Search

We herein report the fabrication strategy of a robust catalyst for the formic acid electro-oxidation reaction (FAOR) via combining the advantages of a TiO 2 -related support and the synergistic effects of NiPtCo alloy. With the predominant dehydrogenation pathway, the NiPtCo/Ti 0.7 W 0.3 O 2 catalyst shows remarkable FAOR mass activity and specific activity of 0.45 A mg Metal -1 and 1.25 mA cm -2 , being 3.75- and 4.81-time higher than those of the commercially available Pt/C, respectively. The as-made FAOR electrocatalyst shows superior CO-tolerance and electrocatalytic stability during long-term operation conditions due to the synergistic contributions of each component in the overall catalyst system.

Hydrogels have emerged as potential materials for bone grafting, thanks to their biocompatibility, biodegradation, and flexibility in filling irregular bone defects. In this study, we fabricated a novel NAH hydrogel system, composed of N,O-carboxymethyl chitosan (NOCC), aldehyde hyaluronic acid (AHA), and hydroxyapatite (HAp). To improve the mechanical strength of the fabricated hydrogel, a porous polycaprolactone (PCL) matrix was synthesized and used as a three-dimensional (3D) support template for NAH hydrogel loading, forming a novel PCL/NAH hybrid scaffold. A mixture of monosodium glutamate (M) and sucrose (S) at varied weight ratios (5M:5S, 7M:3S, and 9M:1S) was used for the fabrication of 3D PCL matrices. The morphology, interconnectivity, and water resistance of the porous PCL scaffolds were investigated for optimal hydrogel loading efficiency. The results demonstrated that PCL scaffolds with porogen ratios of 7M:3S and 9M:1S possessed better interconnectivity than 5M:5S ratio. The compressive strength of the PCL/NAH hybrid scaffolds with 9M:1S (561.6 ± 6.1 kPa) and 7M:3S (623.8 ± 6.8 kPa) ratios are similar to cancellous bone and all hybrid scaffolds were biocompatible. Rabbit models with tibial defects were implanted with the PCL/NAH scaffolds to assess the wound healing capability. The results suggest that the PCL/NAH hybrid scaffolds, specifically those with porogen ratio of 7M:3S, exhibit promising bone healing effects., (© 2024 Wiley Periodicals LLC.)

Dynamic hydrogel systems from N,O-carboxymethyl chitosan (NOCC) are investigated in the past years, which has facilitated their widespread use in many biomedical engineering applications. However, the influence of the polymer's oxidation levels on the hydrogel biological properties is not fully investigated. In this study, chitosan is converted into NOCC and introduced to react spontaneously with oxidized xanthan gum (OXG) to form several injectable hydrogels with controlled degradability. Different oxidation levels of xanthan gum, as well as NOCC/OXG volume ratios, are trialed. The infrared spectroscopy spectra verify chemical modification on OXG and successful crosslinking. With increasing oxidation levels, more dialdehyde groups are introduced into the OXG, resulting in changes in physical properties including gelation, swelling, and self-healing efficiency. Under different volume ratios, the hydrogel shows a stable structure and rigidity with higher mechanical properties, and a slower degradation rate. The shear-thinning and self-healing properties of the hydrogels are confirmed. In vitro assays with L929 cells show the biocompatibility of all formulations although the use of a high amount of OXG15 and OXG25 limited the cell proliferation capacity. Findings in this study suggested a suitable amount of OXG at different oxidation levels in NOCC hydrogel systems for tissue engineering applications., (© 2023 Wiley-VCH GmbH.)

In this study, we employ the framework of first-principles density functional theory (DFT) computations to investigate the physical, electrical, bandgap and thermal conductivity of Cs 2 AgInCl 6 -CAIC (type I) and Cs 2 AgSbCl 6 -CASC (type II) using the GGA-PBE method. CAIC possesses a direct band gap energy of 1.812 eV, while CASC demonstrates an indirect band gap energy of 0.926 eV. The CAIC and CASC exhibit intriguingly reduced thermal conductivity, which can be attributed to the notable reduction in their respective Debye temperatures, measuring 182 K and 135 K, respectively. The Raman active modes computed under ambient conditions have been compared with real-world data, showing excellent agreement. The thermal conductivity values of CAIC and CASC compounds exhibit quantum mechanical characteristics, with values of 0.075 and 0.25 W m -1 K -1 , respectively, at 300 K. It is foreseen that these outcomes will generate investigations concerning phosphors and diodes that rely on single emitters, with the aim of advancing lighting and display technologies in the forthcoming generations.

