission by D. citri and provide new ideas for the comprehensive prevention and control of HLB and CTV. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is efficiently transmitted in a semi-persistent manner by the brown citrus aphid (Toxoptera citricida (Kirkaldy)). Currently, the most sensitive method for detecting plant viruses in insect vectors is reverse-transcription quantitative polymerase chain reaction (RT-qPCR). In this study, the elongation factor-1 alpha (EF-1α) gene and acidic p0 ribosomal protein (RPAP0) gene were confirmed to be suitable reference genes for RT-qPCR normalization in viruliferous T. citricida aphids using the geNorm, NormFinder, and BestKeeper tools. Then the relative CTV titer in aphids (T. citricida) at different post-acquisition feeding times on healthy plants was quantified by RT-qPCR using EF-1α and RPAP0 as reference genes. The relative CTV titer retained in the aphids gradually decreased with increasing feeding time. During the first 0.5 h of feeding time on healthy plants, the remaining CTV titer in aphids showed about 80% rapid loss for the highly transmissible isolate CT11A and 40% loss for the poorly transmissible isolate CTLJ. The relative CTV titer in aphids during more than 12 h post-acquisition times for CT11A was significantly lower than at the other feeding times, which is similar to the trend found for CTLJ. To our knowledge, this is the first report about the relative titer variation of CTV remaining in T. citricida at different post-acquisition feeding times on healthy plants.

Susceptibility to the severe Citrus tristeza virus (CTV), T36, is higher for Citrus macrophylla (CM) than for C. aurantium (CA). How host-virus interactions are reflected in host physiology is largely unknown. In this study, the profile of metabolites and the antioxidant activity in the phloem sap of healthy and infected CA and CM plants were evaluated. The phloem sap of quick decline (T36) and stem pitting (T318A) infected citrus, and control plants was collected by centrifugation, and the enzymes and metabolites analyzed. The activity of the antioxidant enzymes, superoxide dismutase (SOD) and catalase (CAT), in infected plants increased significantly in CM and decreased in CA, compared to the healthy controls. Using LC-HRMS2 a metabolic profile rich in secondary metabolites was assigned to healthy CA, compared to healthy CM. CTV infection of CA caused a drastic reduction in secondary metabolites, but not in CM. In conclusion, CA and CM have a different response to severe CTV isolates and we propose that the low susceptibility of CA to T36 may be related to the interaction of the virus with the host's metabolism, which reduces significantly the synthesis of flavonoids and antioxidant enzyme activity. [ABSTRACT FROM AUTHOR]

Viroids represent a threat to the citrus industry and also display an intricate matter for citrus tristeza virus (CTV) control as most of the commercial citrus rootstocks that are resistant/tolerant to CTV appear to be highly susceptible to viroid infection. Therefore, a detailed knowledge of the viroid's incidence and distribution, along with the assessment of unexplored epidemiological factors leading to their occurrence, are necessary to further improve control measures. Herein, a large-scale epidemiological study of citrus viroids in five districts, 38 locations and 145 fields in Greece is presented, based on the analysis of 3005 samples collected from 29 cultivars of six citrus species. We monitored the occurrence of citrus exocortis (CEVd), hop stunt (HSVd), citrus dwarfing (CDVd), citrus bark cracking (CBCVd), and citrus bent leaf (CBLVd) viroids, and addressed their epidemiological patterns and factors shaping their population structure. Our results show a high frequency and wide distribution of four viroids in all areas and in almost all hosts, whereas CBLVd occurrence was restricted to Crete. Mixed infections were found in all districts in which a wide spread of viroids was observed. We identified a potential pathogens' different preferences that could be partially explained by the host and cultivar, including the type of infection (single or mixed) and the number of viroids in the mixed infections. Overall, this work provides the first detailed epidemiological study on citrus viroids, enriching our knowledge for the implementation, production, and distribution of certified citrus propagative material, and the development of sustainable control strategies. [ABSTRACT FROM AUTHOR]

