Search

Antimicrobial peptides (AMPs) are an important component of innate immunity across all classes of life ranging from prokaryotes to higher animals. Being a key component of innate immunity, AMPs are produced in the sites which are at high risk of pathogen invasion. The main advantage of AMPs possesses broad spectrum antimicrobial activity and can function without memory and specificity, against bacteria, fungi, virus and even parasites. They also exhibit diverse biological functions such as immunomodulation, neutralization of endotoxin and induction of angiogenesis, wound healing, antitumor in addition to its antimicrobial activity. AMPs generally consist of 10 to 50 amino acids and most of them are cationic in nature with a net charge of +2 to +9, although some anionic (negatively charged) AMPs have also been discovered.

Nanoparticles (NPs) are small particles made of single or multiple materials having at least one dimension in nanoscale ranging from 1 to 100 nm. The outstanding features of NPs, such as larger surface area and high particle number per mass unit as compared to their bulk material, superior mechanical performance, possibility of surface functionalization makes them perfect candidate for wide applications. The main factors that make the NPs significantly different from the larger size material are the surface effects and quantum effects. These effects provide them many enhanced features in terms of mechanical, thermal, magnetic, electronic, optical, and catalytic properties. NPs can be of different shapes such as spherical, conical, cylindrical, tubular, and spiral. They are generally classified into three groups, organic, carbon-based, and inorganic NPs based on their composition. Organic NPs are made of proteins, carbohydrates, lipids, polymers, or any other organic compounds. Carbon-based NPs are made exclusively from carbon atoms while the inorganic NPs (for example metal NPs) are prepared differently from the other two classes.

BackgroundThe objective of the study was to report the health-related quality of life (HRQOL) following road traffic accidents (RTAs) among children. MethodsA community-based survey using EuroQol five-dimension questionnaire (EQ-5D-5L) in Hindi was used to collected data from community. The survey included 2620 households from urban and rural areas of Ujjain, India. ResultsFrom the 2620 households included in the study, 229 children aged 5–18 years with a history of RTA in the last 1 year were identified, with 27%, 63%, and 10% children reporting mild, moderate, and severe injury based on length of hospitalization. Motorcycles, bicycles, and pedestrians constituted most RTAs. Helmet use was low (12%). EQ-5D-5L revealed that the most severe and extreme problem post RTA in children was pain and discomfort, whereas the least severe problem was usual activity and self-care. The most common (65%) injuries were either abrasion or fracture and dislocation. EQ-5D-5L severity index was maximum (mean 72) for lower extremity injuries. ConclusionsThe results of the present study highlight the ability and requirement for quality-of-life measurement using EQ-5D-5L among children post-RTA.

Screen viewing time is the total time spent by a child on any digital/electronic device. The objective of the present study was to determine the incidence and predictors of excessive screen viewing time in children in Ujjain, India. This cross-sectional, community-based study was conducted through house-to-house survey by using the three-stage cluster sampling method in 36 urban wards and 36 villages of Ujjain district, India. Excessive screen viewing time was defined as screen viewing for > 2 h/day. The prevalence of excessive screen viewing time was 17.83%. Risk factors identified using the multivariate logistic regression model were: age (OR: 1.5, P < 0.001); mobile phone use before bedtime (OR: 3.17, P = 0.008); parents’ perception about the child habituated to screen (OR: 14.03, P < 0.001); television in bedroom (OR: 48.69, P < 0.001); morning mobile screen viewing time (OR: 9.27, P < 0.001); not reading books other than textbooks (OR: 9.71, P < 0.001); and lack of outdoor play for >2 h (OR: 4.20, P < 0.001). Presence of eye pain was a protective factor for excessive screen viewing time (OR: 0.12, P = 0.011). The study identified multiple modifiable risk factors for excessive screen viewing time.

Screen viewing time is the total time spent by a child on any digital/electronic device. The objective of the present study was to determine the prevalence and predictors of excessive screen viewing time in children in Ujjain, India. This cross-sectional, community-based study was conducted through a house-to-house survey using the three-stage cluster sampling method in 36 urban wards and 36 villages of Ujjain District, India. Excessive screen viewing time was defined as screen viewing for >2 h/day. The prevalence of excessive screen viewing time was 18%. Risk factors identified using the multivariate logistic regression model were age (OR: 1.63, p < 0.001); mobile phone use before bedtime (OR: 3.35, p = 0.004); parents’ perception about the child’s habituation to screen time (OR: 8.46, p < 0.001); television in the bedroom (OR: 35.91, p < 0.001); morning mobile screen viewing time (OR: 6.40, p < 0.001); not reading books other than textbooks (OR: 6.45, p < 0.001); and lack of outdoor play for >2 h (OR: 5.17, p < 0.001). The presence of eye pain was a protective factor for excessive screen viewing time (OR: 0.13, p = 0.012). This study identified multiple modifiable risk factors for excessive screen viewing time.