Graphitic carbon nitride (CN) is a cost-effective and easily synthesized supercapacitor electrode material. However, its limited specific capacity has hindered its practical use. To address this, we developed a binary nanostructure by growing nanosized Co 3 O 4 particles on CN. The CN-Co-2 composite, synthesized via thermal decomposition, exhibited a remarkable specific capacity of 280.64 C/g at 2 A/g. Even under prolonged cycling at 10.5 A/g, the retention rate exceeded 95%, demonstrating exceptional stability. In an asymmetric capacitor device, the CN-Co composite delivered 20.84 Wh/kg at 1000 W/kg, with a retention rate of 99.97% over 20,000 cycles, showcasing outstanding cycling stability. Controlled cobalt source adjustments yielded high-capacity electrode materials with battery-like behavior. This optimization strategy enhances energy density by retaining battery-like properties. In summary, the CN-Co composite is a promising, low-cost, easily synthesized electrode material with a high specific capacity and remarkable cycling stability, making it an attractive choice for energy storage applications.

The exploration of novel electrocatalysts for CO 2 reduction is necessary to overcome global warming and the depletion of fossil fuels. In the current study, the electrocatalytic CO 2 reduction of [Re(CO) 3 Cl( N - N )], where N - N represents 3-(2-pyridyl)-1,2,4-triazole (Hpy), 3-(pyridin-2-yl)-5-phenyl-l,2,4-triazole (Hph), and 2,2'-bipyridine-4,4' dicarboxylic acidic (bpy-COOH) ligands, was investigated. In CO 2 -saturated electrolytes, cyclic voltammograms showed an enhancement of the current at the second reduction wave for all complexes. In the presence of triethanolamine (TEOA), the currents of Re(Hpy), Re(Hph), and Re(bpy-COOH) enhanced significantly by approximately 4-, 2-, and 5-fold at peak potentials of -1.60, -150, and -1.69 V Ag/Ag+ , respectively (in comparison to without TEOA). The reduction potential of Re(Hph) was less negative than those of Re(Hpy) and Re(COOH), which was suggested to cause its least efficiency for CO 2 reduction. Chronoamperometry measurements showed the stability of the cathodic current at the second reduction wave for at least 300 s, and Re(COOH) was the most stable in the CO 2 -catalyzed reduction. The appearance and disappearance of the absorption band in the UV/vis spectra indicated the reaction of the catalyst with molecular CO 2 and its conversion to new species, which were proposed to be Re- DMF + and Re- TEOA and were supposed to react with CO 2 molecules. The CO 2 molecules were claimed to be captured and inserted into the oxygen bond of Re- TEOA , resulting in the enhancement of the CO 2 reduction efficiency. The results indicate a new way of using these complexes in electrocatalytic CO 2 reduction., Competing Interests: The authors declare no competing financial interest., (© 2022 The Authors. Published by American Chemical Society.)

A synergistic multilayer membrane design is necessary to satisfy a multitude of requirements of an ideal wound dressing. In this study, trilayer dressings with asymmetric wettability, composed of electrospun polycaprolactone (PCL) base membranes coated with oligomer chitosan (COS) in various concentrations of polyvinylpyrrolidone (PVP), are fabricated for wound dressing application. The membranes are expected to synergize the hygroscopic, antibacterial, hemostatic, and biocompatible properties of PCL and COS. The wound dressing was coated by spraying the solution of 3% COS and 6% PVP on the PCL base membrane (PVP6-3) three times, which shows good interaction with biological subjects, including bacterial strains and blood components. PVP6-3 samples confirm the diameter of inhibition zones of 20.0 ± 2.5 and 17.9 ± 2.5 mm against Pseudomonas aeruginosa and Staphylococcus aureus , respectively. The membrane induces hemostasis with a blood clotting index of 74% after 5 min of contact. In the mice model, wounds treated with PVP6-3 closed 95% of the area after 10 days. Histological study determines the progression of skin regeneration with the construction of granulation tissue, new vascular systems, and hair follicles. Furthermore, the newly-growth skin shares structural resemblances to that of native tissue. This study suggests a simple approach to a multi-purpose wound dressing for clinical treatment.