Citrus Tristeza Virus (CTV), usually occurs in nature as a mixture of genotypes. Six naturally infected citrus (Citrus sinensis) trees grafted on sour orange rootstock were collected from three citrus growing governorates in Egypt (Sharqia, Qalyubia and Garbia). In this study, RT-PCR, Single-Strand Conformation Polymorphism (SSCP) and nucleotide sequence analysis were used for four independent CTV genomic regions (p65, p18, p20, and p23) to detect and assess the sequence and genetic variabilities among CTV Egyptian isolates. RTPCR products (650 bp) for the CTV p23 gene obtained from the selected isolates were used for the SSCP analysis and DNA sequencing. SSCP patterns of p23 gene for individual isolates yielded different complex haplotype patterns. Nucleotide sequence analysis of p23 region amplified from six isolates under study revealed that p23 shared high nucleotide identity 98.7% with T36 isolate from USA, Florida. Phylogenetic analysis of p23 gene indicated a close evolutionary relationship between all examined isolates and Qaha isolate (T36 isolate group), suggesting that they may have originated from closely related ancestors. Nucleotide sequence analysis of the three genes located on CTV 3'-coterminal overhang, p18, p20 and p65, amplified from isolate A3, Sharqia governorate, revealed that the p18, p65, and p20 genes were related to the T3-KB isolate from South Africa with 99%-100% sequence homology. Phylogenetic relationship analysis for p65, p18 and p20 ORFs clustered the current A3 isolate with T3 genotype group. The recombination analysis identified three of six isolates from Sharqia, and Garbia as potential recombinant for p23 gene. The isolates T36 and T3 were identified as major donors for recombination events in isolate A3. Our results concluded that p23 ORF likely to be as a hotspot region for recombination and originated through recombination event. The current study indicated that recombination is an important factor for the origin of CTV strains in Egypt. [ABSTRACT FROM AUTHOR]

This study reports a simple template-based reverse transcription-polymerase amplification assay (ST-RT-RPA) for detection of citrus tristeza virus (CTV) from crude plant extract lysed in NaOH:EDTA (1:1) without the need of tedious RNA isolation. The developed assay showed versatility in its usage as amplification can be performed at wide temperature range (14°C to 42°C) and incubation time (4 to 32 min), although the best conditions were 38°C for 30 min. The developed ST-RT-RPA assay could detect the CTV up to 10−8 dilution of crude plant extract of NaOH:EDTA and up to 0.01 fg µl−1 of RNA of CTV-infected plant tissues and 0.001 ag µl−1 of plasmid DNA containing viral insert, thus exhibiting sufficient sensitivity. ST-RT-RPA assay showed high specificity without any cross-reaction with other citrus pathogens (Indian citrus ringspot virus, citrus yellow mosaic virus, citrus yellow vein clearing virus, and Candidatus Liberibacter asiaticus) and was more sensitive in detection of CTV infection in field samples as compared to standard reverse transcription-polymerase chain reaction (RT-PCR) with later showing false negative in 7.92% of samples tested after 1 week of sampling. The developed ST-RT-RPA assay used minimally processed crude plant extract as template, tolerant to sample degradation in transit and storage, while it can be easily performed at wide temperatures and could be adopted in resource-poor setup. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV, family Closteroviridae) is an economically important pathogen of citrus. CTV resides in the phloem of the infected plants and induces a range of disease phenotypes, including stem pitting and quick decline as well as a number of other deleterious syndromes. To uncover the biological processes underlying the poorly understood damaging symptoms of CTV, we profiled the transcriptome of sweet orange (Citrus sinensis) phloem-rich bark tissues of non-infected, mock-inoculated trees and trees singly infected with two distinct variants of CTV, T36 or T68-1. The T36 and T68-1 variants accumulated in the infected plants at similar titers. With that, young trees infected with T68-1 were markedly repressed in growth, while the growth rate of the trees infected with T36 was comparable to the mock-inoculated trees. Only a small number of differentially expressed genes (DEGs) were identified in the nearly asymptomatic T36-infected trees, whereas almost fourfold the number of DEGs were identified with the growth-restricting T68-1 infection. DEGs were validated using quantitative reverse transcription-PCR. While T36 did not induce many noteworthy changes, T68-1 altered the expression of numerous host mRNAs encoding proteins within significant biological pathways, including immunity and stress response proteins, papain-like cysteine proteases (PLCPs), cell-wall modifying enzymes, vascular development proteins and others. The transcriptomic alterations in the T68-1-infected trees, in particular, the strong and persistent increase in the expression levels of PLCPs, appear to contribute to the observed stem growth repression. On the other hand, analysis of the viral small interfering RNAs revealed that the host RNA silencing-based response to the infection by T36 and that by T68-1 was comparable, and thus, the induction of this antiviral mechanism may not contribute to the difference in the observed symptoms. The DEGs identified in this study promote our understanding of the underlying mechanisms of the yet unexplained growth repression induced by severe CTV isolates in sweet orange trees.

