Search

Brassica napus L. plants are sensitive to water stress conditions throughout their life cycle from seed germination to seed setting. This study aims at identifying quantitative trait loci (QTL) linked to B. napus tolerance to water stress mimicked by applications of 10% polyethylene glycol-6000 (PEG-6000). Two doubled haploid populations, each consisting of 150 genotypes, were used for this research. Plants at the two true leaf stage of development were grown in the absence (control) or presence (stress) of PEG-6000 under controlled environmental conditions for 48 h, and the drought stress index was calculated for each genotype. All genotypes, along with their parents, were genotyped using the Brassica Infinium 90K SNP BeadChip Array. Inclusive composite interval mapping was used to identify QTL. Six QTL and 12 putative QTL associated with water stress tolerance were identified across six chromosomes (A2, A3, A4, A9, C3, and C7). Collectively, 2154 candidate genes for water stress tolerance were identified for all the identified QTL. Among them, 213 genes were identified as being directly associated with water stress (imposed by PEG-6000) tolerance based on nine functional annotations. These results can be incorporated into future breeding initiatives to select plant material with the ability to cope effectively with water stress., Competing Interests: The authors declare there are no competing interests.

The C2H2 type zinc finger proteins (C2H2-ZFPs) are prevalent motifs found widely across the eukaryotic kingdom, playing crucial roles in various biological processes, including stress responses and plant growth and development. To date, C2H2-ZFPs have been identified in many plant systems, but there have been no reports in Chinese jujube ( Ziziphus jujuba Mill.). In this study, a total of 77 ZjC2H2-ZFPs were identified in Chinese jujube and classified into three groups, with set A containing 29 genes, set B containing two genes, and set C containing 46 genes. The set A group genes were further divided into three groups: A1, A2, and A4 (with no member of the A3 subgroup found in jujube). The set C C2H2-ZFPs genes were also further divided into three groups: C1 containing 24 genes, C2 with two genes, and C3 with three genes. These ZjC2H2-ZFPs were distributed on 12 chromosomes and one tandem duplicated pair of ZjC2H2-ZFPs was found on chromosome 4 (ZjC2H2-21 with ZjC2H2-22). Notably, the 77 ZjC2H2-ZFPs identified in this study lacked finger clusters comprising 10 or more repeats. The structure and protein motif analysis of ZjC2H2-ZFPs showed that most C1 subgroup members were enriched with 'QALGGH' motif zinc finger helices and the A1a ZjC2H2-ZFPs contained highly conserved 'SATALLQKAAQMGS' residues in jujube. A unique finding was the discovery of a conserved non-finger domain (PCYCC motif) in A1 group members, absent in other ZjC2H2-ZFPs and unreported in other species. The enzyme activity of jujube leaves under different water stress treatments were measured, and the results showed that as the degree of water stress increased, the activity of SOD enzymes and H2O2 content also increased. The POD enzyme activity levels of different treatment groups were CK>MS>SS>LS. The levels of malondialdehyde (MDA) content observed under various treatments were notably higher and the proline content was lower in comparison to the control group (CK). Differential expression of ZjC2H2-ZFPs and specific responses were analyzed under water stress and different fruit development stages of jujube using RNA-Seq data. The correlation between expression patterns and protective enzyme activities under water stress was also examined. The results indicated that the expression levels of different ZjC2H2-ZFPs varied. A further protein interaction analysis indicated that ZjC2H2-ZFPs serve as pivotal transcriptional regulators with diverse functions, encompassing DNA or RNA binding and participation in protein interactions, with ZjC2H2-20, ZjC2H2-36, and ZjC2H2-57 being potential key players in these regulatory processes. Their roles appear particularly crucial in responding to abiotic stresses like water stress and regulating plant hormones. This study provides valuable insights into understanding stress responses and enhancing the quality of Chinese jujube during breeding., Competing Interests: The authors declare there are no competing interests., (©2024 Zhengwan et al.)

Soil water deficit (WD) significantly impacts plant survival and crop yields. Many gaps remain in our understanding of the synergistic coordination between molecular and ecophysiological responses delaying substantial drought-induced effects on plant growth. To investigate this synergism in tomato leaves, we combined molecular, ecophysiological, and anatomical methods to examine gene expression patterns and physio-anatomical characteristics during a progressing WD experiment. Four sampling points were selected for transcriptomic analysis based on the key ecophysiological responses of the tomato leaves: 4 and 5 days after WD (d-WD), corresponding to 10% and 90% decrease in leaf stomatal conductance; 8 d-WD, the leaf wilting point; and 10 d-WD, when air embolism blocks 12% of the leaf xylem water transport. At 4 d-WD, upregulated genes were mostly linked to ABA-independent responses, with larger-scale ABA-dependent responses occurring at 5 d-WD. At 8 d-WD, we observed an upregulation of heat shock transcription factors, and two days later (10 d-WD), we found a strong upregulation of oxidative stress transcription factors. Finally, we found that young leaves present a stronger dehydration tolerance than mature leaves at the same drought intensity level, presumably because young leaves upregulate genes related to increased callose deposition resulting in limiting water loss to the phloem, and related to increased cell rigidity by modifying cell wall structures. This combined dataset will serve as a framework for future studies that aim to obtain a more holistic WD plant response at the molecular, ecophysiological and anatomical level., Competing Interests: Declarations. Competing interests: The authors declare no competing interests., (© 2024. The Author(s).)

