Search

Purpose: To describe the clinical features, management, and long-term outcome of Infectious crystalline keratopathy (ICK)., Methods: The medical records of clinically diagnosed and microbiologically proven cases of ICK were reviewed from January 2011 to December 2022. Clinical characteristics include the presence of whitish needle-like projections with branching, limited to anterior-mid stroma. Keratoplasty being the most common risk factor, graft-related microbial keratitis during the same period was also studied. The demography, clinical profile, microbiology, treatment, and outcome were analyzed, and compared with secondary graft infiltrate(GI)., Results: Medical records of 24 cases with ICK were reviewed. The mean age was 49.3 ± 20.1 years, with 15(62.5%) males. Prior keratoplasty was done in 18 (75%) cases, with a mean graft size of 10.1 ± 1.5 mm, and mean interval between the last graft and presentation was 9.7 ± 6.2 (3-90) months. In comparison to GI (n = 24), ICK patients (n = 18,75%) were less symptomatic, presented late (7.3 ± 6.5 days vs 16.3 ± 19.4, p = 0.003), using frequent topical steroids (> 3 times/day, p =  0.006), smaller infiltrate size < 4 mm (p =  0.008), central (p =  0.02), less associated with epithelial defect (p =  0.0001), hypopyon (p =  of 0.0002), corneal perforation (p =  0.0006), and surgical management (p =  0.03). On microbiology, 22 (91.6%) ICK cases were culture positive, 14 (63.6%) gram-positive, 3 (13.6%) gram-negative, 2 (9%) mixed bacteria, and 3 (13.6%) fungus, comparable with GI., Conclusion: ICK affects poor ocular surfaces usually following keratoplasty with larger graft size, the use of steroids being the most common association, and it responds to medical management as compared to GI., (© 2024. The Author(s), under exclusive licence to Springer Nature B.V.)

Purpose: Although a comprehensive knowledge of antibiotic/corticosteroid combinations is essential for the appropriate treatment of eye infections, the impact of their co-administration has not been well studied to date. A systematic pharmacodynamic/pharmacokinetic study to determine the effects of cotreatment with various antibiotics and corticosteroids was conducted., Methods: Four bacterial strains, seven antibiotics, and four corticosteroids were used in the analyses. Drug interactions were evaluated by considering antibacterial effects with a checkerboard assay and intracellular concentrations in human corneal epithelial cells., Results: The drug combinations that showed the most stable effects against Pseudomonas aeruginosa was levofloxacin-prednisolone. Stable combinations against the three types of Gram-positive bacteria were neomycin-prednisolone, ofloxacin-dexamethasone, ofloxacin-prednisolone, and polymyxin-dexamethasone. The cellular concentrations were changed for the gatifloxacin-fluorometholone, moxifloxacin-fluorometholone, tobramycin-dexamethasone, and tobramycin-prednisolone combinations., Conclusions: Loteprednol and fluorometholone reduced the antibacterial effects of all of the tested antibiotics in this study. Dexamethasone and prednisolone showed various effects in this regard, depending on the co-administered antibiotic. Prior knowledge of specific antibiotic/corticosteroid interactions provides valuable information to clinical practitioners by combining data on the antibacterial and intracellular uptake effects of their co-administration., Translational Relevance: When using antibiotics and corticosteroids, drug combinations can be selected by referring to the results of this study.

Competing Interests: The author has no conflicts of interest to disclose.

Corneal involvement in HIV-infected individuals may be broadly classified into two categories, namely, infectious and noninfectious with the vast majority of manifestations occurring in the former. In this article, we shall focus on these two categories and strive to highlight those presentations that should alert the clinician to suspect underlying HIV infection. Infectious group mainly consists of Herpitic group of viral infections. Bacterial causes may be due to Staphylococcus epidermidis, Staphylococcus aureus, Pseudomonas aeroginosa , alpha hemolytic Streptococcus, Micrococcus and Bacillus . Fungalf keratitis in HIV-infected individuals depends on the geographic locations from which patient comes. Microsporidia and Acanthamoeba are common Protozoal causes. Non-infective inflammatory causes include peripheral ulcerative keratitis, keratoconjunctivitis sicca, and squamous cell carcinoma of the conjunctiva. Severity which is abnormally severe or very minimally reactive makes the clinician suspect of immunosuppression.

Infections caused by drug-resistant bacteria seriously endanger human health and global public health. Therefore, it is urgent to discover and develop novel antimicrobial agents to combat multidrug-resistant bacteria. In this study, we designed and synthesized a series of new membrane-active bakuchiol derivatives by biomimicking the structure and function of cationic antibacterial peptides. The most promising compound 28 displayed potent antibacterial activity against both Gram-positive bacteria (minimum inhibitory concentration, MIC = 1.56-3.125 μg/mL) and Gram-negative bacteria (MIC = 3.125 μg/mL), very weak hemolytic activity, and low cytotoxicity. Compound 28 had rapid bactericidal properties and avoided bacterial resistance. More importantly, compound 28 showed strong in vivo antibacterial efficacy against Staphylococcus aureus and Pseudomonas aeruginosa in murine corneal infection models. This design strategy is expected to provide an effective solution to the antibiotic crisis.

Corneal infection caused by a bacteria Pseudomonas aeruginosa is common cause of ocular morbidity. Increasing antibiotic resistance by ocular P. aeruginosa is an emerging concern. In this study the resistome of ocular isolates of Pseudomonas aeruginosa clone ST308 isolated in India in 1997 (PA31, PA32, PA33, PA35 and PA37) and 2018 (PA198 and PA219) were investigated. All the isolates of ST308 had >95% nucleotide similarity. The isolates from 2018 had larger genomes, coding sequences, accessory and pan genes compared to the older isolates from 1997. The 2018 isolate PA219 was resistant to all antibiotics except polymyxin B, while the 2018 isolate PA198 was resistant to ciprofloxacin, levofloxacin, gentamicin and tobramycin. Among the isolates from 1997, five were resistant to gentamicin, tobramycin and ciprofloxacin, four were resistant to levofloxacin while two were resistant to polymyxin B. Twenty-four acquired resistance genes were present in the 2018 isolates compared to 11 in the historical isolates. All isolates contained genes encoding for aminoglycoside (aph(6)-Id, aph(3')-lIb, aph(3″)-Ib), beta-lactam (blaPAO), tetracycline (tet(G)), fosfomycin (fosA), chloramphenicol (catB7), sulphonamide (sul1), quaternary ammonium (qacEdelta1) and fluoroquinolone (crpP) resistance. Isolate PA198 possessed aph(3')-VI, rmtD2, qnrVC1, blaOXA-488, blaPME-1, while PA219 possessed aadA1, rmtB, qnrVC1, aac(6')-Ib-cr, blaTEM-1B, blaVIM-2, blaPAO-1, mph(E), mph(A), msr(E). In both recent isolates qnrVC1 was present in Tn3 transposon. In 219 blaTEM-1 was carried on a transposon and blaOXA-10 on a class 1 integron. There were no notable differences in the number of single nucleotide polymorphisms, but recent isolates carried more insertions and deletions in their genes. These findings suggest that genomes of P. aeruginosa ocular clonal strains with >95% nucleotide identity isolated twenty years apart had changed over time with the acquisition of resistance genes. The pattern of gene mutations also varied with more insertions and deletions in their chromosomal genes which confer resistance to antibiotics., (Copyright © 2021 Elsevier Ltd. All rights reserved.)