Citrus tristeza virus (CTV), a member of the aphid-transmitted closterovirus group, is the causal agent of the notorious tristeza disease in several citrus species worldwide. The codon usage patterns of viruses reflect the evolutionary changes for optimization of their survival and adaptation in their fitness to the external environment and the hosts. The codon usage adaptation of CTV to specific citrus hosts remains to be studied; thus, its role in CTV evolution is not clearly comprehended. Therefore, to better explain the host⁻virus interaction and evolutionary history of CTV, the codon usage patterns of the coat protein (CP) genes of 122 CTV isolates originating from three economically important citrus hosts (55 isolate from Citrus sinensis, 38 from C. reticulata, and 29 from C. aurantifolia) were studied using several codon usage indices and multivariate statistical methods. The present study shows that CTV displays low codon usage bias (CUB) and higher genomic stability. Neutrality plot and relative synonymous codon usage analyses revealed that the overall influence of natural selection was more profound than that of mutation pressure in shaping the CUB of CTV. The contribution of high-frequency codon analysis and codon adaptation index value show that CTV has host-specific codon usage patterns, resulting in higheradaptability of CTV isolates originating from C. reticulata (Cr-CTV), and low adaptability in the isolates originating from C. aurantifolia (Ca-CTV) and C. sinensis (Cs-CTV). The combination of codon analysis of CTV with citrus genealogy suggests that CTV evolved in C. reticulata or other Citrus progenitors. The outcome of the study enhances the understanding of the factors involved in viral adaptation, evolution, and fitness toward their hosts. This information will definitely help devise better management strategies of CTV.

Tristeza disease is caused by citrus tristeza virus (CTV) expresses salient symptoms like stem pitting, yellowing of leaves, stunted growth of large, small lateral branches and twigs. The study was carried out to quantify the spatial and temporal distribution of CTV disease in major citrus growing areas of Sargodha district (Sargodha, Kot Momin, and Bhalwal). The samples from the declined orchards were collected based on symptomology and confirmed through ELISA. CTV was detected in 3 varieties viz., Kinnow (Citrus reticulate), Mosambi (Citrus sinensis) and Feutrell's early (Citrus reticulate cv feutrell's early). The maximum disease incidence was recorded in Mosambi (90%), followed by Feutral's early (74%) and Kinnow (57%). Mosambi was the most susceptible within the range of OD values (0.82-2.35) followed by Feutrell's early (0.45-0.64) and Kinnow (0.25-0.56). The disease severity was recorded only on Mosambi as it was more affected than Feutral's early and Kinnow. The rating scale to observe the severity of tristeza disease was based on percentage of pits in the 1 sq. inch piece of bark at bud union of infected tree. This rating scale has been developed for the first time to record the tristeza disease severity. The maximum disease severity was recorded in Kot Momin (62%) followed by Bhalwal (56%) and Sargodha (50%). The study concluded that CTV is one of the most promising factors playing role in the citrus decline. [ABSTRACT FROM AUTHOR]

The citrus tristeza virus (CTV) is an agent of devastating epidemics of the citrus plant grafted on Citrus aurantium, one of the main rootstocks still used in the Mediterranean area. Consequently, CTV-tolerant alternative citrus rootstocks are considered necessary to manage this disease and/or its vector; that in Mediterranean countries is the aphid Aphis gossypii. In this study, we analyzed the VOCs emitted from Citrus sinensis plants grafted on the CTV-susceptible C. aurantium and on the CTV-tolerant Volkamer lemon, Forner-Alcaide no. 5, and Carrizo citrange. Furthermore, the aphid preference/avoidance response toward these combinations was evaluated in a semi-field experiment. The VOC profiles recorded on the leaves of C. sinensis grafted on the four rootstocks listed above showed significant differences in the abundances and ratios of the compounds emitted. The behavioral experiments indicated that A. gossypii prefers to orient and establish on the C. sinensis plants grafted on C. aurantium rather than on that grafted on the three CTV-tolerant varieties. The possibility that this avoidance mechanism is triggered by the different profile of the VOC emitted by the different combinations and the consequent susceptibility/tolerance shown toward CTV is discussed. [ABSTRACT FROM AUTHOR]