Background Atypical presentation of coronavirus disease-19 (COVID-19) from classic acute respiratory distress syndrome needs to be extensively evaluated to understand the pathophysiology to optimize the management protocol for severely ill patients to abrogate the terminal event. Methods Autopsy core needle biopsies of lungs were obtained from 12 patients who died with COVID-19. Routine histopathological examination of lung tissue along with immunohistochemical analysis of C4d complement staining was studied. Formalin-fixed paraffin-embedded biopsy material was also subjected to real-time reverse transcription-polymerase chain reaction for severe acute respiratory syndrome - coronavirus (SARS-CoV2) gene. Results In the study, all the deceased patients were symptomatic with two-thirds suffering from isolated SARS-CoV2-related pneumonia while remaining one-third had secondary COVID-19 infection. Histopathological evaluation highlights diffuse alveolar damage as the predominant pattern; however, complement-mediated endothelial injury of septal microvasculature, and microthrombi was also distinctly observed with increased serum levels of D-Dimer and fibrinogen-degradation products. The patients who had extrapulmonary manifestations at the time of presentation also showed pulmonary vascular lesions on histopathologic examination. Our study confirms the presence of coagulopathy and immune-mediated microthrombi in pulmonary septal microvasculature in patients with severe disease. Conclusion The results of our small series of patients highlight the possibility of immune-mediated pulmonary vascular injury and thrombosis which has the potential to evolve into large vessel thrombosis and pulmonary embolism in critically ill patients. Definitive therapeutic management protocol including thromboembolic prophylaxis and development of effective immune-modulatory target could possibly reduce mortality in severely ill patients.

A Battery free ultra high frequency 0.9 GHz Radio Frequency ID applications, an extended RF energy collecting framework have planned and introduced. The proposed system incorporates a pi-matching organize off-chip UHF differential radio wire taken after by a CMOS cross-coupled RF-DC transformation rectifier that replaces a battery in various RFID applications. For a UHF band (900 MHz), the designed matching technique shows in differential to RF-DC converter gives a high efficiency of 64percentat -14 dBm. Utilizing CMOS UMC 0.18mum innovation, the proposed design accomplishes way efficient system for input control for -20 dBm to -4 dBm.

Radar application needs vast PA, that should consist of compactness, worth while and cheap. Proposed way tells theoretical analysis and design of GaN MMICPA adopting microstirp radial stub in both input side and output side matching network which is useful for X-band Radar applications that cover the range of 8.5 GHz to 9.5 GHz. our design focus on microstrip technology which uses radial stub for the better matching. proposed design covers a 4W (36 dBm) output power from a 23 dBm input with a 40% Power Added Efficiency (PAE) and a 13 dB gain in CW-mode operation with a 28V drain voltage.The proposed architecture was done on the 0.25μm gate length GaN on SiC process of UMS (GH25) using Keysight ADS 2017 with die size of 1.8 x 2.4 mm2.

Introduction: A Firearm is a thermodynamic machine in which the potential energy of the gun- powder istransformed into the kinetic energy of the projectile.Aims and Objective: To assess the load and analyze the male cases of firearm injuries.Material and Methodology: The present prospective study had been conducted in the Department ofForensic Medicine, SMS Medical College & Hospital, Jaipur, Rajasthan during the period of One & halfyear from May 2014 to October 2015. All cases of firearm injuries that were received dead or live at SMSHospital and its attached Hospitals, Jaipur was included in our study.Result and Observation: In our study majority of firearm injury case [43 cases (40.78%)] were observedin the age group of 20-29 years followed by the age group of 30-39 years [28 cases (27.18%)]. Majorityof the incidences of gun-shot injuries were homicidal in nature (80.58%) followed by accidental episodes(14.56%). Land and property disputes were the most common reason behind firearm injuries in this study(42.72%) followed by revenge & robbery (15.53% & 13.59 % respectively);Majority of the incidencesoccurred during evening in 43 cases (41.75%), followed by afternoon 40 cases (38.83%). There waspresence of firearm entry wound in all victims. Overall,52 cases (50.49%) had a single entrance wound,13 cases(12.62%) had two entry wounds, In summer season 43 cases (41.75%), spring 24 cases (23.30%),winter 20 cases (19.42%), autumn 16 cases (15.53%), were reported in studied cases. In majority of thecases (81.55%), there was no exit wounds while one exit wound was found in 17 cases (16.51%).In rest ofthe two cases, two exit were found in two cases.Conclusion: The results of the present study support the argument that rigorous pursuit of campaign firearmswithout a license and country made guns may prove useful in reducing the number of firearm injuries insociety.