The remobilization of stored assimilates from stems to seeds plays a pivotal role in augmenting barley yield, particularly under water stress conditions. This study examines the molecular mechanisms underlying stem reserve utilization by conducting a comparative analysis of the proteome and metabolome across three barley contrasting genotypes: Yousef, Morocco, and PBYT17. Evaluations were performed at 21 and 28 days after anthesis (DAA) under both water stress and control conditions. The results indicate that the Yousef genotype exhibits superior remobilization of stem reserves, thereby demonstrating its potential to thrive even in adverse environmental conditions. Utilizing advanced quantitative proteomics and targeted metabolomics, this investigation identified a significant number of metabolites and proteins exhibiting differential accumulation across the genotypes. Specifically, 17 metabolites and 1580 proteins were catalogued, highlighting the intricate biochemical responses to water stress. Noteworthy enzymes such as sucrose synthase, inositol monophosphatase 3, and galactokinase were found to be closely associated with remobilization efficiency. In the drought-tolerant genotype, these enzymes maintained stable levels, in stark contrast to the decline observed in the susceptible genotype. This stability is crucial for promoting seed development through ascorbic acid synthesis and for mitigating oxidative stress, which is exacerbated by drought conditions. The elevated levels of certain metabolites, including glucose 6-phosphate, and UDP-glucose, in the drought-tolerant genotype suggest a robust mechanism for maintaining signalling molecules for carbon availability, which is then instrumental in regulating plant growth and seed size development. The findings from this study strongly imply that the drought-tolerant genotype, through enhanced antioxidant capacity, can effectively produce energy-rich storage compounds, thereby optimizing carbon allocation under water stress. Such insights are invaluable for future breeding strategies aimed at improving barley resilience in the face of climate variability., Competing Interests: Declarations Competing interests The authors declare no competing interests., (© 2024. The Author(s).)

The impact of limited water availability on lettuce growth has been well documented. However, the mechanisms by which lettuce controls seed germination under water stress remain unknown. Germination percentage was evaluated in the cv. Salinas (Lactuca sativa) (L. sativa) × US96UC23 (Lactuca serriola) (L. serriola) recombinant inbred line (RIL) population and USDA germplasm collection using 10% polyethylene glycol (PEG). About 50% of both populations displayed less than 90% germination. The average broad-sense heritability (H 2 ) for germination percentage was 0.81 across both populations. Two quantitative trait loci (QTL) for germination percentage were identified on chromosomes 4 and 8 in the RIL population. The RNA-Seq and network analyses of wild lettuce, US96UC23, were performed using the control (distilled water, dH 2 O) and treatment (10% PEG) datasets. The number of differentially expressed genes (DEGs) was 4,095. The top 20 gene ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were assessed by enrichment analysis. The consensus network analysis captured 44 modules. Gene networks were constructed for the top 20 hub genes in 10 significant modules from each dataset. This study comprehensively explains QTL, GO terms, KEGG pathways, and gene networks associated with lettuce seed germination under osmotic stress., (© 2024. This is a U.S. Government work and not under copyright protection in the US; foreign copyright protection may apply.)

Background: A critical factor in the storability of recalcitrant seeds is their moisture content (MC), but its effect on the viability of Cinnamomum cassia (L.) J. Presl (C. cassia) seeds is not fully understood., Methods and Results: Measured the germination rate, starch and soluble sugar content, and transcriptome of 8 seed samples with different MC obtained by low-temperature drying method. It was found that the germination rate was significantly negatively correlated with MC. The lethal MC was around 15.6%. During the dehydration process, there was a significant increase in the content of soluble sugars and starch. Transcriptome analysis was performed on CK, W3, W6 showed a total of 62.78 Gb of clean data. Among the 30,228 Unigenes, 28,195 were successfully annotated. In the three comparative groups (CK and W3, CK and W6, W3 and W6), 6,842, 7,640, and 11,628 differentially expressed genes (DEGs) were obtained, respectively. These DEGs were found to be involved in a variety of metabolic pathways, including carbon metabolism, amino acid biosynthesis, starch and sucrose metabolism, glycolysis/gluconeogenesis, and nucleotide and amino sugar metabolism. A total of 1,416 common genes were identified among all three comparison groups. Furthermore, among all the DEGs, a total of 71 transcription factor families were identified, with the C2H2 transcription factor family having the highest number of genes., Conclusions: This ground-breaking study sheds light on the physiological response and gene expression profiles of C. cassia seeds after undergoing dehydration treatment, which will provide valuable insights for further research and understanding of this process., (© 2024. The Author(s), under exclusive licence to Springer Nature B.V.)

Pearl millet (Cenchrus americanus) is a cereal crop that can tolerate high temperatures, drought, and low-fertility conditions where other crops lose productivity. However, genes regulating this ability are largely unknown. Transcription factors (TFs) regulate transcription of their target genes, regulate downstream biological processes, and thus are candidates for regulators of such tolerance of pearl millet. PgWRKY74 encodes a group IIc WRKY TF in pearl millet and is downregulated by drought. PgWRKY74 may have a role in drought tolerance. The objective of this study was to gain insights into the physiological and biochemical functions of PgWRKY74. Yeast one-hybrid and gel shift assays were performed to examine transcriptional activation potential and deoxyribonucleic acid (DNA)-binding ability, respectively. Transgenic Arabidopsis thaliana plants overexpressing PgWRKY74-green fluorescent protein (GFP) fusion gene were generated and tested for growth and stress-responsive gene expression under mannitol and NaCl-stressed conditions. A construct with PgWRKY74 enabled yeast reporter cells to survive on test media in the yeast one-hybrid assays. The electrophoretic mobility of DNA with putative WRKY TF-binding motifs was lower in the presence of a recombinant PgWRKY74 protein than its absence. The PgWRKY74-GFP-overexpressing Arabidopsis plants exhibited smaller rosette areas than did wild-type plants under mannitol-stressed and NaCl-stressed conditions, and exhibited weaker expression of RD29B, which is induced by the stress-related phytohormone abscisic acid (ABA), under the mannitol-stressed condition. PgWRKY74 have transcriptional activation potential and DNA-binding ability, and can negatively regulate plant responses to mannitol and NaCl stresses, possibly by decreasing ABA levels or ABA sensitivity., (© 2024. The Author(s).)