The citrus industry of Florida faces insurmountable challenges against the destructive diseases citrus tristeza and Huanglongbing (HLB, or citrus greening). Though the tristeza causal agent, citrus tristeza virus (CTV), has been in Florida decades longer than HLB, growers have concentrated most of their efforts on combating the more detrimental HLB. The Asian citrus psyllid (Diaphorina citri; ACP) is the insect vector of the bacterial pathogen Candidatus Liberibacter asiaticus and transmits the incurable HLB to all commercial citrus. During our searches for biological and viral controls against the ACP, we consistently detected sequences of CTV in Florida field populations of ACP. This unexpected finding led us to investigate whether ACPs collected from young shoots could be used as a tool to survey CTV in Florida citrus groves. We first surveyed for the most common CTV strains in Florida (T30, T36, and VT/T68) in citrus trees on mostly sour orange (Citrus aurantium) rootstock, the rootstock susceptible to CTV decline. Out of 968 trees sampled across five years (2018-2022), approximately 8.2% were positive for CTV, with more than half of the CTV-positive trees infected with strain T30. Simultaneously, we looked at CTV strains in ACPs during this time and found that approximately 88% of pooled adult and nymph ACPs also had CTV, with over half the positive samples having the T36 strain. As a result of the much higher CTV incidences in the ACPs, we conducted a second investigation into whether we could more easily detect the same CTV strains in ACP nymphs as in CTV-infected citrus tissue. After individually sampling 43 trees and pooling the nymphs from each tree, we detected CTV at about the same incidence in the citrus tissue and the nymphs, but with much less ACP tissue, time, and resources required for detection compared to citrus tissue. Results from this study illustrate the sustained threat of CTV to Florida citrus and demonstrate the ACP as a potential bioindicator for CTV. K [ABSTRACT FROM AUTHOR]

Strengthening Plant Health research is a major challenge for Mediterranean countries. The diversity and fragmentation of the research landscape in this region have weakened the impacts of national efforts. Mediterranean countries can benefit from coordination of research activities to increase efficiency and impacts. The initiative 'Plant health research priorities for the Mediterranean region', led by the International Centre for Advanced Mediterranean Agronomic Studies (CIHEAM Bari)1 and the Euphresco network for phytosanitary research coordination and funding2 can promote convergence of national programmes and optimize the use of the scarce funding available to plant health, thus strengthening international cooperation and increasing the excellence and relevance of research. [ABSTRACT FROM AUTHOR]

Grapefruit trees in South Africa have been cross protected against severe stem pitting genotypes of Citrus tristeza virus (CTV) since the 1920s using a mild strain initially called 'Nartia' but later referred to as grapefruitmildstrain12(GFMS12).In the current study, the GFMS12 isolate was used as the source for single aphid transmissions (SAT) using Toxoptera citricida, commonly called the brown citrus aphid (BrCA). The BrCA-transmitted CTV sub-isolates were analyzed by the heteroduplex mobility assay (HMA), serological assays, genetic marker analysis (GMA), and selected sub-isolates were biologically indexed. Reverse transcription PCR of genomic regions was conducted using universal primers followed by cloning the PCR products, HMA and sequence analysis; nine genotypes of CTV were identified in the complex of GFMS12, including both severe and mild genotypes. A single BrCA transmitted up to six CTV genotypes simultaneously in one sub-isolate. The HMA was found to be a rapid, reliable tool for the identification of genotypes and can be useful in the development of CTV management strategies and budwood certification programs. [ABSTRACT FROM AUTHOR]