Keratitis is a public health issue in developing countries and a potentially sight-threatening condition. Collagen fibrils in the corneal stroma are parallels to each other. Fundamental substance maintains the same space between collagen fibrils. That is how corneal transparency can be achieved. Any damage which can modify this structure will lead to corneal opacity and loss of vision. Fungal keratitis might appear in up to one-third of cases. Nevertheless, fungal keratitis remains poorly described and understood. Herein, we present the first ever reported case of corneal infection due to Phaeoacremonium parasiticum in a young patient. We describe the clinical and microbial characteristics, and we also discuss the use of confocal microscopy in early diagnosis of this infection.

Purpose : To investigate the sterility of autologous serum eye drops used for ocular surface diseases. Methods : A total of 100 patients were enrolled. The serum was prepared as follows: 20% serum (20% S), 20% serum with dexamethasone (0.02 mg/ml) (20% S + Dex), and 20% serum with levofloxacin (0.1 mg/ml) (20% S + Lev). Serum samples were collected for normal microbial cultivation at 1, 3, 5, 7, 10, 14, 21, and 28 days. The last samples were also assessed on the 28th day by airtight microbial cultivation. Results : A total of 2400 samples were cultured, and the bacterial contamination rates of 20% S, 20% S+ Dex, and 20% S + Lev group were 4.75%, 3.38%, and 0.88%, respectively, for normal microbial cultivation. There was no significant difference in bacterial contamination among the three groups with times ( P = .502). Bacterial contamination of the 20% S + Lev group showed a significant difference in comparison with the 20% S or 20% S + Dex group ( P < .05) in two culture methods; however, no significant difference was found between the 20% S and 20% S + Dex group ( P = .208). There were two samples positive for fungi in the 20% S and 20% S + Dex group and three samples in the 20% S + Lev group in normal cultivation during 28 days. None of the samples was positive with fungi in airtight cultivation on the 28th day. There was also less bacterial contamination in airtight cultivation than in normal cultivation for the three groups on the 28th day. Conclusions : Our study shows that 20% autologous serum drops can be safely prepared and stored at 4°C in an open system under a strict protocol for at least 28 days, and antimicrobial agents could reduce the risk of contamination.

Because of the rapid increase in bacterial resistance, there is an urgent need for developing new antimicrobial agents to combat multidrug-resistant pathogens. In this study, we designed and synthesized a series of kaempferol derivatives as antimicrobial agents biomimicking the structural properties and biological functions of host defense peptides. After fine-tuning of hydrophobic and cationic hydrophilic moieties linked to the flavone scaffold of kaempferol, we obtained a lead compound ( 52 ) that displayed high membrane selectivity (>128), poor hemolytic activity, low cytotoxicity to mammalian cells, and excellent activity against Gram-positive bacteria (minimum inhibitory concentrations = 1.56 μg/mL), including methicillin-resistant Staphylococcus aureus . Compound 52 can kill bacteria quickly by destroying the bacterial membranes and avoid developing bacterial resistance. Moreover, compound 52 exhibited potent in vivo antibacterial activity against S. aureus in a murine corneal infection model. These results indicated that compound 52 had the therapeutic potential as a novel membrane-active antimicrobial to combat Gram-positive bacterial infections.

Purpose : Corneal culturing requires understanding of aseptic non-touch technique and avoidance of possible contaminants. Currently, there is no formal training in the technique and registrars are typically taught by another registrar in the emergency setting.The aim of the study was to develop an evidence-based instructional video for the corneal scrape procedure in microbial keratitis. The study then aims to assess the effect of the instructional video on clinician performance of the corneal scrape procedure. Method : An instructional video for corneal scraping was developed by identifying key steps for the procedure based on available evidence from a review of the literature and clinical practice. A prospective observational comparative case series that included clinicians at the Sydney Hospital/Sydney Eye Hospital, NSW Australia was conducted. Clinicians performing corneal scrapes had their performance of the procedure assessed prior to and after viewing the instructional video. Results : Sixteen key steps to follow in performing the corneal scrape procedure were found and demonstrated in the instructional video. Fourteen clinicians were observed performing 24 corneal scrapes in 24 patients with a median age of 56 years (IQR 34-65 years) and 45% male. Pre-video 11 scrapes were observed vs 13 scrapes post-video. Descriptive data were summarised and non-parametric categorical data analyzed using IBM SPSS (version 1.0.0.800) to perform chi-square and Wilcoxon signed-rank tests. Statistical significance was defined as p < .05. The steps of the corneal scrape procedure were performed correctly by a greater number of clinicians post-video compared to pre-video ( p = .003). There was a significant improvement in inoculation of agar plates with cross-hatched streaks (92% post- vs 55% pre-video) and the maintenance of an intact agar surface (92% post vs 55% pre-video) ( p = .033). Conclusion : An instructional video optimized the performance of corneal scraping, by ophthalmology trainees, in patients with microbial keratitis.

To describe the clinical features, management and outcomes in patients with fungal keratitis at the Sydney Eye Hospital, Australia, over a 9-year period to guide appropriate initial therapy. A retrospective case review was conducted. Patients diagnosed with fungal keratitis from 1 January 2009 to 31 December 2017 were identified from hospital coding and pathology databases. Data were extracted from the medical records. A total of 55 episodes from 51 patients were included. Mean age was 60 ± 20 years (range: 19-91 years), and 33 were male. The fungal species was not identified in two patients. Predisposing factors included ocular surface disease in 17 eyes (32%); corneal disease, 15 (28%); corneal trauma, 12 (23%); and contact lens wear, 13 (24.5%). Fusarium spp. (15, 27%) and Candida parapsilosis (10, 18%) were the most common isolates. The median visual acuity at presentation was 1.3 logMAR (range: 0 to 3) and after treatment 0.7 logMAR (range: -0.02 to 3) (P = .008). Despite medical therapy, most commonly with natamycin and topical and oral voriconazole, surgical intervention was required in 21 eyes (40%); including antifungal injections in 9 (16%); corneal transplantation, 16 (30%); evisceration, 2 (4%); and enucleation, 1 (2%). A poor visual outcome was recorded in 27 of 43 (63%) patients. Fungal keratitis remains a cause of significant ocular morbidity; the majority of patients face a poor outcome despite intense medical and at times surgical treatment. In our setting, fungal keratitis was more commonly associated with corneal or ocular surface disease., (© 2019 Blackwell Verlag GmbH.)