Wheat is the most widely grown crop in the world; its production is severely disrupted by increasing water deficit. Plant roots play a crucial role in the uptake of water and perception and transduction of water deficit signals. In the past decade, the mechanisms of drought tolerance have been frequently reported; however, the transcriptome and metabolome regulatory network of root responses to water stress has not been fully understood in wheat. In this study, the global transcriptomic and metabolomics profiles were employed to investigate the mechanisms of roots responding to water stresses using the drought-tolerant (DT) and drought-susceptible (DS) wheat genotypes. The results showed that compared with the control group, wheat roots exposed to polyethylene glycol (PEG) had 25941 differentially expressed genes (DEGs) and more upregulated genes were found in DT (8610) than DS (7141). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the DEGs of the drought-tolerant genotype were preferably enriched in the flavonoid biosynthetic process, anthocyanin biosynthesis and suberin biosynthesis. The integrated analysis of the transcriptome and metabolome showed that in DT, the KEGG pathways, including flavonoid biosynthesis and arginine and proline metabolism, were shared by differentially accumulated metabolites (DAMs) and DEGs at 6 h after treatment (HAT) and pathways including alanine, aspartate, glutamate metabolism and carbon metabolism were shared at 48 HAT, while in DS, the KEGG pathways shared by DAMs and DEGs only included arginine and proline metabolism at 6 HAT and the biosynthesis of amino acids at 48 HAT. Our results suggest that the drought-tolerant genotype may relieve the drought stress by producing more ROS scavengers, osmoprotectants, energy and larger roots. Interestingly, hormone signaling plays an important role in promoting the development of larger roots and a higher capability to absorb and transport water in drought-tolerant genotypes.

Key Message: This study mapped and screened three candidate genes related to kernel dehydration in maize. The slow development rate of maize kernels during later stages leads to high kernel moisture content at harvest, posing a challenge for mechanized maize harvesting in China. This study utilized a recombinant inbred line population derived from Zheng 58 (slow dehydration) and PH6WC (fast dehydration) as parents. After four years of trait investigation and analysis, 25 quantitative trait loci (QTLs) associated with kernel dehydration rate and moisture content were identified, with six QTLs showing a significant contribution value exceeding 10% in the phenotype. Furthermore, a comparison was made between the QTLs identified in this study and those from previous research on maize kernel moisture content and dehydration rate, followed by screening through the omics analysis of the parental lines. Three candidate genes related to kernel dehydration rate were identified, primarily involving carbohydrate metabolism, energy metabolism processes (Zm00001d014030 and Zm00001d006476), and stimulus resistance (Zm00001d040113). These findings provide valuable insights to assist and guide future breeding efforts for mechanical harvesting of maize., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

The African clawed frog ( Xenopus laevis ) endures prolonged periods of dehydration while estivating underground during the dry season. Epigenetic modifications play crucial roles in regulating gene expression in response to environmental changes. The elucidation of epigenetic changes relevant to survival could serve as a basis for further studies on organ preservation under extreme stress. The current study examined the relative protein levels of key enzymes involved in the arginine methylation of histones in the liver and kidney tissues of control versus dehydrated (35 ± 1%) X. laevis through immunoblotting. Protein arginine methyltransferases (PRMT) 4, 5, and 6 showed significant protein level decreases of 35 ± 3%, 71 ± 7%, and 25 ± 5%, respectively, in the liver tissues of the dehydrated frogs relative to controls. In contrast, PRMT7 exhibited an increase of 36 ± 4%. Similarly, the methylated histone markers H3R2m2a, H3R8m2a, and H3R8m2s were downregulated by 34 ± 11%, 15 ± 4%, and 42 ± 12%, respectively, in the livers of dehydrated frogs compared to controls. By contrast, the kidneys of dehydrated frogs showed an upregulation of histone markers. H3R2m2a, H3R8m2a, H3R8m2s, and H4R3m2a were significantly increased by 126 ± 12%, 112 ± 7%, 47 ± 13%, and 13 ± 3%, respectively. These changes can play vital roles in the metabolic reorganization of X. laevis during dehydration, and are likely to increase the chances of survival. In turn, the tissue-specific regulation of the histone arginine methylation mechanism suggests the importance of epigenetic regulation in the adaptation of X. laevis for whole-body dehydration.

Breeding high yielding water-deficit tolerant rice is considered a primary goal for achieving the objectives of the sustainable development goals, 2030. However, evaluating the performance of the pre-breeding-promising parental-lines for water deficit tolerance prior to their incorporation in the breeding program is crucial for the success of the breeding programs. The aim of the current investigation is to assess the performance of a set of pre-breeding lines compared with their parents. To achieve this goal a set of 7 pre-breeding rice lines along with their parents (5 genotypes) were field evaluated under well-irrigated and water-stress conditions. Water stress was applied by flush irrigation every 12 days without keeping standing water after irrigation. Based on the field evaluation results, a pre-breeding line was selected to conduct physiological and expression analysis of drought related genes at the green house. Furthermore, a greenhouse trial was conducted in pots, where the genotypes were grown under well and stress irrigation conditions at seedling stage for physiological analysis and expression profiling of the genotypes. Results indicated that the pre-breeding lines which were high yielding under water shortage stress showed low drought susceptibility index. Those lines exhibited high proline, SOD, TSS content along with low levels of MDA content in their leaves. Moreover, the genotypes grain yield positively correlated with proline, SOD, TSS content in their leaves. The SSR markers RM22, RM525, RM324 and RM3805 were able to discriminate the tolerant parents from the sensitive one. Expression levels of the tested drought responsive genes revealed the upregulation of OsLEA3, OsAPX2, OsNAC1, OSDREB2A, OsDREB1C, OsZIP23, OsP5CS, OsAHL1 and OsCATA genes in response to water deficit stress as compared to their expression under normal irrigated condition. Taken together among the tested pre-breeding lines the RBL112 pre-breeding line is high yielding under water-deficit and could be used as donor for high yielding genes in the breeding for water deficit resistance. This investigation withdraws attention to evaluate the promising pre-breeding lines before their incorporation in the water deficit stress breeding program., (© 2024. The Author(s).)

