Search

Abstract Background Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent–offspring trios and proband only analysis. Methods We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. Results Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. Conclusion CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Abstract Abnormal hemoglobin anti-Lepore Hong Kong is a rare βδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of β0-thalassemia and α-thalassemia (–SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with β0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2–40.8%) and behaved with β-thalassemia trait. Furthermore, determination of the α/β-mRNA ratio revealed a slight downregulation of β-globin, similar to that of β-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, β0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

ABSTRACTBackground Hb Chapel Hill [Alpha2 74(EF3) Asp > Gly] results from an GAC > GGC substitution at codon 74 of the HBA1 or HBA2 genes. Hb Chapel Hill has not been reported since 1986.Methods A heterozygous mutation, HBA2: c.224A > G, was identified in the proband, her father and sister. We compared the haematological and clinical data of this family with the data reported in the limited number of individuals.Results Having excluded iron deficiency, the Hb Chapel Hill was asymptomatic in heterozygous state. The cases presented here characterize cases in new techniques including capillary electrophoresis (CE). Two aberrant peaks were identified by CE, a major peak migrating in the zone 7 that correspond to Hb Chapel Hill (αChapel Hill 2β2) and a minor peak migrating in the zone 1 that correspond to Hb Chapel Hill2 (αChapel Hill 2δ2). Focusing on the variant expression, the Hb Chapel Hill plus Hb A2 variant were around 18.9–20.6% of total Hb in three members.Conclusion This data will be useful for providing up-to-date and high quality information on the Hb Chapel Hill.

ABSTRACTObjective In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (–α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation.Methods Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants.Results Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (–α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (–α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (–α4.2/) deletion allele.Conclusions Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (−α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.

Abstract Background At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. Methods We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. Results Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). Conclusion We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Objectives Here we report two rare α-globin chain variants in two unrelated families: Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C] and Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. Notably, HBA2: c.400A > C is an unreported new variant in the third exon of the α2 gene, and simple heterozygous unstable Hb Dongguan haematological characteristics are proposed for the first time.Methods Hb analysis was performed by using capillary electrophoresis (CE). Twenty-three common mutations were detected using a suspension array system. Mutations were identified by DNA sequencing.Results The CE results showed an abnormal peak with incomplete separation from Hb A at zone 8 in two members of Family 1. DNA sequencing confirmed the presence of Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C]. Five members of Family 2 exhibited an abnormal peak at zone 11, and DNA sequencing confirmed the presence of Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G].Conclusions The discovery of HBA2: C.400A > C expands the existing spectrum of α-globin variants. The carriers of simple heterozygous Hb Dongguan generally do not have obvious clinical symptoms. The information in this study will help clinicians understand the screening, molecular diagnosis and clinical significance of Hb variants.

Objective The 3.7 kb deletion (-α3.7) in the α-globin cluster, which characterizes α+-thalassemia, has been reported to have a carrier rate of 4.78% in southern China. Three -α3.7 subtypes have been identified worldwide. However, the -α3.7 III subtype has not previously been identified in China. Herein, we reported identification of the -α3.7 III subtype in a Chinese patient.Methods We used gap-PCR and a liquid chip system to detect α-thalassemia mutations. Multiple ligation-dependent probe amplification was performed to detect the large deletion. We finally used Sanger sequencing and single molecule real-time sequencing to characterize and confirm the genotype.Results The proband, characterized as -α3.7 III heterozygous, showed microcytosis and hypochromic red cells, with a mean corpuscular volume of 78 fL and mean corpuscular hemoglobin of 25.4 pg. The proband’s mutation was inherited from her father, who had normal blood parameters.Conclusion We first identified the -α3.7 III subtype in China. Consequently, all -α3.7 subtypes have now been identified in the Chinese population. Therefore, attention should be paid to -α3.7 III in clinical prenatal diagnosis, given that commonly used methods such as gap-PCR may lead to misdiagnosis or missed diagnosis.

Background The α-thalassemia is a highly prevalent disease in tropical and subtropical regions, including southern China, and is mainly caused by deletion in α-globin genes (HBA1 and HBA2). The clinical manifestation of α-thalassemia is highly correlated with the copy number of α-globin genes. The decrease in copy number results in α-thalassemia, while duplication or triplication compounded with β-thalassemia may aggravate the clinical manifestation. However, the common methods used to measure the copy number variants can only detect the three common types: –SEA, -α3.7, and -α4.2, and may easily miss the rare deletional type and duplication or triplication cases. Therefore, a new method that allows the detection of different copy number variants in α-globin genes simultaneously and accurately needs to be established. Methods A total of 428 peripheral-blood and fetal chorionic villus or amniotic fluid samples were used in this study. We employed a pair of primers and two probes, one for HBA1 and another for HBA2, to perform droplet digital polymerase chain reaction (ddPCR). Each reaction needed the ddPCR of RPP30 as a reference gene to calculate the copy number. Results We accurately detected the copy number variants in α-globin genes, including the common form α-thalassemia, triplications such as αααanti4.2, and trisomy 16, by performing only two reactions. The accuracy rate for detecting the copy number of α-globin genes was up to 100%. Conclusion In conclusion, ddPCR served as an accurate and rapid method for detecting copy number variations in the clinical screening for α-thalassemia.