Purpose: To describe the association of water exposure with contact lens (CL)-related disease and explore the guidelines regarding water exposure to CL wearers, provided by CL manufacturing industry, global public health, and CL-related professional associations., Methods: A review of the literature was conducted by searching PubMed, MEDLINE, and Web of Science databases up to September 2017 for articles published or translated in English using keywords: contact lens* AND tap water OR swimming OR showering OR water exposure AND microbial keratitis OR Acanthamoeba keratitis OR corneal infiltrate* OR ocular adverse event*. References in all relevant publications were also reviewed., Results: Water exposure during CL wear is associated with complications ranging from sterile corneal infiltrative events to sight-threatening infections. Despite the documented risks due to water exposure, water-related habits are common among CL wearers. This suggests a lack of awareness and understanding regarding the risks among CL wearers and potentially CL practitioners. Discrepancies exist in guidelines for CL hygiene and compliance provided by the CL manufacturing industry, global public health, and CL-related professional associations. There is also widespread use of water imagery within CL marketing and packaging materials. These factors may give rise to confusion among wearers and may contribute toward risk-taking behaviors., Conclusions: Consensus among stakeholders about water and CL care is needed. Guidelines should unequivocally advocate for the avoidance of any water exposure including handling CLs with wet hands, rinsing CLs or storage cases in tap water, showering while wearing CLs and swimming with CLs without wearing goggles.

Purpose: To report a novel clinical presentation of corneal biofilms, consisting of formation of superficial and recurrent corneal plaques., Methods: Interventional case report. A 9-year-old boy presented with subepithelial, whitish, avascular, and recurrent corneal plaques without any clinical manifestations of active corneal inflammation and/or infection. He had a history of minor ocular trauma; otherwise, his medical history was unremarkable., Results: An excisional biopsy was performed under topical anesthesia. Histological analysis identified these plaques as clusters of gram-negative bacilli surrounded by an extracellular matrix. Samples were further evaluated with special stains (calcofluor white, Flamingo fluorescent dye, propidium iodide, and Gomori-Grocott) that demonstrated biofilm structures., Conclusions: Corneal plaques are a very rare clinical presentation of corneal biofilms that allow prolonged survival of microorganisms even in the absence of prosthetic material and clinical signs or symptoms of corneal active inflammation and/or infection.

Bacteria can acquire an accessory genome through the horizontal transfer of genetic elements from non-parental lineages. This leads to rapid genetic evolution allowing traits such as antibiotic resistance and virulence to spread through bacterial communities. The study of complete genomes of bacterial strains helps to understand the genomic traits associated with virulence and antibiotic resistance. We aimed to investigate the complete accessory genome of an ocular isolate of Pseudomonas aeruginosa strain PA34. We obtained the complete genome of PA34 utilising genome sequence reads from Illumina and Oxford Nanopore Technology followed by PCR to close any identified gaps. In-depth genomic analysis was performed using various bioinformatics tools. The susceptibility to heavy metals and cytotoxicity was determined to confirm expression of certain traits. The complete genome of PA34 includes a chromosome of 6.8 Mbp and two plasmids of 95.4 Kbp (pMKPA34-1) and 26.8 Kbp (pMKPA34-2). PA34 had a large accessory genome of 1,213 genes and had 543 unique genes not present in other strains. These exclusive genes encoded features related to metal and antibiotic resistance, phage integrase and transposons. At least 24 genomic islands (GIs) were predicated in the complete chromosome, of which two were integrated into novel sites. Eleven GIs carried virulence factors or replaced pathogenic genes. A bacteriophage carried the aminoglycoside resistance gene (AAC(3)-IId). The two plasmids carried other six antibiotic resistance genes. The large accessory genome of this ocular isolate plays a large role in shaping its virulence and antibiotic resistance., Competing Interests: The authors have declared that no competing interests exist.

Colonization by Staphylococcus aureus (S. aureus) has been implicated in many infectious and wound healing disorders. This study was performed to characterize the pathogenic role of S. aureus alpha-hemolysin (alpha-toxin) in corneal epithelial wound healing and infectious keratitis in the setting of a corneal wound. The effect of wild-type and isogenic Hla mutant (α-hemolysin gene deleted) S. aureus bacteria and conditioned media on corneal epithelial wound healing was tested in vitro using a scratch assay and in vivo using a murine epithelial debridement model. The invasiveness of wild-type and Hla mutant S. aureus was evaluated in vitro in human corneal epithelial cells and in vivo in a murine model of infectious keratitis following total epithelial debridement. S. aureus and its conditioned media significantly delayed epithelial wound closure both in vitro (P < 0.05) and in vivo (P < 0.05). The effect of S. aureus on wound healing was significantly diminished with the Hla mutant strain (P < 0.05). Likewise, compared to the wild-type strain, the Hla mutant strain demonstrated significantly reduced ability to invade corneal epithelial cells in vitro (P < 0.05) and infect murine corneas following total epithelial debridement in vivo (P < 0.05). In conclusion, S. aureus alpha-hemolysin plays a major role in the pathologic modulation of corneal epithelial wound healing and the intracellular invasion of the bacteria. Limiting colonization by S. aureus and/or blocking alpha-hemolysin may provide a therapeutic approach for corneal wound healing and infectious disorders., (Copyright © 2019 Elsevier Ltd. All rights reserved.)

Purpose: To report a farmer's corneal abscess caused by an unusual pathogen: Listeria monocytogenes fluoroquinolone resistant., Methods: A 78-year-old farmer presented a central corneal abscess associated with 1-mm hypopyon and decreased visual acuity evolving since 2 weeks. First an antibiotic therapy associating oral ofloxacin and topical ciprofloxacin, vancomycin and ceftazidime was started. Different samples of the abscess were performed and sent to different microbiological laboratories., Result: Listeria monocytogenes was isolated after 2 days of culture. Antibiotics sensitivity showed resistance to ciprofloxacin, fosfomycin and fusidic acid. Ceftazidime was changed for gentamicin, and after 1 month of treatment the abscess decreased considerably., Conclusion: This case demonstrated that even if Listeria is rarely involved in ocular abscess, it must be evocated for people with risk factors as farmers. This suspicion should lead to an extended incubation to identify the pathogen. The analysis of Listeria resistance is essential to start an efficient therapy.