Common beans ( Phaseolus vulgaris L.), besides being an important source of nutrients such as iron, magnesium, and protein, are crucial for food security, especially in developing countries. Common bean cultivation areas commonly face production challenges due to drought occurrences, mainly during the reproductive period. Dry spells last approximately 20 days, enough time to compromise production. Hence, it is crucial to understand the genetic and molecular mechanisms that confer drought tolerance to improve common bean cultivars' adaptation to drought. Sixty six RNASeq libraries, generated from tolerant and sensitive cultivars in drought time sourced from the R5 phenological stage at 0 to 20 days of water deficit were sequenced, generated over 1.5 billion reads, that aligned to 62,524 transcripts originating from a reference transcriptome, as well as 6673 transcripts obtained via de novo assembly. Differentially expressed transcripts were functionally annotated, revealing a variety of genes associated with molecular functions such as oxidoreductase and transferase activity, as well as biological processes related to stress response and signaling. The presence of regulatory genes involved in signaling cascades and transcriptional control was also highlighted, for example, LEA proteins and dehydrins associated with dehydration protection, and transcription factors such as WRKY, MYB, and NAC, which modulate plant response to water deficit. Additionally, genes related to membrane and protein protection, as well as water and ion uptake and transport, were identified, including aquaporins, RING-type E3 ubiquitin transferases, antioxidant enzymes such as GSTs and CYPs, and thioredoxins. This study highlights the complexity of plant response to water scarcity, focusing on the functional diversity of the genes involved and their participation in the biological processes essential for plant adaptation to water stress. The identification of regulatory and cell protection genes offers promising prospects for genetic improvement aiming at the production of common bean varieties more resistant to drought. These findings have the potential to drive sustainable agriculture, providing valuable insights to ensure food security in a context of climate change.

Drought is a major environmental stress that limits plant growth, so it's important to identify drought-responsive genes to understand the mechanism of drought response and breed drought-tolerant roses. Protein phosphatase 2C (PP2C) plays a crucial role in plant abiotic stress response. In this study, we identified 412 putative PP2Cs from six Rosaceae species. These genes were divided into twelve clades, with clade A containing the largest number of PP2Cs (14.1%). Clade A PP2Cs are known for their important role in ABA-mediated drought stress response; therefore, the analysis focused on these specific genes. Conserved motif analysis revealed that clade A PP2Cs in these six Rosaceae species shared conserved C-terminal catalytic domains. Collinearity analysis indicated that segmental duplication events played a significant role in the evolution of clade A PP2Cs in Rosaceae. Analysis of the expression of 11 clade A RcPP2Cs showed that approximately 60% of these genes responded to drought, high temperature, and salt stress. Among them, RcPP2C24 exhibited the highest responsiveness to both drought and ABA. Furthermore, overexpression of RcPP2C24 significantly reduced drought tolerance in transgenic tobacco by increasing stomatal aperture after exposure to drought stress. The transient overexpression of RcPP2C24 weakened the dehydration tolerance of rose petal discs, while its silencing increased their dehydration tolerance. In summary, our study identified PP2Cs in six Rosaceae species and highlighted the negative role of RcPP2C24 on rose's drought tolerance by inhibiting stomatal closure. Our findings provide valuable insights into understanding the mechanism behind rose's response to drought., Competing Interests: Declaration of competing interest The authors declare no conflict of interest., (Copyright © 2024 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter., (© 2024 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

Human myeloid leukemia cells (HL-60/S4) exposed to hyperosmotic stress with sucrose undergo dehydration and cell shrinkage. Interphase chromatin and mitotic chromosomes congeal, exhibiting altered phase separation (demixing) of chromatin proteins. To investigate changes in the transcriptome, we exposed HL-60/S4 cells to hyperosmotic sucrose stress (~600 milliOsmolar) for 30 and 60 minutes. We employed RNA-Seq of polyA mRNA to identify genes with increased or decreased transcript levels relative to untreated control cells (i.e., differential gene expression). These genes were examined for over-representation of Gene Ontology (GO) terms.  In stressed cells, multiple GO terms associated with transcription, translation, mitochondrial function and proteosome activity, as well as "replication-dependent histones", were over-represented among genes with increased transcript levels; whereas, genes with decreased transcript levels were over-represented with transcription repressors. The transcriptome profiles of hyperosmotically-stressed cells suggest acquisition of cellular rebuilding, a futile homeostatic response, as these cells are ultimately doomed to a dehydrated death.

Main Conclusion: Expression profiling of NF-Y transcription factors during dehydration and salt stress in finger millet genotypes contrastingly differing in tolerance levels identifies candidate genes for further characterization and functional studies. The Nuclear Factor-Y (NF-Y) transcription factors are known for imparting abiotic stress tolerance in different plant species. However, there is no information on the role of this transcription factor family in naturally drought-tolerant crop finger millet (Eleusine coracana L.). Therefore, interpretation of expression profiles against drought and salinity stress may provide valuable insights into specific and/or overlapping expression patterns of Eleusine coracana Nuclear Factor-Y (EcNF-Y) genes. Given this, we identified 59 NF-Y (18 NF-YA, 23 NF-YB, and 18 NF-YC) encoding genes and designated them EcNF-Y genes. Expression profiling of these genes was performed in two finger millet genotypes, PES400 (dehydration and salt stress tolerant) and VR708 (dehydration and salt stress sensitive), subjected to PEG-induced dehydration and salt (NaCl) stresses at different time intervals (0, 6, and 12 h). The qRT-PCR expression analysis reveals that the six EcNF-Y genes namely EcNF-YA1, EcNF-YA5, EcNF-YA16, EcNF-YB6, EcNF-YB10, and EcNF-YC2 might be associated with tolerance to both dehydration and salinity stress in early stress condition (6 h), suggesting the involvement of these genes in multiple stress responses in tolerant genotype. In contrast, the transcript abundance of finger millet EcNF-YA5 genes was also observed in the sensitive genotype VR708 under late stress conditions (12 h) of both dehydration and salinity stress. Therefore, the EcNF-YA5 gene might be important for adaptation to salinity and dehydration stress in sensitive finger millet genotypes. Therefore, this gene could be considered as a susceptibility determinant, which can be edited to impart tolerance. The phylogenetic analyses revealed that finger millet NF-Y genes share strong evolutionary and functional relationship to NF-Ys governing response to abiotic stresses in rice, sorghum, maize, and wheat. This is the first report of expression profiling of EcNF-Ys genes identified from the finger millet genome and reveals potential candidate for enhancing dehydration and salt tolerance., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

