Search

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.

Abstract Background Osteoarthritis (OA) is a chronic degenerative joint disease characterized by loss of joint function, which seriously reduces the quality of life of the elderly and imposes a heavy socioeconomic burden worldwide. Monotropein (MON), the main active ingredient of Morinda officinalis F.C. How, has exhibited therapeutic effects in different disease models. However, its potential effects on chondrocytes in an arthritic model remain unclear. This study aimed to evaluate the effects of MON in chondrocytes and a mouse model of OA, and explore the potential mechanisms. Materials and methods Murine primary chondrocytes were pretreated with 10 ng/ml interleukin (IL)-1β for 24 h to establish an in vitro model of OA, and then treated with different concentrations of MON (0, 25, 50 and 100 μM) for 24 h. The proliferation of the chondrocytes was assayed using ethynyl-deoxyuridine (EdU) staining. Immunofluorescence staining, western blotting and TUNEL staining were performed to assess the effects of MON on cartilage matrix degradation, apoptosis and pyroptosis. The mouse model of OA was constructed by surgical destabilization of the medial meniscus (DMM), and the animals were randomly divided into the sham-operated, OA and OA + MON groups. Following OA induction, the mice were given intraarticular injection of 100 μM MON or equal volume of normal saline twice a week for 8 weeks. The effects of MON on cartilage matrix degradation, apoptosis and pyroptosis were assessed as indicated. Results MON significantly accelerated the proliferation of chondrocytes, and inhibited cartilage matrix degradation, apoptosis and pyroptosis in the IL-1β-stimulated cells by blocking the nuclear factor-kappa B (NF-κB) signaling pathway. In the mouse model as well, MON treatment alleviated OA progression and promoted cartilage repair by inhibiting cartilage matrix degradation, and chondrocyte apoptosis and pyroptosis through the inactivation of the NF-κB signaling pathway. Furthermore, the MON-treated arthritic mice exhibited better articular tissue morphology and lower OARSI scores. Conclusions MON alleviated OA progression by inhibiting cartilage matrix degradation, and the apoptosis and pyroptosis of chondrocytes via NF-κB pathway inactivation, and is a promising alternative for the treatment of OA.

The invasion of ship domains stands out as a significant factor contributing to the risk of collisions during vessel navigation. However, there is a lack of research on the mechanisms underlying the collision risks specifically related to merchant and fishing vessels in coastal waters. This study proposes an assessment method for collision risks between merchant and fishing vessels in coastal waters and validates it through a comparative analysis through visualization. First of all, the operational status of fishing vessels is identified. Collaboratively working fishing vessels are treated as a unified entity, expanding their ship domain during operation to assess collision risks. Secondly, to quantify the collision risk between ships, a collision risk index (CRI) is proposed and visualized based on the severity of the collision risk. Finally, taking the high-risk area for merchant and fishing vessel collisions in the Minjiang River Estuary as an example, this paper conducts an analysis that involves classifying ship collision scenarios, extracts risk data under different collision scenarios, and visually analyzes areas prone to danger. The results indicate that this method effectively evaluates the severity of collision risk, and the identified high-risk areas resulting from the analysis are verified by the number of accidents that occurred in the most recent three years.

Background: Spinal cord injury (SCI) is a common disorder of the central nervous system with considerable socio-economic burden. Andrographolide (Andro), the main active component of Andrographis paniculata, has exhibited neuroprotective effects in different models of neurological diseases. The aim of this study was to evaluate the neuroprotective effects of Andro against SCI and explore the related mechanisms.Methods: SCI was induced in rats by the Allen method, and the modeled animals were randomly divided into sham-operated, SCI, SCI + normal saline (NS) and SCI + Andro groups. The rats were injected intraperitoneally with Andro (1 mg/kg) or the same volume of NS starting day one after the establishment of the SCI model for 28 consecutive days. Post-SCI tissue repair and functional recovery were evaluated by measuring the spinal cord water content, footprint tests, Basso-Beattie-Bresnahan (BBB) scores, hematoxylin-eosin (HE) staining and Nissl staining. Apoptosis, oxidative stress and inflammation, as well as axonal regeneration and remyelination were analyzed using suitable markers. The in vitro model of SCI was established by treating cortical neurons with H2O2. The effects of Andro on apoptosis, oxidative stress and inflammation were evaluated as indicated.Results: Andro treatment significantly improved tissue repair and functional recovery after SCI by reducing apoptosis, oxidative stress and inflammation through the nuclear factor E2-related factor 2/heme oxygenase-1 (Nrf-2/HO-1) and nuclear factor-kappa B (NF-κB) signaling pathways. Furthermore, Andro treatment promoted M2 polarization of the microglial cells and contributed to axonal regeneration and remyelination to improve functional recovery after SCI. In addition, Andro also attenuated apoptosis, oxidative stress and inflammation in H2O2-stimulated cortical neurons in vitro.Conclusion: Andro treatment alleviated SCI by reducing apoptosis, oxidative stress and inflammation in the injured tissues and cortical neurons, and promoted axonal regeneration and remyelination for functional recovery.