The effect of storage time and temperature on the recovery of pathogen DNA from polytetrafluorethylene (PTFE) was investigated. PTFE impression membranes were inoculated with Pseudomonas aeruginosa, Herpes Simplex Virus-1 (HSV-1) or Acanthamoeba and stored at -70 °C, -20 °C, +4 °C or +35 °C. PCR was performed on days 0, 1, 2, 3, 7 and months 1, 3 and 10 post-inoculation. We found no reduction in the DNA recovery of any of the studied microorganisms for the first 3 days of storage up to +35 °C. For HSV-1 and P. aeruginosa, storage for 3 months at +35 °C was associated with a significant reduction in DNA recovery (P<0.001), but not at +4 °C, -20 °C or -70 °C for 1 month for P. aeruginosa and for 10 months for HSV-1. Acanthamoeba DNA recovery was not affected by any storage parameters (P=0.203). These results will inform the investigation of microbial keratitis where access to microbiological testing is not readily available.

Infectious crystalline keratopathy was first reported by Gorovoy and colleagues in 1983 when they identified bacteria colonizing a cornea after a penetrating keratoplasty. Subsequent cases have elaborated on the organisms responsible and the management outcomes. Patients present with a white or gray branching opacity originating from an epithelial defect, commonly after a penetrating keratoplasty. Local immunosuppression contributes to the quiescent nature and the limited inflammatory response associated with infectious crystalline keratopathy. Diagnosis of the infective pathogens may be difficult, with a corneal scraping often being too superficial to obtain an adequate specimen. A biofilm is present that advantages microorganism survival, reduces antibiotic bioavailability, and inhibits diagnostic microbial detection. Treatment begins with topical antimicrobials, initially broad spectrum and then targeted to microorganism sensitivity. Adjunctive therapies to enhance the efficacy of treatment include disruption of the microorganism biofilm by laser, intrastromal antibiotics, and keratectomy. In recalcitrant cases, or where corneal scarring ensues, corneal transplantation is required., (Copyright © 2017 Elsevier Inc. All rights reserved.)

The aim of the study was mycological examination of ulcerated corneal tissues from an ophthalmic patient. Tissue fragments were analyzed on potato-glucose agar (PDA) and maltose (MA) (Difco) media using standard laboratory techniques. Cultures were identified using classical and molecular methods. Macro- and microscopic colony morphology was characteristic of fungi from the genus Aspergillus (restricted growth series), most probably Aspergillus penicillioides Speg. Molecular analysis of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis., The aim of the study was mycological examination of ulcerated corneal tissues from an ophthalmic patient. Tissue fragments were analyzed on potato-glucose agar (PDA) and maltose (MA) (Difco) media using standard laboratory techniques. Cultures were identified using classical and molecular methods. Macro- and microscopic colony morphology was characteristic of fungi from the genus Aspergillus (restricted growth series), most probably Aspergillus penicillioides Speg. Molecular analysis of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis., (© 2018 Eulalia Machowicz-Matejko et al.)

Background: Because corneal infiltrative events (CIEs) may result from bacterial components on contact lenses, which can come from contaminated lens cases, we evaluated the biocidal efficacy of five multipurpose solutions against Gram-negative commonly isolated and CIE-associated organisms., Methods: Of the multipurpose solutions tested, one contained polyhexamethylene biguanide (PHMB)/polyquaternium-1 (PQ-1; Bausch & Lomb Incorporated: Biotrue), one contained alexidine dihydrochloride (alexidine)/PQ-1 (AMO: RevitaLens OcuTec) and three contained PQ-1/myristamidopropyl dimethylamine (MAPD; Alcon: Opti-Free PureMoist, PQ-1/MAPD-1; Opti-Free RepleniSH, PQ-1/MAPD-2; Opti-Free Express, PQ-1/MAPD-3). Challenge organisms were CIE-associated Achromobacter xylosoxidans, Delftia acidovorans and Stenotrophomonas maltophilia at manufacturer-recommended durations (stand-alone), in lens cases without lenses (up to seven days) and in lens cases with etafilcon A lenses (up to 30 days)., Results: In stand-alone testing against CIE-associated organisms, PHMB/PQ-1 and alexidine/PQ-1 were significantly superior versus MAPD-based multipurpose solutions against A. xylosoxidans (all p ≤ 0.01), D. acidovorans (all p ≤ 0.001) and S. maltophilia (all p ≤ 0.05). In lens cases, PHMB/PQ-1 and alexidine/PQ-1 achieved greater than 3-log reductions against all challenge organisms at all times evaluated. PQ-1/MAPD-1 achieved a greater than 3-log reduction against D. acidovorans at 24 hours; PQ-1/MAPD-1 and PQ-1/MAPD-3 achieved greater than 3-log reductions at seven days against all organisms. In lens cases with lenses, PHMB/PQ-1 and alexidine/PQ-1 achieved greater than 3-log reductions against all organisms at all times. PQ-1/MAPD-1 and PQ-1/MAPD-3 achieved greater than 3-log reductions at seven or more days against all organisms. PQ-1/MAPD-2 did not achieve a greater than 3-log reduction at any time; some regrowth was observed., Conclusions: PHMB- and alexidine-based multipurpose solutions demonstrated significantly greater biocidal activity compared with PQ-1/MAPD-based agents against Gram-negative organisms commonly isolated and CIE-associated pathogens., (© 2017 Bausch & Lomb Incorporated. Clinical and Experimental Optometry published by John Wiley & Sons Australia, Ltd on behalf of Optometry Australia.)

Purpose: To analyze clinical outcomes of repeat optical penetrating (PK) or endothelial keratoplasty (EK) after failed therapeutic keratoplasty (TPK)., Design: Retrospective consecutive, comparative, interventional case series., Methods: setting: LV Prasad Eye Institute, Hyderabad, India., Study Population: Patients aged >18 years who underwent a repeat PK or EK following a failed TPK with a follow-up of at least 1 year were included. Patients with culture-negative ulcers, viral etiology, coexistent ocular surface disease, and multiple grafts were excluded from the study., Intervention: PK or EK for failed TPK., Main Outcome Measure: Corrected distance visual acuity at 1 year follow-up. secondary outcome measure: Graft clarity., Results: One hundred twelve eyes (67 PK, 45 EK) were included in the study. The PK group had a significantly higher number of cases with high-risk features prior to regraft. Improvement in visual acuity in each of the types of grafts was statistically significant (P < .01), but there was no difference between the 2 groups at 1 year postoperatively. A statistically significant proportion of grafts regained graft clarity after regrafting in the PK group (P < .01) but not in the EK group (P = .205) at 1 year postoperatively. Endothelial rejection rates were higher in the PK group. Subgroup analysis showed that eyes that had PK or EK for failed TPK conducted for Aspergillus keratitis showed better outcomes in terms of graft clarity. Kaplan-Maier (KM) survival analysis for graft clarity showed cumulative survival of 50% at 5 years. The survival using the KM curve was not statistically different between the 2 groups (P = .33)., Conclusion: This study shows that visual rehabilitation with relatively good functional outcomes can be achieved by performing repeat PK or EK in patients after failed TPK., (Copyright © 2016 Elsevier Inc. All rights reserved.)