The design and detailed analysis of a Reconfigurable concurrent Dual-band LNA with Dynamic Output Load Network operating in 0.9GHz and 1.8GHz has been demonstrated in 0.18um CMOS process. A common source (CS) cascade topology with serial and parallel LC circuit based input matching was adopted. A new output load network made reconfigurable in terms of high gain(HG) and low gain(LG) mode through the output impedance seen at the respective nodes. The impedance nodes are controlled through control (CT H and CT L ) switches. Varactor tuning has been incorporated to input and output to optimize the circuit. The proposed LNA achieves a S 21 of 19 dB and 13 dB at 0.9 GHz and 1.8 GHz for high gain mode, and simultaneously 10 dB and 7 dB gain for low gain mode. The extracted simulations shows with noise figure (NF) of 4 dB and 4.2 dB at high gain mode and 3.3 dB and 4 dB at low gain mode respectively.

Introduction:-Sexual assaults are inhuman crimes against individual as well as the whole society. This study was thus initiated to obtain statistical pattern of sexual assaults pertaining to analyze various aspects including socio-demography and victim assailant relation, other relevant factors. Materials and Method:- Inclusion Criteria :-all the victims/sexual offence survivors examined at SMS Medical College, Jaipur during 1st January 2018 to 31st December 2018 Exclusion Criteria:- all the alleged cases of sexual offence whom consent could not be obtained. Results:- total 60 cases were studied. The mean age of the victims in present study was 20.98 years. 73.33% victims were from urban regions. 50% victims were educated. 70% victims in the present study were married. Most common place of commission of the crime was the victim’s own home (46.67%) . 43.34% victims reported within one week time period from the incidence. 88.33% victims were assaulted by a single person. 76.67% victims were assaulted by familiar persons. In 51.67% cases, the victim had been assaulted multiple times. In 85% cases, there was peno-vaginal intercourse. 71.67% cases had no injury in the present study. 3.33% victims got pregnant after the sexual assault. Conclusion:- Females of reproductive age group were the most common victims in the present study. Familiar persons committed the crime in most cases and victim’s home was the most common site of occurrence. There was delayed reporting of the crime in most cases which was the main reason for loss of vital trace evidences. Suggestions:- Strict adherence to protocols for medical examination of victims of sexual assaults should be mandatory. Sex education should be provided to school students of teenage to increase awareness regarding medical and legal issues related to such events to increase the reporting of this crime.

Radar Front-Ends crave diverse power amplifiers, which must be small-scaled, productive and economical. Our approach elaborate optimized Design of high power GaN power amplifier adopting microstirp radial stub in pair input and output matching network for an X-band Radar applications that overlay 8.5 GHz to 9.5 GHz.To develop 15W power amplifier utilizing a compact design of 4way power divider with proposed design was accomplished in microstrip technology adopting radial stub for the superior matching. The system achieves a 15W (43 dBm) output power from a 23 dBm input drive with a 42% Power Added Efficiency (PAE) and a 20 dB gain in CW−mode operation with a 28V drain voltage. The 4W MMIC design was completed on the 0.25µm gate length GaN on SiC process of UMS (GH25) using Keysight ADS 2017 with die size of 1.8 x 2.4 mm2. The proposed 15W power amplifier through a design of 4W MMIC in GaN GH25 and power divider/combiner mounted on printed circuit board consumes an area of 55 x 24 mm2.

A wide input range differential dual band RF energy harvesting system has been designed and presented for a battery less RFID applications. The proposed architecture includes an off-chip differential dual band antenna with differnetial dual band matching network followed by a CMOS cross coupled rectifier for RF-DC conversion which replaces a battery in several RFID applications. The proposed differential dual band matching network for the rectifier provides a peak efficiency of 60% at -12 dBm at 0.9 GHz and 64% at -16 dBm at 1.8 GHz. The proposed architecture achieves better efficiency for lower input power ranges from -20 dBm to 8 dBm which implemented using UMC 0.18 µ m CMOS Technology.