A series of Zr-based metal-organic frameworks was prepared via the solvothermal route using sulfonic-rich linkers for the efficient capture of Pb 2+ ions from aqueous medium. The factors affecting adsorption such as the solution pH, adsorbent dosage, contact time, adsorption isotherms, and mechanism were studied. Consequently, the maximum adsorption capacity of Pb 2+ on the acidified VNU-23 was determined to be 617.3 mg g -1 , which is much higher than that of previously reported adsorbents and MOF materials. Furthermore, the adsorption isotherms and kinetics of the Pb 2+ ion are in good accordance with the Langmuir and pseudo-second-order kinetic model, suggesting that the uptake of Pb 2+ is a chemisorption process. The reusability experiments demonstrated the facile recovery of the H + ⊂VNU-23 material through immersion in an HNO 3 solution (pH = 3), where its Pb 2+ adsorption efficiency still remained at about 90% of the initial uptake over seven cycles. Remarkably, the adsorption mechanism was elucidated through a combined theoretical and experimental investigation. Accordingly, the Fourier transform infrared spectroscopy (FT-IR), Raman spectroscopy, scanning electron microscopy connected to energy-dispersive X-ray mapping (SEM-EDX-mapping), and X-ray photoelectron spectroscopy (XPS) analysis of the Pb⊂VNU-23 sample and comparison with H + ⊂VNU-23 confirmed that the electrostatic interaction occurs via the interaction between the SO 3 - moieties in the framework and the Pb 2+ ion, leading to the formation of a Pb-O bond. In addition, the density functional theory (DFT) calculations showed the effective affinity of the MOF adsorbent toward the Pb 2+ ion via the strong driving force mentioned in the experimental studies. Thus, these findings illustrate that H + ⊂VNU-23 can be employed as a potential adsorbent to eliminate Pb 2+ ions from wastewater.

The gas-phase structures of the fruit ester methyl hexanoate, CH 3 -O-(C=O)-C 5 H 11 , have been determined using a combination of molecular jet Fourier-transform microwave spectroscopy and quantum chemistry. The microwave spectrum was measured in the frequency range of 3 to 23 GHz. Two conformers were assigned, one with C s symmetry and the other with C 1 symmetry where the γ-carbon atom of the hexyl chain is in a gauche orientation in relation to the carbonyl bond. Splittings of all rotational lines into doublets were observed due to internal rotation of the methoxy methyl group CH 3 -O, from which torsional barriers of 417 cm -1 and 415 cm -1 , respectively, could be deduced. Rotational constants obtained from geometry optimizations at various levels of theory were compared to the experimental values, confirming the soft degree of freedom of the (C=O)-C bond observed for the C 1 conformer of shorter methyl alkynoates like methyl butyrate and methyl valerate. Comparison of the barriers to methyl internal rotation of methyl hexanoate to those of other CH 3 -O-(C=O)- R molecules leads to the conclusion that though the barrier height is relatively constant at about 420 cm -1 , it decreases in molecules with longer R .

Background: Malignant melanoma is a common malignant tumor and one of the tumors with the fastest growing incidence. The effect of microRNAs on the biological processing of malignant melanoma cells also have been reported. This study explores the ability of miR-498 to regulate the progression of malignant melanoma cells. Methods: The expression of miR-498 was detected by RT-qPCR. The proliferation, invasion, and migration of malignant melanoma cells were measured by cell counting kit-8, clone formation, and transwell assays. Flow cytometry assay detected the percentage of apoptotic cells. Western blot was used to detect the expression of markers related to epithelial-mesenchymal transition. The correction of miR-498 and UBE2T was explored by dual-luciferase assay and Western blot. Results: Overexpression of miR-498 inhibited the proliferation, invasion, migration, and induced cell apoptosis of M14 and A375 cells. In addition, the expression of epithelial-mesenchymal transition-related factors was altered by the overexpression of miR-498. miR-498 can directly target UBE2T 3'-UTR and inhibit UBE2T protein expression. The overexpression of UBE2T reversed the inhibitory effects of miR-498 on the progression of malignant melanoma cells. Furthermore, UBE2T mRNA was significantly highly expressed in malignant melanoma tissues. The high expression of UBE2T was associated with the poor overall survival rate of malignant melanoma patients. Conclusions: Altogether, our findings demonstrated that miR-498 significantly inhibited the proliferation, invasion, migration, and induced apoptosis of malignant melanoma cells and confirmed that miR-498 regulated malignant melanoma cell progression by targeting UBE2T.