Serratia marcescens is a soil- and water-derived bacterium that secretes several host-directed factors and causes hospital infections and community-acquired ocular infections. The putative two-component regulatory system composed of EepR and EepS regulates hemolysis and swarming motility through transcriptional control of the swrW gene and pigment production through control of the pigA-pigN operon. Here, we identify and characterize a role for EepR in regulation of exoenzyme production, stress survival, cytotoxicity to human epithelial cells, and virulence. Genetic analysis supports the model that EepR is in a common pathway with the widely conserved cyclic-AMP receptor protein that regulates protease production. Together, these data introduce a novel regulator of host-pathogen interactions and secreted-protein production., (Copyright © 2015, American Society for Microbiology. All Rights Reserved.)

Ablation of syndecan-1 in mice is a gain of function mutation that enables mice to significantly resist infection by several bacterial pathogens. Syndecan-1 shedding is induced by bacterial virulence factors, and inhibition of shedding attenuates bacterial virulence, whereas administration of purified syndecan-1 ectodomain enhances virulence, suggesting that bacteria subvert syndecan-1 ectodomains released by shedding for their pathogenesis. However, the pro-pathogenic functions of syndecan-1 ectodomain have yet to be clearly defined. Here, we examined how syndecan-1 ectodomain enhances Staphylococcus aureus virulence in injured mouse corneas. We found that syndecan-1 ectodomain promotes S. aureus corneal infection in an HS-dependent manner. Surprisingly, we found that this pro-pathogenic activity is dependent on 2-O-sulfated domains in HS, indicating that the effects of syndecan-1 ectodomain are structure-based. Our results also showed that purified syndecan-1 ectodomain and heparan compounds containing 2-O-sulfate motifs inhibit S. aureus killing by antimicrobial factors secreted by degranulated neutrophils, but does not affect intracellular phagocytic killing by neutrophils. Immunodepletion of antimicrobial factors with staphylocidal activities demonstrated that CRAMP, a cationic antimicrobial peptide, is primarily responsible for S. aureus killing among other factors secreted by degranulated neutrophils. Furthermore, we found that purified syndecan-1 ectodomain and heparan compounds containing 2-O-sulfate units potently and specifically inhibit S. aureus killing by synthetic CRAMP. These results provide compelling evidence that a specific subclass of sulfate groups, and not the overall charge of HS, permits syndecan-1 ectodomains to promote S. aureus corneal infection by inhibiting a key arm of neutrophil host defense., (© 2015 by The American Society for Biochemistry and Molecular Biology, Inc.)

A 25-year-old woman underwent intracranial surgery for trigeminal nerve schwannoma (TGNS) with persistent left-sided facial hypoaesthesia. Two months later, she developed a central corneal ulceration. Scraping of the corneal lesion revealed Gram-negative bacilli. Genus level identification was achieved using standard techniques and species level identification, revealing Pseudomonas stutzeri, was aided by a VITEK 2 compact system. Broad-spectrum fortified antibiotics were initially started followed by species-sensitive fortified antibiotics. Ocular surface toxicity developed a week later; this was managed with a non-fortified antibiotic. The epithelial defect healed in 3 weeks with subsequent corneal scar formation. Visual rehabilitation was achieved with deep anterior lamellar keratoplasty. Six months following surgery, the patient had a visual acuity of 20/40 with -1.25 170° -0.5 refractive correction and a clear graft. This case report, for the first time, highlights P. stutzeri, an aetiological agent of corneal ulcer following excision of TGNS and its successful management., (2015 BMJ Publishing Group Ltd.)

Objective: To determine the bacteriological spectrum of the removed therapeutic soft contact lenses (TSCLs) and to establish efficacy of prophylactic antibiotics on TSCLs used for 2 weeks for treatment of patients with recurrent corneal erosion syndrome (RCES)., Methods: This study included idiopathic RCES treated using highly oxygen-permeable silicone hydrogel contact lenses (CLs), and treated 4 times per day with topical tobramycin 3% for 2 weeks. After TSCLs were applied for 2 weeks, the lenses were removed with sterile forceps under which a speculum was inserted, and placed on blood agar with the inner face down. The TSCLs were analyzed for bacterial colonization, and antibiotic susceptibility tests were performed for the isolates, using disk diffusion., Results: Of the 40 lenses analyzed, 9 (22.5%) yielded positive cultures. Staphylococcus epidermidis was the most commonly isolated microorganism; there were five methicillin-sensitive coagulase-negative staphylococci and two methicillin-resistant coagulase-negative staphylococci. Furthermore, we found two lenses that were colonized by Enterobacter gergoviae and Citrobacter freundii. All cultured bacteria showed intermediate or complete sensitivity to ciprofloxacin, tigecycline, and tobramycin. Despite bacterial colonization in 9 CLs, no clinical signs of infectious keratitis were found in any of the patients with prophylactic topical tobramycin 3%., Conclusions: In case of using TSCLs for 2 weeks, tobramycin or ciprofloxacin may be useful as prophylactic topical antibiotics for preventing secondary corneal infections. Considering currently growing incidence of ciprofloxacin-resistant ocular isolates, tobramycin seems to be a reasonable prophylactic topical antibiotic susceptible broad spectrum of bacteria in clinics.

Aspergillus flavus infects the human eye leading to keratitis. Extracellular proteins, the earliest proteins that come in contact with the host and virulence related exoproteins, were identified in the fungus isolated from infected cornea. Virulence of the corneal isolates was tested in the Galleria mellonella larvae model and those isolates showing higher virulence were taken for subsequent exoproteome analysis. High resolution two-dimensional electrophoresis and mass spectrometry were used to generate A. flavus exoproteome reference map as well as to profile most of the exoproteins. Analysis of the identified proteins clearly shows the major biological processes that they are involved in. Nearly 50% of the exoproteins possess catalytic activity and one of these, an alkaline serine protease (Alp1) is present in high abundance as well as multiple proteoforms. Many proteins in the A. flavus exoproteome have been shown to be virulence factors in other pathogens indicating the probable role for these proteins in the corneal infection as well. Interestingly, the majority of the exoproteins do not have secretory signal indicating that they are secreted through the non-classical pathway. Thus, this study provides a clue to the early strategies employed by the pathogen to establish an infection in an immunocompetent host., Biological Significance: The outcome of a fungal infection in an immunocompetent human eye depends on the ability of the fungus to overcome the host defense and propagate itself. In this process, the earliest events with respect to the fungal proteins involved include the secretory proteins of the invading organism. As a first step towards understanding the role of the extracellular proteins, exoproteome profile of the fungal isolates was generated. The fungal isolates from cornea showed a distinct pattern of the exoproteome when compared to the saprophyte. Since corneal isolates also showed higher virulence in the insect larval model, presumably the proteins elaborated by the corneal isolates are virulence related. One of the abundant proteins is an alkaline serine protease and this protein exists as multiple proteoforms. This study reports the comprehensive profile of exoproteome and reveals proteins that are potential virulence factors., (Copyright © 2014 Elsevier B.V. All rights reserved.)