The NAC family of transcription factors (TFs) regulate plant development and abiotic stress. However, the specific function and response mechanism of NAC TFs that increase drought resistance in Picea wilsonii remain largely unknown. In this study, we functionally characterized a member of the PwNAC family known as PwNAC31 . PwNAC31 is a nuclear-localized protein with transcriptional activation activity and contains an NAC domain that shows extensive homology with ANAC072 in Arabidopsis . The expression level of PwNAC31 is significantly upregulated under drought and ABA treatments. The heterologous expression of PwNAC31 in atnac072 Arabidopsis mutants enhances the seed vigor and germination rates and restores the hypersensitive phenotype of atnac072 under drought stress, accompanied by the up-regulated expression of drought-responsive genes such as DREB2A (DEHYDRATION-RESPONSIVE ELEMENT BINDING PROTEIN 2A) and ERD1 (EARLY RESPONSIVE TO DEHYDRATION STRESS 1) . Yeast two-hybrid and bimolecular fluorescence complementation assays confirmed that PwNAC31 interacts with DREB2A and ABF3 (ABSCISIC ACID-RESPONSIVE ELEMENT-BINDING FACTOR 3). Yeast one-hybrid and dual-luciferase assays showed that PwNAC31, together with its interaction protein DREB2A, directly regulated the expression of ERD1 by binding to the DRE element of the ERD1 promoter. Collectively, our study provides evidence that PwNAC31 activates ERD1 by interacting with DREB2A to enhance drought tolerance in transgenic Arabidopsis .

Dehydration is a stress factor for organisms inhabiting natural habitats where water is scarce. Thus, it may be expected that species facing arid environments will develop mechanisms that maximize resistance to desiccation. Insects are excellent models for studying the effects of dehydration as well as the mechanisms and processes that prevent water loss since the effect of desiccation is greater due to the higher area/volume ratio than larger animals. Even though physiological and behavioral mechanisms to cope with desiccation are being understood, the genetic basis underlying the mechanisms related to variation in desiccation resistance and the context-dependent effect remain unsolved. Here we analyze the genetic bases of desiccation resistance in Drosophila melanogaster and identify candidate genes that underlie trait variation. Our quantitative genetic analysis of desiccation resistance revealed sexual dimorphism and extensive genetic variation. The phenotype-genotype association analyses (GWAS) identified 71 candidate genes responsible for total phenotypic variation in desiccation resistance. Half of these candidate genes were sex-specific suggesting that the genetic architecture underlying this adaptive trait differs between males and females. Moreover, the public availability of desiccation data analyzed on the same lines but in a different lab allows us to investigate the reliability and repeatability of results obtained in independent screens. Our survey indicates a pervasive micro-environment lab-dependent effect since we did not detect overlap in the sets of genes affecting desiccation resistance identified between labs., (© 2023. The Author(s), under exclusive licence to Springer Nature Switzerland AG.)

Background: Kernel dehydration is an important factor for the mechanized harvest in maize. Kernel moisture content (KMC) and kernel dehydration rate (KDR) are important indicators for kernel dehydration. Although quantitative trait loci and genes related to KMC have been identified, where most of them only focus on the KMC at harvest, these are still far from sufficient to explain all genetic variations, and the relevant regulatory mechanisms are still unclear. In this study, we tried to reveal the key proteins and metabolites related to kernel dehydration in proteome and metabolome levels. Moreover, we preliminarily explored the relevant metabolic pathways that affect kernel dehydration combined proteome and metabolome. These results could accelerate the development of further mechanized maize technologies., Results: In this study, three maize inbred lines (KB182, KB207, and KB020) with different KMC and KDR were subjected to proteomic analysis 35, 42, and 49 days after pollination (DAP). In total, 8,358 proteins were quantified, and 2,779 of them were differentially expressed proteins in different inbred lines or at different stages. By comparative analysis, K-means cluster, and weighted gene co-expression network analysis based on the proteome data, some important proteins were identified, which are involved in carbohydrate metabolism, stress and defense response, lipid metabolism, and seed development. Through metabolomics analysis of KB182 and KB020 kernels at 42 DAP, 18 significantly different metabolites, including glucose, fructose, proline, and glycerol, were identified., Conclusions: In sum, we inferred that kernel dehydration could be regulated through carbohydrate metabolism, antioxidant systems, and late embryogenesis abundant protein and heat shock protein expression, all of which were considered as important regulatory factors during kernel dehydration process. These results shed light on kernel dehydration and provide new insights into developing cultivars with low moisture content., (© 2023. The Author(s).)

Phosphorylation of AT Hook-Like 10 (AHL10), one of the AT-hook family of plant-specific DNA binding proteins, is critical for growth suppression during moderate severity drought (low water potential, ψ w ) stress. To understand how AHL10 phosphorylation determines drought response, we identified putative AHL10 interacting proteins and further characterized interaction with RRP6L1, a protein involved in epigenetic regulation. RRP6L1 and AHL10 mutants, as well as ahl10-1rrp6l1-2, had similar phenotypes of increased growth maintenance during low ψ w . Chromatin precipitation demonstrated that RRP6L1 chromatin association increased during low ψ w stress and was dependent upon AHL10 phosphorylation. Transcriptome analyses showed that AHL10 and RRP6L1 have concordant effects on expression of stress- and development-related genes. Together these results indicate that stress signalling can act via AHL10 phosphorylation to control the chromatin association of the key regulatory protein RRP6L1. AHL10 and RRP6L1 interaction in meristem cells is part of a mechanism to downregulate growth during low ψ w stress. Interestingly, the loss of AHL13, which is homologous to AHL10 and phosphorylated at a similar C-terminal site, blocked the enhanced growth maintenance of ahl10-1. Thus, AHL10 and AHL13, despite their close homology, are not redundant but rather have distinct roles, likely related to the formation of AHL hetero-complexes., (© 2023 John Wiley & Sons Ltd.)

Early Responsive to Dehydration (ERD) genes are rapidly induced in response to various biotic and abiotic stresses, such as bacteria, drought, light, temperature and high salt in Arabidopsis thaliana . Sixteen ERD of Arabidopsis thaliana ( AtERD ) genes have been previously identified. The lengths of the coding region of the genes are 504-2838 bp. They encode 137-745 amino acids. In this study, the AtERD genes structure and promoter are analyzed through bioinformatics, and a overall function is summarized and a systematic signal pathway involving AtERD genes is mapped. AtERD9, AtERD11 and AtERD13 have the GST domain. AtERD10 and AtERD14 have the Dehyd domain. The promoters regions contain 32 light responsive elements, 23 ABA responsive elements, 5 drought responsive elements, 5 meristem expression related elements and 132 core promoter elements. The study provides a theoretical guidance for subsequent studies of AtERD genes.