Hemoglobin Santa Ana [β88(F4)Leu→Pro (CTG > CCG) HBB: c.266T > C] is an unstable hemoglobin variant characterized by a substitution of the amino acid leucine by proline at the 88th position of the β-globin chain. We for the first time identified this hemoglobin variant in a Chinese patient by capillary electrophoresis (CE). The proband was an 8-year-old boy with chronic anemia, brown urine and splenomegaly. He had been affected by moderate anemia, twice approaching a severe degree, that was attributed to infection. The CE result revealed an abnormal hemoglobin peak at electrophoretic zone 4 that correspond to the hemoglobin Santa Ana peak, and a CTG > CCG mutation at codon 88 of the β-globin gene was confirmed by DNA sequencing. To avoid misdiagnosis and genetic risks, a literature review of other unstable hemoglobins that migrate similarly to the hemoglobin Santa Ana was performed. Our findings indicate that hemoglobin Santa Ana can be clearly separated by CE, with accurate diagnosis depending on molecular analysis. This information will be useful for providing appropriate genetic counselling and for prenatal diagnosis.

Abstract Introduction Although over 1000 hemoglobin (Hb) variants were identified so far, Hb Port Phillip compound with α‐thalassemia deletion had no reported before. Methods Two patients and the associated families from Guangdong province in China were recruited. Hematological parameters were determined by blood routine examination and hemoglobin electrophoresis. Genotyping was performed by Gap‐PCR and Sanger sequencing. Results One patient was diagnosed as Hb Port Phillip, while her daughter was compounded with ‐α4.2 deletion, with normal Hb level (150 g/L), mean corpuscular volume (MCV) 108.4 fl and mean corpuscular hemoglobin (MCH) (30.5 pg). Another patient was diagnosed as compound Hb Port Phillip and ‐‐SEA deletion. This proband presented with more severe α‐thalassemia trait than the patient compounded with ‐α4.2 deletion, with hemoglobin 80 g/L, MCV 61.7 fl, and MCH 18.7 pg. Conclusion Here we first time identified two patients compound with Hb Port Phillip and ‐α4.2 and ‐‐SEA deletions, respectively, which had never been reported. Our study widens the genotypes of hemoglobinopathy and provides reference for genetic counselling and prenatal diagnosis in this population.

We report on a fetus with cardiomegaly and increased middle cerebral artery-peak systolic velocity at 25 weeks of gestation. Severe fetal anemia (hemoglobin (Hb) level 37 g/L) was confirmed by cordocentesis. Hb analysis showed that Hb Bart’s was 9% in cord blood. Molecular analysis of the proband’s family found that the mother was a carrier of Hb Quong Sze (Hb QS, HBA2 :c.377T>C), the father was a carrier of Hb Zurich-Albisrieden (Hb ZA, HBA2 :c.178G>C), and the fetus was a compound heterozygote for Hb ZA and Hb QA. Despite intrauterine blood transfusions, the fetus experienced problems including oligohydramnios, growth retardation, placental thickening, and heart enlargement in the third trimester. The couple chose to terminate the pregnancy, and fetal autopsy confirmed the above diagnosis. This is the first report of a case of Hb ZA compounded with Hb QS, and provides a reference for genetic counselling and prenatal diagnosis in the Chinese population.

We report two unrelated cases of compound heterozygosity for hemoglobin (Hb) variant Broomhill and the Southeast Asian (- - SEA /) α-thalassemia deletion, whose clinical features and laboratory findings have never been reported. Hematological analyses revealed abnormal values for both cases as α-thalassemia traits, and capillary electrophoresis suggested an abnormal peak that was incompletely separated from the Hb A peak. A suspension array system and Sanger sequencing were used to characterize the genotypes. Sanger sequencing confirmed the presence of Hb Broomhill [α114(GH2)Pro→Ala; HBA1 : c.343C>G]. Eventually, both cases were accurately diagnosed as compound heterozygotes for Hb Broomhill and the (- - SEA /) α-thalassemia deletion, which is the first known report of these variants. This information will be useful when providing appropriate genetic counselling and prenatal diagnosis.

Immunochromatographic sensors (ICSs) are inexpensive, simple, portable, and robust, thus making ICSs commonplace in clinical diagnoses, food testing, and environmental monitoring. However, commonly used gold nanoparticles (AuNPs) ICSs have low sensitivity. Therefore, we developed highly sensitive surface enhanced Raman scattering (SERS) ICSs. To enhance the sensitivity of SERS ICSs, rough surface core-shell Au@Ag nanoparticles (RSAu@AgNPs) were prepared by coating silver on the surface of gold nanoflowers (AuNFs). Then these nanoparticles were used as SERS substrate in the SERS ICSs, after which the SERS ICSs were implemented to detect haemoglobin and heavy metal cadmium ion (Cd2+). The limit of detection (LOD) of the SERS ICSs for detecting haemoglobin was 8 ng/mL, and the linear range of the SERS ICSs was from 31.3 to 2000 ng/mL. The LOD of the SERS ICSs for detecting Cd2+ was 0.05 ng/ mL and the linear analysis range was from 0.05 to 25 ng/mL. The cross reactivity of the SERS ICSs was studied and results showed that the SERS ICSs exhibited highly specific for detection of haemoglobin and Cd2+, respectively. The SERS ICSs were then used to detect haemoglobin (spiked in serum and in stool) and Cd2+ (spiked in tap water, river water, and soil leaching water), and the results showed high recovery. These characteristics indicated that SERS ICSs were ideal tools for clinical diagnosis and environmental pollution monitoring. [ABSTRACT FROM AUTHOR]