Purpose: The goal of this study was to provide an update of significant corneal literature published in 2013., Design: This study is a systematic literature review., Methods: We conducted a systematic review of the English-language literature published from January 1, 2013, to December 31, 2013, using the following PubMed search and Medical Subject Headings terms: cornea transplantation, keratoplasty, Descemet membrane endothelial keratoplasty, Descemet stripping endothelial keratoplasty, cross linking, pre-Descemet's layer, Rho-associated kinase, keratoprosthesis, infectious keratitis, corneal dystrophy, corneal astigmatism, and keratoconus., Results: This review summarizes relevant and innovative original articles, review articles, and novel techniques from the following journals: American Journal of Ophthalmology, British Journal of Ophthalmology, Cornea, Graefe's Archive for Clinical and Experimental Ophthalmology, Investigative Ophthalmology & Visual Science, JAMA Ophthalmology, Journal of Cataract and Refractive Surgery, Journal of Refractive Surgery, and Ophthalmology. Case reports, abstracts, letters to the Editor, and unpublished work were excluded, as well as articles e-published ahead of print in 2012 that were discussed in the previous review. One hundred twenty-seven articles met the criteria for this review., Conclusions: This review summarizes significant cornea-related literature from 2013.

Background: To report a case of non-typical Pseudomonas aeruginosa keratitis that was misdiagnosed as fungal keratitis by in vivo confocal microscopy., Case Presentation: A 37-year-old Chinese woman presented with a 2-week history of increasing pain and redness of the right eye. She was started on hourly topical fortified tobramycin and levofloxacin by the referring doctor without improvement. She denied any improvement of her symptoms and signs. On examination, she had a large central corneal ulcer extending to the peripheral cornea. Further symptoms included a satellite lesion, intense conjunctival injection and marked corneal oedema. The corneal scrape was not performed initially because of the deep infiltrate in the stroma. The patient was examined by in vivo confocal microscopy. Confocal microscopy images showed hyper-reflective, thin, and branching interlocking linear structures in the stroma that were 5-8 μm in width and 200-400 μm in length. The morphology was consistent with that of fungus. However, the histopathological examination, Gram stain, and culture of the cornea only confirmed the presence of a Pseudomonas species within the deep strom. No fungal element was found. The pathogen was sensitive to ciprofloxacin, gentamicin, levofloxacin, tobramycin and amikacin., Conclusion: This case reports the potential for a false positive finding of fungus in Pseudomonas aeruginosa keratitis and emphasizes the importance of bacterial culture and antibiotic susceptibility testing in the management of microbial keratitis.

Objective: To understand the prevalence and demographic characteristics of infectious keratitis and infectious corneal blindness., Methods: A multi-center, population-based cross-sectional study was conducted from January 1 to August 31, 2010. A total of 191,242 individuals of all age groups from 10 geographically representative provinces were sampled using stratified, multi-stage, random and systematic sampling procedures. A majority, 168,673 (88.2%), of those sampled participated in the study. The examination protocol included a structured interview, visual acuity testing, an external eye examination, and an anterior segment examination using a slit lamp. The causes and sequelae of corneal disease were identified using uniform customized protocols. Blindness in one eye caused by infectious keratitis was defined as infectious corneal blindness., Results: The prevalence of past and active infectious keratitis was 0.192% (95% confidence interval [CI], 0.171-0.213%), and the prevalence of viral, bacterial, and fungal keratitis was 0.11%, 0.075%, and 0.007%, respectively. There were 138 cases of infectious corneal blindness in at least one eye in the study population (prevalence of 0.082% [95%CI, 0.068%-0.095%]). Statistical analysis suggested that ocular trauma, alcoholic consumption, low socioeconomic levels, advanced age, and poor education were risk factors for infectious corneal blindness., Conclusions: Infectious keratitis is the leading cause of corneal blindness in China. Eye care strategies should focus on the prevention and rehabilitation of infectious corneal blindness.

Purpose: The aim of this study was to evaluate the visual outcomes and graft survival rate after therapeutic keratoplasty performed for interface infection after Descemet stripping automated endothelial keratoplasty (DSAEK)., Methods: This is a retrospective, interventional case series. The study population comprised 7 patients who developed unilateral post-DSAEK interface infection unresponsive to conservative treatment, with or without graft exchange, and were treated with penetrating keratoplasty (PK), 9 to 9.5 mm in diameter, with en bloc excision of the recipient cornea and DSAEK graft. The main outcome measures included best spectacle-corrected visual acuity, refractive error, histological examination, reinfection, and rejection and graft survival rates., Results: Interface infection was diagnosed in 10 (0.92%) of 1088 eyes that underwent DSAEK at our institution between 2005 and 2013. Seven of 10 eyes (0.64% of the total) were unresponsive to conservative treatment and underwent therapeutic keratoplasty. Candida and Staphylococcus species were identified in 3 cases each, and Nocardia species was identified in 1 case. With a mean post-PK follow-up of 25.4 months (range 4-60 months), no recurrence of infection was seen in any eye, and 5 of 7 PK grafts remained clear. Best spectacle-corrected visual acuity was 20/20 in 2 eyes, better than 20/50 in 4 eyes, and 20/100 or worse in 3 eyes, in 2 of which the graft had failed within 1 year of performing the PK., Conclusions: Therapeutic keratoplasty is instrumental in eliminating interface infection after DSAEK, possibly leading to excellent visual outcomes with a relatively high graft survival rate.

Objective: To describe a reproducible technique for intrastromal injection in the standing horse for treatment of corneal stromal abscessation., Animal Studied: A retrospective clinical study addressing the history, treatment, and outcome of six equids (six eyes) that received intrastromal voriconazole injection., Procedure: Equids having a deep stromal abscess suspected to be of fungal origin were administered intrastromal injection of 5% voriconazole solution under standing sedation in an effort to bring about enhanced resolution of clinical disease., Results: Intracorneal administration of 5% voriconazole solution resulted in resolution of clinical disease, specifically stromal abscessation and secondary uveitis. All animals displayed decreased blepharospasm and no significant complications in the immediate postinjection period. Convalescent periods were subjectively shorter than anticipated with traditional medical therapy. All animals developed mild to moderate stromal fibrosis relative to the initial severity and depth of abscessation., Conclusions: Intrastromal injection of 5% voriconazole solution may provide a safe and effective treatment option for corneal stromal abscessation in horses. In all reported cases, administration of injection early in the treatment period appeared to contribute to rapid resolution of clinical disease without significant complications. The authors present this technique as an alternative to traditional surgical intervention, being more economical, having shorter treatment duration, and potentially resulting in less scar formation., (© 2014 American College of Veterinary Ophthalmologists.)