Background: Neoporphyra haitanensis, a major marine crop native to southern China, grows in the harsh intertidal habitats of rocky coasts. The thallus can tolerate fluctuating and extreme environmental stresses, for example, repeated desiccation/rehydration due to the turning tides. It is also a typical model system for investigating stress tolerance mechanisms in intertidal seaweed. The basic leucine zipper (bZIP) transcription factors play important roles in the regulation of plants' responses to environmental stress stimuli. However, little information is available regarding the bZIP family in the marine crop Nh. haitanensis., Results: We identified 19 bZIP genes in the Nh. haitanensis genome and described their conserved domains. Based on phylogenetic analysis, these 19 NhhbZIP genes, distributed unevenly on the 11 superscaffolds, were divided into four groups. In each group, there were analogous exon/intron numbers and motif compositions, along with diverse exon lengths. Cross-species collinearity analysis indicated that 17 and 9 NhhbZIP genes were orthologous to bZIP genes in Neopyropia yezoensis and Porphyra umbilicalis, respectively. Evidence from RNA sequencing (RNA-seq) data showed that the majority of NhhbZIP genes (73.68%) exhibited transcript abundance in all treatments. Furthermore, genes NN 2, 4 and 5 showed significantly altered expression in response to moderate dehydration, severe dehydration, and rehydration, respectively. Gene co-expression network analysis of the representative genes was carried out, followed by gene set enrichment analysis. Two NhhbZIP genes collectively responding to dehydration and rehydration and their co-expressing genes mainly participated in DNA repair, DNA metabolic process, and regulation of helicase activity. Two specific NhhbZIP genes responding to severe dehydration and their corresponding network genes were mainly involved in macromolecule modification, cellular catabolic process, and transmembrane transport. Three specific NhhbZIP genes responding to rehydration and their co-expression gene networks were mainly involved in the regulation of the cell cycle process and defense response., Conclusions: This study provides new insights into the structural composition, evolution, and function of the NhhbZIP gene family. Our results will help us to further study the functions of bZIP genes in response to dehydration and rehydration in Nh. haitanensis and improve Nh. haitanensis in southern China., (© 2023. The Author(s).)

Grisemycin, salinipeptin, and cypemycin belong to the linaridin class of ribosomally synthesized and posttranslationally modified peptides that contain multiple dehydrobutyrine and D-amino acid residues. The biosynthetic gene clusters of these linaridins lack obvious candidate genes for the dehydratase and epimerase required to introduce dehydrobutyrine and D-amino acid residues, respectively. However, we previously demonstrated that the grisemycin (grm) cluster contained cryptic dehydratase and epimerase genes by heterologous expression of this biosynthetic gene cluster in Streptomyces lividans and proposed that two genes (grmH and grmL) with unknown functions catalyze dehydration and epimerization reactions. In this study, we confirmed that both GrmH and GrmL, which were shown to constitute a protein complex by a co-purification experiment, were required to catalyze the dehydration, epimerization, and proteolytic cleavage of a precursor peptide GrmA by in vivo experiments. Furthermore, we demonstrated that GrmH/GrmL complex accepted salinipeptin and cypemycin precursor peptides, which possess three additional amino acids., (© The Author(s) 2023. Published by Oxford University Press on behalf of Japan Society for Bioscience, Biotechnology, and Agrochemistry.)

In plants, the ability to produce hydrophobic substances that would provide protection from dehydration was required for the transition to land. This genome-wide investigation outlines the evolution of GDSL-type esterase/lipase (GELP) proteins in the moss Physcomitrium patens and suggests possible functions of some genes. GELP proteins play roles in the formation of hydrophobic polymers such as cutin and suberin that protect against dehydration and pathogen attack. GELP proteins are also implicated in processes such as pollen development and seed metabolism and germination. The P. patens GELP gene family comprises 48 genes and 14 pseudogenes. Phylogenetic analysis of all P. patens GELP sequences along with vascular plant GELP proteins with reported functions revealed that the P. patens genes clustered within previously identified A, B and C clades. A duplication model predicting the expansion of the GELP gene family within the P. patens lineage was constructed. Expression analysis combined with phylogenetic analysis suggested candidate genes for functions such as defence against pathogens, cutin metabolism, spore development and spore germination. The presence of relatively fewer GELP genes in P. patens may reduce the occurrence of functional redundancy that complicates the characterization of vascular plant GELP genes. Knockout lines of GELP31, which is highly expressed in sporophytes, were constructed. Gelp31 spores contained amorphous oil bodies and germinated late, suggesting (a) role(s) of GELP31 in lipid metabolism in spore development or germination. Future knockout studies of other candidate GELP genes will further elucidate the relationship between expansion of the family and the ability to withstand the harsh land environment., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

In this study, a transcriptomic analysis of the dehydration rate of mature rice seeds was conducted to explore candidate genes related to the dehydration rate and provide a theoretical basis for breeding and utilization. We selected two rice cultivars for testing (Baghlani Nangarhar, an extremely rapid dehydration genotype, and Saturn, a slow dehydration genotype) based on the results determined by previous studies conducted on the screening of 165 germplasm materials for dehydration rate phenotypes. A rapid dehydration experiment performed on these two types of seeds was conducted. Four comparative groups were set up under control and dehydration conditions. The differentially expressed genes (DEGs) were quantified via transcriptome sequencing and real-time quantitative PCR (RT-qPCR). GO (Gene ontology) and KEGG(Kyoto Encyclopedia of Genes and Genomes) analyses were also conducted. In Baghlani Nangarhar, 53 DEGs were screened, of which 33 were up-regulated and 20 were down-regulated. In Saturn, 25 DEGs were screened, of which 19 were up-regulated and 6 were down-regulated. The results of the GO analysis show that the sites of action of the differentially expressed genes enriched in the rapid dehydration modes are concentrated in the cytoplasm, internal components of the membrane, and nucleosomes. They play regulatory roles in the processes of catalysis, binding, translocation, transcription, protein folding, degradation, and replication. They are also involved in adaptive responses to adverse external environments, such as reactive oxygen species and high temperature. The KEGG analysis showed that protein processing in the endoplasmic reticulum, amino acid biosynthesis, and oxidative phosphorylation were the main metabolic pathways that were enriched. The key differentially expressed genes and the most important metabolic pathways identified in the rapidly and slowly dehydrated genotypes were protein processing in the endoplasmic reticulum and oxidative phosphorylation metabolism. They were presumed to have important regulatory roles in the mechanisms of stress/defense, energy metabolism, protein synthesis/folding, and signal transduction during the dehydration and drying of mature seeds. The results of this study can potentially provide valuable information for further research on the genes and metabolic pathways related to the dehydration rate of mature rice seeds, and provide theoretical guidance for the selection and breeding of new rice germplasm that can be rapidly dehydrated at the mature stage.