An ultra-low power (ULP) sub-threshold CMOS low noise amplifier (LNA) with tunable input matching for 2.4 GHz ISM band wireless sensor network applications is presented. A mathematical approach has been presented to find input matching network for any type of impedance transformation like complex to complex and complex to real. An Impedance transformation using parallel inductor sub-threshold LNA topology has been presented for IEEE 802.15.4a standard using a standard low cost 0.18μm RF CMOS process. The inductive source degeneration is avoided here to facilitate higher gain, better figure of merit with less area. Continuously tuned characteristics are obtained by using a switch, and the input matching circuit is equipped with varactor tuning techniques. It occupies the frequency range between 2.2 GHz and 2.55 GHz, and achieves 24dB gain, a 3.6dB noise figure with −5 dBm P1dB. This draws a supply voltage of 0.532 mA from 1.8 V.

BACKGROUND The various patterns of homicidal deaths include assault by sharp weapon, blunt weapon, firearms, strangulation, homicidal hanging, smothering, drowning, burns, poisoning etc. The role of forensic expert is to help in the administration of justice. Detailed examination of wounds helps in prediction of the weapon used in the killing. The nature of the weapon used, and the gravity of the injury inflicted together play a decisive role in identifying the charges to be held against the said accused which further determine the punishment in each case. The present study was thus undertaken to find out the weapons used commonly in homicidal deaths in the study region. MATERIALS AND METHODS The present study was conducted at the Department of Forensic Medicine of a tertiary care center of the state over a period of three years. Informed consent from the relatives of the deceased was also kept as an inclusion criterion. Suspected deaths later disproved to be homicidal in manner as per police inquest and negative consent for participation in the study were the exclusion criteria. The weapon used in these killings were identified and other data collected to observe the pattern of use of different weapons in homicidal deaths in the study region. RESULTS In the present study, blunt weapons were the most common offenders used for homicidal killing especially employed in Land and property disputes. Sharp weapons and Firearms followed next in order. Burns were used least, and this study also reported homicidal killings by poisonings which is a rare finding and not reported earlier. Strangulation and burns were more common in female victims. Burning to death was used as a means for killing more commonly in fatalities of females associated with the demand of dowry. CONCLUSION Stricter enforcement of laws must be ensued on possession of dangerous weapons like sharp heavy cutting weapons/firearms and also to solve disputes related to land and properties to prevent these unwanted deaths hampering the active sections of the society.

Many studies have been conducted to study age-related changes in human pubic symphyseal surfaces but no recorded study was found on living persons using Mckern-Stewart (1957) method. Mckern-Stewart's method applies phase scoring for the three components of the pubic symphysis, and thus introduces objectivity to the otherwise subjective and somewhat confusing avenue of age estimation. This prospective cross-sectional study analysed age-related changes of pubic symphyseal surfaces in 3-D reconstructed CT images of the symphyseal surface by application of the Mckern-Stewart method in living individuals. It was carried out on 123 participants in a known age group of 15 to 60 years in the S.M.S. Medical College, Jaipur, (Rajasthan, India). The 3D reconstructed CT images of the symphyseal surface were evaluated for all the three components of Mckern-Stewart method. The subjects were categorized into eight age groups at five year intervals. We observed that the score as per Mckern-Stewart method was linearly proportionate to the age of the individual participant. Age and Mckern-Stewart's score was found to be significantly correlated for both the sexes. Regression models were generated to estimate age from the total Mckern-Stewart's score. In conclusion, we found out that age can be estimated by application of Mckern-Stewart method, when applied to 3D reconstructed CT images of pubic bones in living individuals. Mckern-Stewart's method is especially helpful for estimating age for individuals in the 15 to 40 years old age range.

BACKGROUND Disability and disability certificates are like double-edged swords. On one hand, a non-qualifying individual may avail certain benefits and privileges reserved for disabled person due to over calculation; and on other hand, a deserving disabled may not be able to get benefit out of the granted opportunities due to under calculation. This study was thus undertaken to analyse the disability certificates issued at our institution to determine the fallacies that are evident in the criteria for disability assessment. METHODOLOGY 500 cases of permanent physical disability (PPD) resulting from road traffic accidents (RTA) satisfying the inclusion and exclusion criteria were re-examined after final assessment of disability and the assessed disability was reviewed in terms of the defect in function of body; the total percentage of disability allotted to the candidate and the appropriateness of the assessed value in relation to the hindrance caused to daily routine. OBSERVATIONS No discrepancy was noted in 355 cases, but in rest of 145 cases a number of discrepancies were noted in relation to the above said criteria of comparison. Out of these, in 20% cases, the percentage of disability did not include a note of the total impact of the disability on physical, mental, social life of the disabled person resulting in more non-functioning as compared to the calculated resulting permanent disability. In rest 30% cases with discrepancies, calculated percentage had ill correlation between malfunctioning of the body part and its overall calculation in relation to the body as a whole. Rest 50% cases were those where similar malfunctioning resulting from different lesions was assessed differently resulting in different percentages of permanent physical disabilities. CONCLUSION A serious revision of these guidelines in lieu of discrepancies must be ensued to benefit one and all equally and to ensure uniformity in the process which is a gateway to eligibility for public benefit which should be equal to all in a democracy.