Purpose: To investigate histopathologic and immunohistochemical aspects of equine deep stromal abscesses (DSA) with a focus on the histopathologic diagnosis, presumptive etiology, and the immunohistochemical expression of three angiogenesis-related factors: vascular endothelial growth factor-A (VEGF-A), pigment epithelium-derived factor (PEDF), and interleukin-1 receptor antagonist (IL-1ra)., Sample Population: Paraffin-embedded biopsy samples from 51 DSA. The biopsies were collected from full-thickness penetrating keratoplasty or split-thickness lamellar keratoplasty surgeries at the University of Florida Veterinary Medical Center in the period from 2004 to 2009., Procedure: The histopathologic and immunohistochemical findings were tested for association between each other. Prevalence calculation and test for association with qualitative data analysis was used for data evaluation., Results: Fungal hyphae were found histologically in 47.1% (n = 24) of the DSA cases. Histopathologically, most fungal DSA showed suppurative keratitis (n = 34; 66.7%) and little to no stromal vascularization infiltrating the abscess (negative association, P = 0.005). All three angiogenesis-related factors were expressed to some degree in DSA tissue. A negative association between VEGF-A and PEDF when compared to the presence of fungal hyphae (P < 0.001, P = 0.023) indicated that cases positive for these two factors will most probably not have fungal hyphae present., Conclusion: Abnormally decreased VEGF-A expression is suggested as the reason for the slow vascularization and delayed resolution of fungal DSA, whereas PEDF and IL-ra did not seem to have any influence on the vascularization process. Clinical and histopathologic characteristics of DSA make it possible to suggest an etiology for an equine DSA with an unknown etiology., (© 2013 American College of Veterinary Ophthalmologists.)

Objective: To study the equine deep stromal abscesses (DSA) with focus on the duration of the corneal disease, medical treatment, season of presentation, clinical appearance, and the degree of corneal vascularization., Material and Methods: Equine DSA diagnosed, biopsied, and surgically treated at the University of Florida Veterinary Medical Center (UFVMC) from 2004 to 2009 were identified. The medical record, clinical photographic images, and microbiology results for each case were evaluated. Frequency and prevalence calculation as well as qualitative data analysis was performed for clinical and microbiological data., Results: Fifty-one equine DSA were included in the study. Spring (March, April, May; 33.4%) and winter (December, January, February; 31.4%) were the most common seasons for DSA presentation. The 51 cases were divided into four categories of focal opacity from their clinical appearance: focal yellow (45.2%), focal white (23.5%), diffuse yellow/white (23.5%), and focal pink (7.8%). 5.9% of the DSA (n = 3) were culture positive for fungal growth, whereas 17.6% were positive for bacterial growth (n = 9). No association between short-/long-term systemically administered NSAID treatment and the corneal vascular response to the corneal lesion could be appreciated., Conclusion: Equine DSA most often present in the spring and winter in the subtropical environment of the state of Florida (USA). The clinical appearance may have a connection with the etiology and pathogenesis of the equine DSA. No connection between short- or long-term systemically administered NSAID and the degree of corneal vascularization of the DSA was noted., (© 2013 American College of Veterinary Ophthalmologists.)

Pseudomonas aeruginosa is a frequent cause of acute infections. The primary virulence factor that has been linked to clinical disease is the type III secretion system, a molecular syringe that delivers effector proteins directly into host cells. Despite the importance of type III secretion in dictating clinical outcomes and promoting disease in animal models of infections, clinical isolates often do not express the type III secretion system in vitro. Here we screened 81 clinical P. aeruginosa isolates for secretion of type III secretion system substrates by western blot. Non-expressing strains were also subjected to a functional test assaying the ability to intoxicate epithelial cells in vitro, and to survive and cause disease in a murine model of corneal infection. 26 of 81 clinical isolates were found to be type III secretion negative by western blot. 17 of these 26 non-expressing strains were tested for their ability to cause epithelial cell rounding. Of these, three isolates caused epithelial cell rounding in a type III secretion system dependent manner, and one strain was cytotoxic in a T3SS-independent manner. Five T3SS-negative isolates were also tested for their ability to cause disease in a murine model of corneal infection. Of these isolates, two strains caused severe corneal disease in a T3SS-independent manner. Interestingly, one of these strains caused significant disease (inflammation) despite being cleared. Our data therefore show that P. aeruginosa clinical isolates can cause disease in a T3SS-independent manner, demonstrating the existence of novel modifiers of clinical disease.

Microsporidia are a diverse group of obligate, intracellular, eukaryotic, spore-forming parasites. Traditionally, these were considered as protozoans but recently have been reclassified as fungi. Microsporidia behave as opportunistic pathogens causing systemic infections. In the eye, Microsporidia cause keratoconjunctivitis, corneal stromal keratitis, scleritis, and endophthalmitis. This review shares our experiences with anterior segment infections caused by this pathogen. Keratoconjunctivitis is a common form of ocular infection caused by the parasite. Although early reports described it as occurring only in immunosuppressed individuals, it can also occur in immunocompetent individuals. The disease shows a seasonal pattern with a peak incidence during the rainy season. Although several drugs have been considered, our experience suggests that keratoconjunctivitis is a self-limiting disease. In contrast to keratoconjunctivitis, stromal keratitis is an ill-defined disease. We collected 30 cases and analyzed the various aspects of this disease. Stromal keratitis is characterized by a slowly progressive course. The corneal picture resembles herpes simplex virus stromal keratitis or fungal keratitis cases, and is characterized by deep stromal infiltrates with overlying and surrounding stromal edema and keratic precipitates. The diagnosis of Microsporidia infection is confirmed by a microscopic examination of smears from patients with ulcerative keratitis or by a histopathological examination of corneal tissues. Definitive genus identification requires the examination of specimens by electron microscopy or by molecular methods. In the absence of a definitive medical treatment, nearly all patients require surgical treatment. The confusion regarding Microsporidia is not only limited to their classification but also extends to various aspects of the corneal disease caused by them.