Stem pitting is a complex and economically important virus-associated disease of perennial woody plants. Molecular mechanisms and pathways occurring during virus-plant interaction that result in this phenomenon are still obscure. Previous studies indicated that di_erent Citrus tristeza virus (CTV) mutants induce defined stem pitting phenotypes ranging from mild (CTVΔp13) to severe (CTVΔp33) in Citrus macrophylla trees. In this study, we conducted comparative transcriptome analyses of C. macrophylla trees infected with CTV mutants (CTVΔp13 and CTVΔp33) and a full-length virus in comparison to healthy plants as control. The mild CTV stem pitting mutant had very few differentially expressed genes (DEGs) related to plant defense mechanism and plant growth and development. In contrast, substantial gene expression changes were observed in plants infected with the severe mutant and the full-length virus, indicating that both the p13 and p33 proteins of CTV acted as a regulator of symptom production by activating and modulating plant responses, respectively. The analysis of transcriptome data for CTVΔp33 and the full-length virus suggested that xylem specification has been blocked by detecting several genes encoding xylem, cell wall and lignin degradation, and cell wall loosening enzymes. Furthermore, stem pitting was accompanied by downregulation of transcription factors involved in regulation of xylem differentiation and downregulation of some genes involved in lignin biosynthesis, showing that the xylem differentiation and specification program has been shut off. Upregulation of genes encoding transcription factors associated with phloem and cambium development indicated the activation of this program in stem pitting disease. Furthermore, we detected the induction of several DEGs encoding proteins associated with cell cycle re-entry such as chromatin remodeling factors and cyclin, and histone modification. This kind of expression pattern of genes related to xylem differentiation and specification, phloem and cambium development, and cell cycle re-entry is demonstrated during secondary vascular tissue (SVT) regeneration. The microscopy analysis confirmed that the regeneration of new phloem is associated with stem pitting phenotypes. The findings of this study, thus, provide evidence for the association between stem pitting phenotypes and SVT regeneration, suggesting that the expression of these genes might play important roles in development of stem pitting symptoms. Overall, our findings suggest that phloemregeneration contributes to development of stem pitting symptoms. [ABSTRACT FROM AUTHOR]

The δ-aminolevulinic acid dehydratase (ALAD) enzyme is an intermediate in the biosynthetic pathway of tetrapyrroles. It combines two δ‐aminolevulinic acid (δ‐ALA) molecules to form the pyrrole, porphobilinogen, an important precursor for plant pigments involved in photosynthesis, respiration, light-sensing, and nutrient uptake. Our recent efforts showed that, in citrus, silencing of ALAD gene via Citrus tristeza virus-induced gene silencing, caused yellow spots and necrosis in leaves and in developing new shoots. Silencing of ALAD gene reduced leaf pigments and altered leaf metabolites. Moreover, total phenolic content, H2O2, and reactive oxygen species (ROS) increased, indicating that silencing of ALAD induced severe stress. Herein, we hypothesized that conditions including lower sucrose, elevated ROS, alteration of microRNA involved in RNAi regulatory protein Argonaute 1 (AGO1) and ROS lead to higher deposition of callose in phloem tissues. Using aniline blue staining and gene expression analysis of callose synthases, we showed significant deposition of callose in ALAD-silenced citrus.

Virus-induced gene silencing is a promising technique for functional genomics studies. Citrus tristeza virus was employed successfully to create an infectious clone that was used to silence endogenous citrus genes. Phytoene desaturase (PDS) and delta (δ)-aminolevulinic acid dehydratase (ALAD) were targeted successfully in citrus. Silencing PDS usually results in a photo-bleached leaf phenotype while silencing ALAD causes discrete yellow spots in leaves. Silencing two or more genes simultaneously using the same infectious clone could be difficult due to the capacity of the plasmid and subsequent cloning. On the other hand, inoculating a new construct into a citrus plant pre-infected with another construct fails due to the superinfection exclusion phenomenon. Herein, I report our successful trials whereby we simultaneously graft-inoculate constructs targeting PDS and ALAD. The budwoods were graft-inoculated into the same tree but on two different branches. Interestingly, a new phenotype was produced because of the silencing of the two genes, which we called “color-breaking”. The phenotype was observed in both branches. Gene expression analysis showed a significant reduction of PDS and ALAD transcripts. This finding suggests the possibility of targeting more than one gene using different constructs, however, the graft-inoculation must be at the same time.