Sex chromosome-related anomalies engender plethora of conditions leading to male infertility. Hypogonadotropic hypogonadism (HH) is a rare but well-known cause of male infertility. Present study was conducted to ascertain possible consensus on the alterations of the Y-linked genes and loci in males representing hypogonadism (H), which in turn culminate in reproductive dysfunction. A total of nineteen 46, XY males, clinically diagnosed with H (11 representative HH adults and eight prepubertal boys suspected of having HH) were included in the study. Sequence-tagged site screening,SRY gene sequencing,fluorescence in situ hybridization mapping (FISH), copy number and relative expression studies by real-time PCR were conducted to uncover the altered status of the Y chromosome in the patients. The result showed random microdeletions within the AZFa (73%)/b (78%) and c(26%) regions. Sequencing of the SRY gene showed nucleotide variations within and outside of the HMG box in four males (21%). FISH uncovered mosaicism for SRY, AMELY,DAZ genes and DYZ1 arrays, structural rearrangement for AMELY (31%) and duplication of DAZ (57%) genes. Copy number variation for seven Y-linked genes (2-8 rounds of duplication), DYZ1 arrays (495-6201 copies) and differential expression of SRY,UTY and VCY in the patients' blood were observed. Present work demonstrates the organizational vulnerability of several Y-linked genes in H males. These results are envisaged to be useful during routine diagnosis of H patients.

Background: Neonatal small bowel obstruction is the most commonly encountered paediatric surgical emergency worldwide and in India. The objective of this study was to study the prevalence and spectrum of neonatal small bowel obstruction.Methods: A retrospective chart review of all neonates aged between 1-28 days that underwent surgery for small intestinal obstruction between January 2017 to January 2019 at Department of Paediatric Surgery, R.D. Gardi Medical College, Ujjain, MP. A predesigned questionnaire was used to collect demographic, clinical and outcome related information. Exploratory laparotomy and type of surgical intervention was done as per the cause.Results: A total of 52 neonates (M: F ratio 1.74: 1) were included in the study. The most common clinical features were vomiting (92%), bilious vomiting (85%) and abdominal fullness (75%) and laboratory feature was leucocytosis (42%) and thrombocytopenia (31%). Most (66%) neonates presented between 2-7 days and belonged to rural areas (65%). The two most common final diagnosis were malrotation (56%) and intestinal atresia (23%). Associated anomalies were seen in 29% [vertebral defects, anal atresia, cardiac defects, tracheo-esophageal fistula, renal anomalies, and limb abnormalities association (8%) and congenital heart disease (8%)]. The mean (±SD) duration to reach full feeds and duration of neonatal intensive care unit stay was 6.2±1.3 and 14.1 (±5) days, respectively. Complications were seen in 20% cases, most common being early bowel obstruction. A total of 6 (11.5%) neonates died in the post-operative period, 83% because of sepsis.Conclusions: Small bowel obstruction is common neonatal surgical emergency. Most common cause is malrotation and intestinal atresia. Neonatal sepsis is the most common underlying cause of death post-operatively.

Background: The trends of deaths due to unnatural incidents are on the rise each year throughout the world, including India. Incremental trends have been observed in all mortalities throughout the country. Although all these mortalities seem preventable, yet not much has been achieved over the years. Intentional mortalities are yet more preventable as compared to non intentional ones. The trends of unnatural deaths were observed at a tertiary care centre of the capital city of Rajasthan to determine the comparative magnitude of such fatalities to predict possible reasons for them.Methods: An observational study was carried out for a one year period (2013-14) at the Department of Forensic Medicine of an apex institution of the capital metropolitan city to determine the comparative trends of accidental to suicidal and homicidal deaths amongst the medico-legal autopsies carried out over the study period. The results were analysed to look into the probable reasons for these preventable deaths.Results: Accidental fatalities contributed maximally followed by suicides and homicides. All types of unnatural deaths were more commonly observed in young adult male population. Road accidents were the major offenders followed by thermal injuries and falls. Intentional fatalities due to self harm or other human beings shared a considerable burden among unexpected mortalities over the study region.Conclusions: Majority of the reported fatalities were preventable deaths occurring amongst the active and productive population and hence, it is of utmost importance to analyse such deaths to suggest remedial measures bring down the toll of such causalities.