Aspergillus and Fusarium species are important causes of fungal infections worldwide. Airborne spores (conidia) of these filamentous fungi express a surface protein that confers hydrophobicity (hydrophobin) and covers cell wall components that would otherwise induce a host immune cell response. Using a mutant Aspergillus fumigatus strain (ΔrodA) that does not express the RodA hydrophobin, and Aspergillus and Fusarium conidia from clinical isolates that were treated with hydrofluoric acid (which removes the A. fumigatus RodA protein), we observed increased surface exposure of β1,3-glucan and α-mannose on Aspergillus and Fusarium conidia. We also found that ΔrodA and hydrofluoric acid-treated conidia stimulate significantly higher NF-κB p65 nuclear translocation and cytokine production by macrophages from C57BL/6, but not from Dectin-1(-/-) or Dectin-2(-/-) mice. Using a murine model of A. fumigatus corneal infection, we showed that ΔrodA conidia induced significantly higher cytokine production, neutrophil infiltration, and more rapid fungal clearance from C57BL/6 corneas compared with the parent G10 strain, which was dependent on Dectin-1 and Dectin-2. Together, these findings identify the hydrophobin RodA as a virulence factor that masks Dectin-1 and Dectin-2 recognition of conidia, resulting in impaired neutrophil recruitment to the cornea and increased fungal survival and clinical disease.

Purpose: To evaluate the sterility and safety of 100% nonpreserved, autologous, serum eye drop treatment in patients with ocular surface diseases., Methods: A total of 147 autologous serum bottles (294 samples) from 21 patients with ocular surface diseases were included. Seven bottles with autologous serum were prepared for each patient, and each bottle was used for only 1 day, then discarded. Two samples from each bottle were taken (before use and after 24 hours of use) and then cultured in standard media. The culture plates were held for at least 6 weeks or until no growth could be confirmed. To monitor safety, all patients were admitted and evaluated for the occurrence of infection., Results: In the pretreatment group, 4 samples from 4 patients (1.36%) were positive for bacteria and 7 samples from 7 patients (2.38%) were positive for fungi. In the 24-hour-after-treatment group, 1 culture (0.34%) was positive for bacteria, and 6 samples (2.04%) from 6 patients were positive for fungi. Aspergillus spp and Fonsecaea spp were the most common organisms identified in any of the cultures. Neither clinical nor microbiological evidence of infection was demonstrated in any patient during the treatment or follow-up periods., Conclusions: Although no ocular surface infection was observed, the patients under 100% autologous serum eye drops therapy should be closely monitored for clinical evidence of fungal and bacterial infections.

The role of the wild boar (Sus scrofa) as a reservoir for a large number of pathogens that can affect both domestic animals and humans has been widely studied in the last few years. However, the impact of some of these pathogens on the health of wild boar populations is still being determined. This article presents a clinical case of severe bilateral keratoconjunctivitis affecting a 2-mo-old piglet from a semi-free range population in Spain. Histopathologic and microbiologic analysis revealed lesions in the cornea, choroid, and optical nerve, and Chlamydia suis was detected in the eyes bilaterally. The visual handicap resulting from this type of lesion greatly affects the survival of this affected piglet.

Purpose: Microbial adhesion to contact lenses is believed to be one of the initiating events in the formation of many corneal infiltrative events, including microbial keratitis, that occur during contact lens wear. The advent of silicone hydrogel lenses has not reduced the incidence of these events. This may partly be related to the ability of microbes to adhere to these lenses. The aim of this study was to review the published literature on microbial adhesion to contact lenses, focusing on adhesion to silicone hydrogel lenses., Methods: The literature on microbial adhesion to contact lenses was searched, along with associated literature on adverse events that occur during contact lens wear. Particular reference was paid to the years 1995 through 2012 because this encompasses the time when the first clinical trials of silicone hydrogel lenses were reported, and their commercial availability and the publication of epidemiology studies on adverse events were studied., Results: In vitro studies of bacterial adhesion to unworn silicone hydrogel lens have shown that generally, bacteria adhere to these lenses in greater numbers than to the hydroxyethyl methacrylate-based soft lenses. Lens wear has different effects on microbial adhesion, and this is dependent on the type of lens and microbial species/genera that is studied. Biofilms that can be formed on any lens type tend to protect the bacteria and fungi from the effects on disinfectants. Fungal hyphae can penetrate the surface of most types of lenses. Acanthamoeba adhere in greater numbers to first-generation silicone hydrogel lenses compared with the second-generation or hydroxyethyl methacrylate-based soft lenses., Conclusion: Microbial adhesion to silicone hydrogel lenses occurs and is associated with the production of corneal infiltrative events during lens wear.

Purpose: To evaluate the efficacy of automated lamellar therapeutic keratoplasty (ALTK) for the management of anterior corneal stromal scarring caused by trachoma., Methods: Seventeen cases of trachomatous keratopathy that were treated by ALTK were retrospectively evaluated. The main outcome measures were uncorrected visual acuity, best-corrected visual acuity (BCVA), keratometry, pachymetry, time to epithelialization, graft clarity, and complications, if any., Results: The mean age of the patients was 50.3 ± 14.1 years. Five of the 17 cases had Salzmann nodular degeneration. The mean decimal BCVA was 0.06 ± 0.05 preoperatively, which improved to 0.41 ± 0.16 at 12 months, and 12 eyes (70.6%) had a postoperative BCVA of 6/18 or better. The median epithelialization time was 6 days (range, 1-38 days). Persistent epithelial defect developed in 6 eyes, and 1 eye developed graft infection., Conclusions: Anterior stromal corneal scarring caused by trachoma can be effectively treated with ALTK. However, occurrence of persistent epithelial defects may complicate the success of this surgery.

Purpose: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts., Design: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture., Participants and Controls: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis., Methods: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample., Main Outcome Measures: Detection of fungi in corneal samples by HRM., Results: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis., Conclusions: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction., (Copyright © 2012 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.)

Purpose: A case of Phialemonium curvatum wound corneal infection after phacoemulsification is reported., Methods: Case report., Results: The marked aggressiveness of this fungus is demonstrated by the absence of therapeutic response to both medical and surgical treatment., Conclusions: The poor outcome resulted in evisceration of the affected eye.

In this study, six in situ gelling formulations based on Gelrite were prepared and evaluated for the retained ophthalmic delivery of Moxifloxacin (Mox). The effectiveness of the best developed formula G5 was compared with photodynamic therapy (PDT), the recent expanding approach for the treatment of ophthalmologic disorders after the assessment of optimum photodynamic inactivation parameters that permit efficient pathogens eradication. It was found that, Staphylococcus aureus (S. aureus) (Gram-positive) was more susceptible to effective lethal photosensitization that reaches 93.5% reduction in viable count than Escherichia coli (E. coli) (Gramnegative) of 76.1% using 3 mg/mL Hematoporphyrin (HP), illuminated by 630 nm Light Emitting Diode (LED) at 9 J/cm(2) and incubated for 15 min. Following topical instillation of G5 to rabbits corneas, higher amount of Mox was retained in the aqueous humor up to 24 h with significant 6-fold increase in the C(max) and AUC((0-∞)) compared to vigamox commercial eye drops. After post corneal infection with S. aureus, both approaches were effectively treating the infection without causing ocular irritation or collateral damage to corneal tissue where G5 showed remarkable improvement after four days compared to seven days of PDT treatment.