In this study, the effect of coated hydrogel layer on characteristics of the whole gelatin/silver nanoparticles multi-coated polycaprolactone membrane (PCLGelAg) was investigated through systematic and typical wound dressing characterizations to select the optimal number of layers for practical applications. Scanning electron microscopy, free swell absorptive capacity and tensile test in both wet and dry conditions were conducted to characterize all fabricated membranes of six coating times. In vitro cytotoxicity and agar diffusion evaluation were also carried out to assess the biocompatibility and antibacterial activity of the membranes. The findings illustrated that as the coated layers increase, the absorptive capacity, and degradation rate were higher, the membranes were stiffer in dry state while the tensile strength in wet state, elongation, and cell viability were significantly decreased. PCLGelAg3 was chosen to be the best fit for wound healing since it maintained quite sufficient maximum buffer uptake, elasticity, cell viability along with inducing abnormalities in bacterial morphology and preventing biofilm formation., (© 2021 Wiley Periodicals LLC.)

Herbicide compounds containing aromatic rings and chlorine atoms, such as 2,4,5-trichlorophenoxyacetic (2,4,5-T), cause serious environmental pollution. Furthermore, these compounds are very difficult to decompose by chemical, physical, and biological techniques. Fortunately, the high-voltage direct current electrochemical technique can be controlled to form a plasma on metallic electrodes. It creates active species, such as H 2 , O 2 , and H 2 O 2 , and free radicals, such as H • , O • , and OH • . Free radicals that have a high oxidation potential (e.g., OH • ) are highly effective in oxidizing benzene-oring compounds. Iron electrodes are used in the study to combine the dissolving process of the iron anode electrode to create Fe 2+ ions and the electrochemical Fenton reaction. In addition, the flocculation process by Fe(OH) 2 also occurs and the plasma appears with a voltage of 5 kV on the iron electrode in a solution of 30 mg L -1 of 2,4,5-T. After a period of time of the reaction, the aromatic-oring compounds containing chlorine were effectively treated, and the electric conductivity of the solution increased due to the amount of Cl - ions released in the solution and the decrease in the pH value. The degradable products of 2,4,5-T were qualitatively characterized by gas chromatography-mass spectrometry (GC-MS), and it was determined that straight-chain carboxylic acids are formed in the solution. These compounds are easy to oxidize thoroughly under appropriate conditions in a solution via OH • free radicals. Moreover, 2,4,5-T was also quantitatively analyzed using a calibration curve from GC-MS and high-performance liquid chromatography (HPLC). Furthermore, this work also suggests that the performance of the treatment process can be optimized by controlling the technological factors, such as the input voltage, the distance between anodic and cathodic electrodes, the initial concentration of 2,4,5-T, and flowing air through the solution that represents an approximately 99.83% degradable efficiency. Finally, the work demonstrates a potential technology for treating the 2,4,5-T compound, particularly for environmental pollution treatments., Competing Interests: The authors declare no competing financial interest., (© 2021 The Authors. Published by American Chemical Society.)

The neuron derived synaptic adhesion molecular neuroligin-3 (NLGN3) plays an important role in glioma growth. While the role of autocrine NLGN3 in glioma has not been well-studied. The expression of NLGN3 in glioma was detected using immunohistochemistry. We further explored its function and regulatory mechanism in U251 and U87 cells with high expression of NLGN3. Knockdown of endogenous NLGN3 significantly reduced the proliferation, migration, and invasion of glioma cells and down-regulated the activity of the PI3K-AKT, ERK1/2, and LYN signaling pathways. In comparison, overexpression of NLGN3 yielded opposite results. Our results further demonstrate that LYN functions as a feedback mechanism to promote NLGN3 cleavage. This feedback regulation was achieved by upregulating the ADAM10 sheddase responsible for NLGN3 cleavage. Inhibition of ADAM10 suppressed the proliferation, migration, and invasion of glioma cells; oppositely, the expression of ADAM10 was correlated with a higher likelihood of lower grade glioma (LGG) in the brain. Our study demonstrates that glioma-derived NLGN3 promotes glioma progression by upregulating activity of LYN and ADAM10, which in turn promote NLGN3 cleavage to form a positive feedback loop. This pathway may open a potential therapeutic window for the treatment of human glioma., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Dang, Li, Zhang, Han, Fan and Huang.)