Drought is among the most challenging environmental restrictions to tomatoes (Solanum lycopersi-cum), which causes dehydration of the tissues and results in massive loss of yield. Breeding for dehydration-tolerant tomatoes is a pressing issue as a result of global climate change that leads to increased duration and frequency of droughts. However, the key genes involved in dehydration response and tolerance in tomato are not widely known, and genes that can be targeted for dehydration-tolerant tomato breeding remains to be discovered. Here, we compared phenotypes and transcriptomic profiles of tomato leaves between control and dehydration conditions. We show that dehydration decreased the relative water content of tomato leaves after 2 h of dehydration treatment; however, it promoted the malondialdehyde (MDA) content and ion leakage ratio after 4 h and 12 h of dehydration, respectively. Moreover, dehydration stress triggered oxidative stress as we detected significant increases in H 2 O 2 and O 2- levels. Simultaneously, dehydration enhanced the activities of antioxidant enzymes including peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), and phenylalanine ammonia-lyase (PAL). Genome-wide RNA sequencing of tomato leaves treated with or without dehydration (control) identified 8116 and 5670 differentially expressed genes (DEGs) after 2 h and 4 h of dehydration, respectively. These DEGs included genes involved in translation, photosynthesis, stress response, and cytoplasmic translation. We then focused specifically on DEGs annotated as transcription factors (TFs). RNA-seq analysis identified 742 TFs as DEGs by comparing samples dehydrated for 2 h with 0 h control, while among all the DEGs detected after 4 h of dehydration, only 499 of them were TFs. Furthermore, we performed real-time quantitative PCR analyses and validated expression patterns of 31 differentially expressed TFs of NAC, AP2/ERF, MYB, bHLH, bZIP, WRKY, and HB families. In addition, the transcriptomic data revealed that expression levels of six drought-responsive marker genes were upregulated by de-hydration treatment. Collectively, our findings not only provide a solid foundation for further functional characterization of dehydration-responsive TFs in tomatoes but may also benefit the improvement of dehydration/drought tolerance in tomatoes in the future.

Engineering drought tolerance in rice needs to focus on regulators that enhance tolerance while boosting plant growth and vigor. The present study delineated the concealed function and tissue-mediated interplay of the miR408/target module in imparting drought stress tolerance in rice. The plant miR408 family comprises three dominant mature forms (21 nt), including a distinct monocot variant (F-7 with 5' C) and is divided into six groups. miR408 majorly cleaves genes belonging to the blue copper protein in addition to several other species-specific targets in plants. Comparative sequence analysis in 4726 rice accessions identified 22 sequence variants (SNP and InDELs) in its promoter (15) and pre-miR408 region. Haplotype analysis of the sequence variants indicated eight haplotypes (three: Japonica-specific and five: Indica-specific) of the miR408 promoter. In drought-tolerant Nagina 22, miR408 follows flag leaf preferential expression. Under drought conditions, its levels are upregulated in flag leaf and roots which seems to be regulated by a differential fraction of methylated cytosines (mCs) in the precursor region. The active pool of miR408 regulated targets under control and drought conditions is impacted by the tissue type. Comparative expression analysis of the miR408/target module under different sets of conditions features 83 targets exhibiting antagonistic expression in rice, out of which 12 genes, including four PLANTACYANINS (OsUCL6, 7, 9 and 30), PIRIN, OsLPR1, OsCHUP1, OsDOF12, OsBGLU1, glycine-rich cell wall gene, OsDUT, and OsERF7, are among the high confidence targets. Further, overexpression of MIR408 in drought-sensitive rice cultivar (PB1) leads to the massive enhancement of vegetative growth in rice with improved ETR and Y(II) and enhanced dehydration stress tolerance. The above results suggest that miR408 is likely to act as a positive regulator of growth and vigor, as well as dehydration stress, making it a potential candidate for engineering drought tolerance in rice., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Plants have evolved mechanisms of adaptation to fluctuations in their environmental conditions that have been given the term "stress memory". Synthetic wheat offers new hope for breeders to restore useful genes lost during the genetic bottleneck. We aimed to test whether drought priming and seed priming could improve drought tolerance in a diverse germplasm of synthetic and common wheat under field conditions. In this research, 27 wheat genotypes (including 20 synthetics, 4 common local and 3 common exotic bread wheat) were field evaluated under four water environments. These treatments included: 1) normal condition (N), plants were irrigated when 40% of the total available soil water was depleted from the root-zone, 2) seed priming-secondary stress (SD2), only water stress was applied at anthesis when 90% of the total available soil water was depleted and seeds were planted for evaluating, 3) primary stress- secondary stress (D1D2), primary water stress was applied at jointing stage when 70% of the total available soil water was depleted then secondary water stress was applied at the anthesis stage when 90% of the total available soil water was depleted, and 4) secondary stress (D2) only water stress was applied at the anthesis when 90% of the total available soil water was depleted. Our results indicated that improved efficient enzymatic antioxidant system leads to less yield reduction in D1D2 treatment. However, the positive effects of drought priming were more pronounced in drought primed (D1D2) than seed primed treatment (SD2). Synthetic wheat genotypes had a significant superiority in terms of yield, yield components and drought tolerance compared to common wheat genotypes. Nevertheless, the response of genotypes to stress memory was very different. Drought sensitive genotypes had better response to stress memory. Superior genotypes were identified as high yield and drought tolerant genotypes which can be used for future studies., (© 2023. The Author(s).)