The Hox complex contains 39 genes clustered into four groups involved in cell differentiation and development. We cloned full-length sequence of Hoxc11 gene from water buffalo Bubalus bubalis, assessed its copy number, localized the same onto the chromosome 5, and studied its evolutionary conservation across the species. Northern hybridization of Hoxc11 showed a 2.2 kb band in the tissues analyzed. Real-Time PCR showed highest expression of Hoxc11 gene in lung followed by spleen, spermatozoa, and testis. Six interacting partners of this gene showed higher expression in spleen, lung, testis, and spermatozoa. During the early stages of development, Hoxc11 and its interacting partners both showed lower expression, which then became prominent during the age of 1-3 years, regressed drastically thereafter, and remained so until the animal's life time (∼ 20 years). The high expression of Hoxc11 and its interacting partners in spermatozoa and testis during the onset of puberty suggests its likely role in the differentiation of gonads and subsequent reproductive activities. Additional work on Hoxc11 especially, in the context of respiratory, immunological, and in/fertility in other species, including humans would be useful for establishing its broader biological significance towards the enrichment of functional and comparative genomics.

We assessed genomic instability of 3.4 kb DYZ1 repeat arrays in patients encompassing prostate cancer (PC), cases of repeated abortion (RA) and males exposed to natural background radiation (NBR) using real-time PCR and fluorescence in situ hybridization (FISH). Normal males showed DYZ1 copies ranging from 3000 to 4300, RA, 0-2237; PC, 550; and males exposed to NBR, 1577-5700. FISH showed organizational variation of DYZ1 in these samples substantiating the data obtained from real-time PCR. Of the 10 RA samples, 7 were found to be affected of which, 5 showed deletion of 265 bp from nt 25 to 290 and 773 bp from 1347 to 2119 and 2 showed deletion of 275 bp from nt 3128 to 3402. Copy number variation of DYZ1 in these males correlated with genetic constrains/anomalies. Although precise mechanisms of genomic instability of DYZ1 remains unclear, we construe that this repeat plays a critical role in maintaining the structural integrity of the Y chromosome, possibly by absorbing the load of mutations. This may be used as a marker system to analyze genetic integrity of the DYZ1 repeat array(s) across the spectrum of patients.

Higher eukaryotes contain a wide variety of repetitive DNA, although their functions often remain unknown. We describe cloning, chromosomal localization, copy number assessment, and transcriptional status of 1378- and 673-bp repeat fractions in the buffalo genome. The pDS5, representing the 1378-bp fragment, showed FISH signals in the centromeric region of acrocentric chromosomes only, whereas pDS4, corresponding to 673 bp, detected signals in the centromeric regions of all the chromosomes. Crosshybridization studies of pDS5 and pDS4 with genomic DNA from different sources showed signals only in buffalo, cattle, goat, and sheep. Real-time PCR analysis uncovered 1234 and 3420 copies of pDS5 and pDS4 fragments per the haploid genome, corresponding to 30 and 68 copies per chromosome, respectively. Analysis of cDNA from different tissues of buffalo with Real-time PCR showed maximum expression of pDS5 and pDS4 in the spleen and liver, respectively. Phylogenetic analysis of these sequences showed a close relationship between buffalo and cattle. The prospect of this approach in comparative genomics is highlighted.

Molecular Markers for Characterization of Stem Cell Lineages

Uniqueness of the Extracellular Domain of Protooncogene c-kit Receptor Across the Species: Implications in Conservation of Biodiversity

The long arm of the human Y chromosome is flecked with various fractions of repetitive DNA. DYZ1 is one such fraction, which is organized tandemly as an array of a 3.4-kb repeat ranging from 2000-4000 copies in normal males. We have studied the organizational variation of the DYZ1 fraction on the human Y chromosome using DNA samples from CEPH family members and the random population employing the RFLP approach, fluorescence in situ hybridization (FISH), and conducted a similarity search with GenBank sequences. Typing of genomic DNA using DYZ1 as a probe showed an allele length and copy number variations even between two male siblings. Hybridization of DNA from monochromosome hybrids with this probe showed its presence on chromosome 15 in addition to the Y chromosome. Fluorescence in situ hybridization of metaphase chromosomes from an apparently normal male showed DYZ1 sequences in the proximal region of chromosome 11 in addition to the long arm of the Y chromosome. Typing of sets of semen and blood DNA samples from the same human individuals showed discernible allelic variation between the two samples, indicating tissue-specific programmed sequence modulation. DYZ1 seems to be the first probe having the unique potential to discriminate unequivocally the difference between the DNA originating from semen and blood samples, and may be exploited in forensic cases. This probe may also be used as a diagnostic tool to ascertain Y chromosome mosaicism in patients (e.g., Turner), its aberrant status in somatic cells, and possible sequence modulation/rearrangement in the germline samples. Additionally, this can be used to uncover sequence polymorphism in the human population.