We developed and designed a bifacial four-terminal perovskite (PVK)/crystalline silicon (c-Si) heterojunction (HJ) tandem solar cell configuration albedo reflection in which the c-Si HJ bottom sub-cell absorbs the solar spectrum from both the front and rear sides (reflected light from the background such as green grass, white sand, red brick, roofing shingle, snow, etc.). Using the albedo reflection and the subsequent short-circuit current density, the conversion efficiency of the PVK-filtered c-Si HJ bottom sub-cell was improved regardless of the PVK top sub-cell properties. This approach achieved a conversion efficiency exceeding 30%, which is higher than those of both the top and bottom sub-cells. Notably, this efficiency is also greater than the Schockley-Quiesser limit of the c-Si solar cell (approximately 29.43%). The proposed approach has the potential to lower industrial solar cell production costs in the near future., (© 2021. The Author(s).)

Hematin has been used as an alternative enzyme catalyst to horseradish peroxidase (HRP) due to its iron-containing activity center. Although hematin and it derivatives have been widely used for polymerization of phenol/analine compounds, it has some drawbacks such as the limited solubility and reaction only at high pH condition. Herein, we report a nanosized biomimetic catalyst, hematin-decorated polyamidoamine dendrimer (G3.0-He) that can effectively catalyze the in situ hydrogelation of phenol-conjugated polymers under neutral pH condition. We demonstrate that G3.0-He particles are smaller than 100 nm and have excellent enzyme-mimetic functions. Interestingly, the nanosized catalyst is not inactivated at high H 2 O 2 concentration. Compared to pure hematin, G3.0-He has significantly higher dispersion in acidic and neutral media, and preserves the percentage of survival of fibroblasts over 90%. Notably, G3.0-He possesses an exquisite HRP-mimicking activity in gelation of gelatin derivative with phenolic hydroxyl (tyamine) moieties under mild physiological conditions. The in vitro study demonstrated that Gel-Tyr hydrogel by G3.0-He catalyzed reaction had excellent cytocompatibility and an excellent scaffold for adhesion to fibroblast cells. Therefore, the designed minimalistic G3.0-He catalyst could serve as an effective catalytic alternative for HRP enzyme in the preparation of biomedical hydrogels., (Copyright © 2021 Elsevier B.V. All rights reserved.)

Malignant melanoma is a type of very dangerous skin cancer. Histone modifiers usually become dysregulated during the process of carcinoma development, thus there is potential for a histone modifier inhibitor as a useful drug for cancer therapy. There is a multitude of evidence regarding the role of G9a, a histone methyltransferase (HMTase), in tumorigenesis. In this study, we first showed that G9a was significantly upregulated in melanoma patients. Using the TCGA database, we found a significantly higher expression of G9a in primary melanoma samples (n = 461) compared to normal skin samples (n = 551). Next, we knocked down G9a in human M14 and A375 melanoma cell lines in vitro via small interfering RNA (siRNA). This resulted in a significant decrease in cell viability, migration and invasion, and an increase in cell apoptosis. UNC0642 is a small molecule inhibitor of G9a that demonstrates minimal cell toxicity and good in vivo pharmacokinetic characteristics. We investigated the role of UNC0642 in melanoma cells, and detected its anti-cancer effects in vitro and in vivo . Next, we treated cells with UNC0642, and observed a significant decrease in cell viability in M14 and A375 cell lines. Furthermore, treatment with UNC0642 resulted in increased apoptosis. In immunocompetent mice bearing A375 engrafts, treatment with UNC0642 inhibited tumor growth. Results of Western blot analysis revealed that administration of UNC0642 or silencing of G9a expression by siRNA reduced Notch1 expression significantly and decreased the level of Hes1 in A375. All in all, the data from our study demonstrates potential of G9a as a therapeutic target in the treatment of melanoma.