Grapefruit trees in South Africa have been cross protected against severe stem pitting genotypes of Citrus tristeza virus (CTV) since the 1920s using a mild strain initially called ‘Nartia’ but later referred to as grapefruit mild strain 12 (GFMS12). In the current study, the GFMS12 isolate was used as the source for single aphid transmissions (SAT) using Toxoptera citricida, commonly called the brown citrus aphid (BrCA). The BrCA-transmitted CTV sub-isolates were analyzed by the heteroduplex mobility assay (HMA), serological assays, genetic marker analysis (GMA), and selected sub-isolates were biologically indexed. Reverse transcription PCR of genomic regions was conducted using universal primers followed by cloning the PCR products, HMA and sequence analysis; nine genotypes of CTV were identified in the complex of GFMS12, including both severe and mild genotypes. A single BrCA transmitted up to six CTV genotypes simultaneously in one sub-isolate. The HMA was found to be a rapid, reliable tool for the identification of genotypes and can be useful in the development of CTV management strategies and budwood certification programs.

The article reports that the citrus is acknowledged as one of the most important perennial fruit crops. Topics include examines India is the third highest citrus producer in the world after China and Brazil; and considered citrus is grown in several countries, of which various cultivate it commercially and India contributes in the global citrus production.

The credibility of a pathogen detection assay is measured using specific parameters including repeatability, specificity, sensitivity, and reproducibility. The use of high-throughput sequencing (HTS) as a routine detection assay for viruses and viroids in citrus was previously evaluated and, in this study, the reproducibility and sensitivity of the HTS assay were assessed. To evaluate the reproducibility of HTS, the same plants assayed in a previous study were sampled again, one year later, and assessed in triplicate using the same analyses to construct the virome profile. The sensitivity of the HTS assay was compared to routinely used RT-PCR assays in a time course experiment, to compensate for natural pathogen accumulation in plants over time. The HTS pipeline applied in this study produced reproducible and comparable results to standard RT-PCR assays for the detection of CTV and three viroid species in citrus. Even though the limit of detection of HTS can be influenced by pathogen concentration, sample processing method and sequencing depth, detection with HTS was found to be either equivalent or more sensitive than RT-PCR in this study. [ABSTRACT FROM AUTHOR]

Copyright of Revista de la Universidad del Valle de Guatemala is the property of Universidad del Valle de Guatemala and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

In Bangladesh, citrus is an important fruit crop that is becoming more commonly cultivated in commercial plantations. In March 2019, we observed yellowing, vein clearing, and mild mosaic symptoms in citron (Citrus medica). Based on systematic serological and molecular analyses of the symptomatic leaf samples, the Citrus tristeza virus (CTV) was identified. To the best of our knowledge, this is the first report of CTV and any citrus virus in Bangladesh. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is the most severe viral disease for citrus production. Many strains of CTV have been characterized and their symptomology widely varies, ranging from asymptomatic or mild infections to severe symptomology that results in substantial yield loss or host death. The capacity of the different CTV strains to affect the biochemistry of different citrus species has remained largely unstudied, despite that associated metabolomic shifts would be relevant toward symptom development. Thus, amino acid, sugar, phenolic, and terpenoid levels were assessed in leaves of healthy and CTV-infected grapefruit, lemon, mandarin, and two different sweet orange cultivars. Both mild [VT-negative (VT-)] and severe [VT-positive (VT+)] CTV genotype strains were utilized. When looking at overall totals of these metabolite classes, only amino acid levels were significantly increased by infection of citrus with severe CTV strains, relative to mild CTV strains or healthy plants. No significant trends of CTV infection on summed amounts of all sugar, phenolic, or terpenoid compounds were observed. However, individual compound levels were affected by CTV infections. Subsequent canonical discriminant analysis (CDA) that utilized profiles of individual amino acids, terpenoids, or phenolics successfully distinguished leaf samples to specific citrus varieties and identified infection status with good accuracy. Collectively, this study reveals biochemical patterns associated with severity of CTV infections that can potentially be utilized to help identify in-field CTV infections of economic relevance. [ABSTRACT FROM AUTHOR]