The data on unnatural female deaths in a particular geographic area can give the reflection of its law and order situation. Present Descriptive Observational study was conducted at the Department of Forensic Medicine and Toxicology, SMS Medical college and attached Hospitals Jaipur (Rajasthan) during period of June’2014 to May’2015. Total 4097 medico-legal autopsies were conducted among them 850 cases were concluded to be female unnatural deaths. Burn is the leading cause of death. As per manner of death, accidental burn cases predominated the study followed by suicidal and homicidal cases. Second decade age group is most vulnerable for deaths due to burns. Suicidal deaths caused by burns outnumbered in married females and mental agony was the major reason for commitment of the act. 40 cases of unnatural female deaths were registered under section 498A and/or 304B of IPC. Distribution and causes of unnatural female deaths in present study are more or less similar to the pattern found in most of the other Indian studies. This study suggests variable measures to scrutinize unnatural female deaths to improve the plight.

The analysis of genetic diversity and relatedness within and between the different species and populations has been a major theme of research for many biologists. With the availability of whole-genome sequencing for an increasing number of species, focus has been shifted to the development of molecular markers based on DNA or protein polymorphism. DNA sequences originate and undergo evolutionary metamorphoses’ and thus may be used as powerful genetic markers to characterize genomes of wide range of species. This type of analysis is called fingerprinting, profiling or genotyping. DNA profiling based on typing individuals using highly variable minisatellites in the human genome was first developed by Jeffreys et al (1985). He demonstrated short repeat sequences tandemly arranged within the gene(s) and each organism has a unique pattern of the arrangement of these minisatellites, the only exception being multiple individuals from a single zygote (e.g. identical twins). DNA fingerprinting technique was notably used to help solve crimes and determine paternity. In addition, with the advances in Molecular biology techniques, isolation of genes tagged with minisatellites has become the most powerful tool for genome analysis.

Background Diarrhoea accounts for 20% of all paediatric deaths in India. Despite WHO recommendations and IAP (Indian Academy of Paediatrics) and Government of India treatment guidelines, few children suffering from acute diarrhoea in India receive low osmolarity oral rehydration solution (ORS) and zinc from health care providers. The aim of this study was to analyse practitioners' prescriptions for acute diarrhoea for adherence to treatment guidelines and further to determine the factors affecting prescribing for diarrhoea in Ujjain, India. Methods This cross-sectional study was conducted in pharmacies and major hospitals of Ujjain, India. We included prescriptions from all practitioners, including those from modern medicine, Ayurveda, Homeopathy as well as informal health-care providers (IHPs). The data collection instrument was designed to include all the possible medications that are given for an episode of acute diarrhoea to children up to 12 years of age. Pharmacy assistants and resident medical officers transferred the information regarding the current diarrhoeal episode and the treatment given from the prescriptions and inpatient case sheets, respectively, to the data collection instrument. Results Information was collected from 843 diarrhoea prescriptions. We found only 6 prescriptions having the recommended treatment that is ORS along with Zinc, with no additional probiotics, antibiotics, racecadotril or antiemetics (except Domperidone for vomiting). ORS alone was prescribed in 58% of the prescriptions; while ORS with zinc was prescribed in 22% of prescriptions, however these also contained other drugs not included in the guidelines. Antibiotics were prescribed in 71% of prescriptions. Broad-spectrum antibiotics were prescribed and often in illogical fixed-dose combinations. One such illogical combination, ofloxacin with ornidazole, was the most frequent oral antibiotic prescribed (22% of antibiotics prescribed). Practitioners from alternate system of medicine and IHPs are significantly less likely (OR 0.13, 95% CI 0.04-0.46, P = 0.003) to prescribe ORS and zinc than pediatricians. Practitioners from 'free' hospitals are more likely to prescribe ORS and zinc (OR 4.94, 95% CI 2.45-9.96, P < 0.001) and less likely to prescribe antibiotics (OR 0.01, 95% CI 0.01-0-04, P < 0.001) compared to practitioners from 'charitable' hospitals. Accompanying symptoms like the presence of fever, pain, blood in the stool and vomiting significantly increased antibiotic prescribing. Conclusion This study demonstrated low adherence to standard treatment guidelines for management of acute diarrhoea in children under 12 years in Ujjain, India. Key public health concerns were the low use of zinc and the high use of antibiotics, found in prescriptions from both specialist paediatricians as well as practitioners from alternate systems of medicine and informal health-care providers. To improve case management of acute diarrhoea, continuing professional development programme targeting the practitioners of all systems of medicine is necessary.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5' CACCTCTCCACCTGCC 3') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.