The purpose of this research is to investigate the effect of different oxidation degrees and volume ratios of components on the physical properties and biocompatibility of an in situ cross-linking chitosan-hyaluronic acid-based hydrogel for skin wound healing applications. Carboxymethyl groups (-CH 2 COOH) were introduced to the polymer chain of chitosan, producing N,O - Carboxymethyl Chitosan (NOCC). Hyaluronic acid was oxidized to obtain aldehyde hyaluronic acid (AHA) with three oxidation degrees (AHA40, AHA50 and AHA60). The gelation was induced by forming Schiff base linkage between aldehyde groups of AHA and amino groups of NOCC. Then, the polysaccharide derivatives were combined at three NOCC:AHA volume ratios (3:7, 5:5 and 7:3) to form composite hydrogels without using any additional cross-linker. FT-IR analysis, surface morphology observation and wettability test, in vitro degradation test and rheological analysis were carried out to characterize the hydrogels. Additionally, in vitro cytotoxicity and in vivo wound healing evaluations were also conducted to study the biocompatibility of the composite. Our findings showed that when increasing the volume of NOCC, the homogeneity and hydrophobicity of the resulting hydrogels were also improved and their pore walls became thicker, leading to slower degradation rate. On the other hand, when raising the oxidation degree of AHA, the hydrophilicity of the gels decreased and less time was required to form the gel matrix. Besides, the obtained in vitro and in vivo results indicated that lower oxidation degree of AHA supports cell proliferation, cell attachment and wound healing process better. It is also concluded that NOCC-AHA40 5:5 hydrogel is most suitable for skin wound healing applications since it possesses superior morphology with high uniformity, favorable pore size and suitable density along with appropriate wettability. The NOCC-AHA gel matrix is expected to be used as a delivery system for other factors and employed as an effective bio-glue in further tissue engineering applications., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Psoriasis-specific proteins dysregulated in keratinocytes and involved in the pathophysiological process of psoriasis remains elusive. We report here that epidermal galectin-3 expression is significantly downregulated in lesional skin, but not in non-lesional skin in psoriasis patients, nor in a group of diseases known as psoriasiform dermatitis clinically and histologically similar to psoriasis. The deficiency of epidermal galectin-3 is sufficient to promote development of psoriatic lesions, as evidenced by more severe skin inflammation in galectin-3 knockout (gal3 -/- ) mice, compared to wild-type mice, after imiquimod treatment, and in skin from gal3 -/- mice grafted onto wildtype mice. The development of psoriatic-like lesions is attributable to 1) the spontaneously tuning up of psoriasis signatures in keratinocytes through JNK pathway; and 2) neutrophil accumulation caused by the enhanced leukocyte-recruiting capacity associated with overexpression of S100A7-9 and CXCL-1, 8 in keratinocytes with impaired galectin-3 expression. Psoriasis-like skin inflammation is significantly improved in gal-3 -/- mice both by inhibition of neutrophils accumulation with a selective CXCR2 antagonist of SB225002, and by intracutaneous injection of recombinant galectin-3. Overall, these findings offer promising galectin-3-related diagnostic and therapeutic resolutions of psoriasis., (Copyright © 2017 Elsevier Ltd. All rights reserved.)

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

The inserted (I) domain of αLβ2 integrin (LFA-1) contains the entire binding site of the molecule. It mediates both rolling and firm adhesion of leukocytes at sites of inflammation depending on the activation state of the integrin. The affinity change of the entire integrin can be mimicked by the I domain alone through mutations that affect the conformation of the molecule. High-affinity mutants of the I domain have been discovered previously using both rational design and directed evolution. We have found that binding affinity fails to dictate the behavior of I domain adhesion under shear flow. In order to better understand I domain adhesion, we have developed a novel panning method to separate yeast expressing a library of I domain variants on the surface by adhesion under flow. Using conditions analogous to those experienced by cells interacting with the post-capillary vascular endothelium, we have identified mutations supporting firm adhesion that are not found using typical directed evolution techniques that select for tight binding to soluble ligands. Mutants isolated using this method do not cluster with those found by sorting with soluble ligand. Furthermore, these mutants mediate shear-driven cell rolling dynamics decorrelated from binding affinity, as previously observed for I domains bearing engineered disulfide bridges to stabilize activated conformational states. Characterization of these mutants supports a greater understanding of the structure-function relationship of the αL I domain, and of the relationship between applied force and bioadhesion in a broader context.

The intracellular signaling molecule TRAF6 is critical for Toll-like receptor (TLR)-mediated activation of dendritic cells (DCs). We now report that DC-specific deletion of TRAF6 (TRAF6ΔDC) resulted, unexpectedly, in loss of mucosal tolerance, characterized by spontaneous development of T helper 2 (Th2) cells in the lamina propria and eosinophilic enteritis and fibrosis in the small intestine. Loss of tolerance required the presence of gut commensal microbiota but was independent of DC-expressed MyD88. Further, TRAF6ΔDC mice exhibited decreased regulatory T (Treg) cell numbers in the small intestine and diminished induction of iTreg cells in response to model antigen. Evidence suggested that this defect was associated with diminished DC expression of interleukin-2 (IL-2). Finally, we demonstrate that aberrant Th2 cell-associated responses in TRAF6ΔDC mice could be mitigated via restoration of Treg cell activity. Collectively, our findings reveal a role for TRAF6 in directing DC maintenance of intestinal immune tolerance through balanced induction of Treg versus Th2 cell immunity., (Copyright © 2013 Elsevier Inc. All rights reserved.)