Background: Head Injury is the single most common cause of mortality in vehicle accidents. Its outcome is a product of different mechanisms, types and amounts of head injuries and their anatomical locations. Objective: To analyze the pattern of fatal head Injury in road traffic accidents at SMS Hospital, Jaipur; a tertiary care centre. Subjects: Cases of Road Traffic Accidents with fatal head injury subjected to medico-legal autopsy at the Department of Forensic Medicine, SMS Medical College and Hospital Jaipur, Rajasthan, India - a tertiary care center. Main outcome: Young adults (both males and females) in their most productive years of life are especially prone to head injury, as a result of vehicle accidents. The use of helmets as preventive measure has checked the external and bony injuries to skull region but there is an urgent need to plan further prevention in such cases to check internal brain injuries caused due to movement of brain in cranial cavity. Results: Males clearly outnumbered females with male to female ratio as 4.7:1. Motor-cyclists were the commonest group of victims. Head injury was the commonest cause of death comprising 53.5% cases. Intracranial hemorrhage of one or more vascular components was the commonest type of injury. The most frequent pattern was a combination of subdural, subarachnoid and intracerebral hematomas i.e. 23 (34.9%). This was followed by Subarachnoid and Intracerebral 13 (19.7%) and subdural and subarachnoid 09 (13.6%). Out of 16 (24.24%) single compartment hemorrhage, the most frequent was intracerebral 08 (50%), followed by subdural 5 (31.25%) and subarachnoid 2 (12.5%) hemorrhage. Conclusion: Prompt treatment should be instituted to all cases of trauma particularly head injury to prevent fatality. Also there is a need to plan preventive measures.

Background Repetitive sequences are the major components of the eukaryotic genomes. Association of these repeats with transcribing sequences and their regulation in buffalo Bubalus bubalis has remained largely unresolved. Results We cloned and sequenced RsaI repeat fragments pDp1, pDp2, pDp3, pDp4 of 1331, 651, 603 and 339 base pairs, respectively from the buffalo, Bubalus bubalis. Upon characterization, these fragments were found to represent retrotransposons and part of some functional genes. The resultant clones showed cross hybridization only with buffalo, cattle, goat and sheep genomic DNA. Real Time PCR, detected ~2 × 104 copies of pDp1, ~ 3000 copies of pDp2 and pDp3 and ~ 1000 of pDp4 in buffalo, cattle, goat and sheep genomes, respectively. RsaI repeats are transcriptionally active in somatic tissues and spermatozoa. Accordingly, pDp1 showed maximum expression in lung, pDp2 and pDp3 both in Kidney, and pDp4 in ovary. Fluorescence in situ hybridization showed repeats to be distributed all across the chromosomes. Conclusions The data suggest that RsaI repeats have been incorporated into the exonic regions of various transcribing genes, possibly contributing towards the architecture and evolution of the buffalo and related genomes. Prospects of our present work in the context of comparative and functional genomics are highlighted.

Resistance to broad spectrum β lactams, mediated by extended spectrum beta lactamase (ESβL) and AmpC βL enzymes is an increasing problem worldwide. Presence of these in clinical infections can result in treatment failure if one of the second or third generation cephalosporins is used. Therefore, it is recommended that any ESβL-producing organism according to the National Committee for Clinical Laboratory Standards (NCCLS) criteria can be reported as resistant to all extended spectrum β lactam antibiotics regardless of the susceptibility test results. In this study, a total of 250 Escherichia coli (E. coli) isolates were subjected to Double disc test and AmpC disc test for the detection of ESβL- and AmpC βL-producing strains, respectively. Prevalence of ESβL- and AmpC βL-producing strains among E. coli isolates, over a 3-month-period in the hospital-based population of Jaipur, was 64.80% (162/250). AmpC βL producers were 24.00% (60/250) and co-existence of ESβL and AmpC βL was detected in 8.00% (20/250) of the isolates.