Background and Objective: Limitations of current periodontal regeneration modalities in both predictability and extent of healing response, especially on new cementum and attachment formation, underscore the importance of restoring or providing a microenvironment that is capable of promoting the differentiation of periodontal ligament stem cells (PDLSCs) towards cementoblast-like cells and the formation of cementum/periodontal ligament-like tissues. The aim of this study was to investigate the biological effect of conditioned medium from developing apical tooth germ cells (APTG-CM) on the differentiation and cementogenesis of PDLSCs both in vitro and in vivo., Material and Methods: Using the limiting dilution technique, single-colony-derived human PDLSCs were isolated and expanded to obtain homogeneous populations of PDLSCs. Morphological appearance, cell cycle analysis, bromodeoxyuridine incorporation, alkaline phosphatase (ALP) activity, mineralization behavior, gene expression of cementoblast phenotype and in vivo differentiation capacities of PDLSCs co-cultured with APTG-CM were evaluated., Results: The induced PDLSCs exhibited several characteristics of cementoblast lineages, as indicated by the morphological changes, increased proliferation, high ALP activity, and the expression of cementum-related genes and calcified nodule formation in vitro. When transplanted into immunocompromised mice, the induced PDLSCs showed tissue-regenerative capacity to produce cementum/periodontal ligament-like structures, characterized by a layer of cementum-like mineralized tissues and associated periodontal ligament-like collagen fibers connecting with the newly formed cementum-like deposits, whereas control, untreated PDLSCs transplants mainly formed connective tissues., Conclusion: Our findings suggest that APTG-CM is able to provide a cementogenic microenvironment and induce differentiation of PDLSCs along the cementoblastic lineage. This has important implications for periodontal engineering.

Aim: To investigate the expression pattern of epithelial cell adhesion molecule (Ep-CAM) on normal and malignant colon tissues to evaluate its diagnostic and therapeutic significance., Methods: cDNA encoding Ep-CAM extracellular domain was cloned by reverse transcription-polymerase chain reaction (RT-PCR) from excised malignant colon tissues and inserted into a glutathione S-transferase (GST)-tagged vector. Ep-CAM-GST fusion protein was induced by isopropyl-beta-D-thiogalactopyranoside (IPTG) and purified with glutathione-sepharose. The Ep-CAM-GST fusion protein was mixed with Freund's adjuvant and Balb/c mice were immunized with it. Sp2/0 myeloma cells were fused with the spleen cells of the immunized mice. After having selected by indirect ELISA, the anti-Ep-CAM monoclonal antibodies (MAbs) were generated and the corresponding ascites were obtained. Finally, the human colon carcinoma tissue array prepared from seventy individual patients was stained with the anti-Ep-CAM MAbs., Results: The isolated Ep-CAM cDNA sequence was identical to the data in GenBank. The expressed fusion protein was almost soluble and had a molecular weight (MW) of 53 ku. Four MAbs against Ep-CAM were obtained and designated as FMU-Ep1, FMU-Ep2, FMU-Ep3 and FMU-Ep4 respectively. Among them, FMU-Ep4 could recognize the natural Ep-CAM on Colo205 and SW480 cells, and all of them could be used for immunohistochemical staining of tissue sections. It was found that Ep-CAM was distributed differently in normal and various malignant colon tissues, including squamous cell carcinoma, signet-ring cell carcinoma and adenocarcinoma. In normal colon gland epithelia, Ep-CAM antigen was mainly distributed on the basolateral membrane and in the region between the basolateral membrane and the cytoplastic part near the nuclei, whereas the expression pattern of colon malignancies was mainly on the whole surface of epithelia and the expression was much higher than the normal colon tissues. The staining pattern of tissue array showed in adenocarcinoma and papillary adenocarcinoma, and the expression of Ep-CAM was increased from grade I to grade III., Conclusion: MAbs against Ep-CAM might be useful for research on the structure and function of Ep-CAM and may have diagnostic and therapeutic value to various colon carcinomas.