Drought is a harmful abiotic stress that threatens the growth, development, and yield of rice plants. To cope with drought stress, plants have evolved their diverse and sophisticated stress-tolerance mechanisms by regulating gene expression. Previous genome-wide studies have revealed many rice drought stress-responsive genes that are involved in various forms of metabolism, hormone biosynthesis, and signaling pathways, and transcriptional regulation. However, little is known about the regulation of drought-responsive genes during rehydration after dehydration. In this study, we examined the dynamic gene expression patterns in rice seedling shoots during dehydration and rehydration using RNA-seq analysis. To investigate the transcriptome-wide rice gene expression patterns during dehydration and rehydration, RNA-seq libraries were sequenced and analyzed to identify differentially expressed genes (DEGs). DEGs were classified into five clusters based on their gene expression patterns. The clusters included drought-responsive DEGs that were either rapidly or slowly recovered to control levels by rehydration treatment. Representative DEGs were selected and validated using qRT-PCR. In addition, we performed a detailed analysis of DEGs involved in nitrogen metabolism, phytohormone signaling, and transcriptional regulation. In this study, we revealed that drought-responsive genes were dynamically regulated during rehydration. Moreover, our data showed the potential role of nitrogen metabolism and jasmonic acid signaling during the drought stress response. The transcriptome data in this study could be a useful resource for understanding drought stress responses in rice and provide a valuable gene list for developing drought-resistant crop plants.

Fibrillin family members play multiple roles in growth, development, and protection against abiotic stress. In this study, we identified 12 potential CaFBNs that are ranging from 25 kDa-42.92 kDa and are mostly basic. These proteins were hydrophilic in nature and generally resided in the chloroplast. The CaFBN genes were located on different chromosomes like 1, 4, 5, and 7. All FBNs shared conserved motifs and possessed a higher number of stress-responsive elements. For evolutionary analysis, a phylogenetic tree of CaFBNs with other plants' FBNs was constructed and clustered into 11 FBN subgroups. For expression analysis, 21 day old chickpea seedling was exposed to dehydration stress by withholding water. We also performed various physiological and biochemical analyses to check that plant changes at the physiological and cellular levels while undergoing stress conditions. The transcript expression of CaFBNs was higher in aerial parts, especially in stems and leaves. Dehydration-specific transcriptome and qPCR analysis showed that FBN-1, FBN-2, and FBN-6 were highly expressed. In addition, our study provides a comprehensive overview of the FBN protein family and their importance during the dehydration stress condition in Cicer arietinum., Competing Interests: Declaration of competing interest Authors declare that they have no conflict of interest., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Background: Late embryogenesis abundant (LEA) proteins play an important role in dehydration process of seed maturation. The seeds of Panax notoginseng (Burkill) F. H. Chen are typically characterized with the recalcitrance and are highly sensitive to dehydration. However, it is not very well known about the role of LEA proteins in response to dehydration stress in P. notoginseng seeds. We will perform a genome-wide analysis of the LEA gene family and their transcriptional responses to dehydration stress in recalcitrant P. notoginseng seeds., Results: In this study, 61 LEA genes were identified from the P. notoginseng genome, and they were renamed as PnoLEA. The PnoLEA genes were classified into seven subfamilies based on the phylogenetic relationships, gene structure and conserved domains. The PnoLEA genes family showed relatively few introns and was highly conserved. Unexpectedly, the LEA_6 subfamily was not found, and the LEA_2 subfamily contained 46 (75.4%) members. Within 19 pairs of fragment duplication events, among them 17 pairs were LEA_2 subfamily. In addition, the expression of the PnoLEA genes was obviously induced under dehydration stress, but the germination rate of P. notoginseng seeds decreased as the dehydration time prolonged., Conclusions: We found that the lack of the LEA_6 subfamily, the expansion of the LEA_2 subfamily and low transcriptional levels of most PnoLEA genes might be implicated in the recalcitrant formation of P. notoginseng seeds. LEA proteins are essential in the response to dehydration stress in recalcitrant seeds, but the protective effect of LEA protein is not efficient. These results could improve our understanding of the function of LEA proteins in the response of dehydration stress and their contributions to the formation of seed recalcitrance., (© 2023. The Author(s).)

Background: Iris lactea var. chinensis, a perennial herbaceous species, is widely distributed and has good drought tolerance traits. However, there is little information in public databases concerning this herb, so it is difficult to understand the mechanism underlying its drought tolerance., Results: In this study, we used Illumina sequencing technology to conduct an RNA sequencing (RNA-seq) analysis of I. lactea var. chinensis plants under water-stressed conditions and rehydration to explore the potential mechanisms involved in plant drought tolerance. The resulting de novo assembled transcriptome revealed 126,979 unigenes, of which 44,247 were successfully annotated. Among these, 1187 differentially expressed genes (DEGs) were identified from a comparison of the water-stressed treatment and the control (CK) treatment (T/CK); there were 481 upregulated genes and 706 downregulated genes. Additionally, 275 DEGs were identified in the comparison of the rehydration treatment and the water-stressed treatment (R/T). Based on Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) analysis, the expression levels of eight randomly selected unigenes were consistent with the transcriptomic data under water-stressed and rehydration treatment, as well as in the CK. According to Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, proline metabolism-related DEGs, including those involved in the 'proline catabolic process', the 'proline metabolic process', and 'arginine and proline metabolism', may play important roles in plant drought tolerance. Additionally, these DEGs encoded 43 transcription factors (TFs), 46 transporters, and 22 reactive oxygen species (ROS)-scavenging system-related proteins. Biochemical analysis and histochemical detection showed that proline and ROS were accumulated under water-stressed conditions, which is consistent with the result of the transcriptomic analysis., Conclusions: In summary, our transcriptomic data revealed that the drought tolerance of I. lactea var. chinensis depends on proline metabolism, the action of TFs and transporters, and a strong ROS-scavenging system. The related genes found in this study could help us understand the mechanisms underlying the drought tolerance of I. lactea var. chinensis., (© 2023. The Author(s).)

Early responsive dehydration (ERD) genes can be rapidly induced by dehydration. ERD15 genes have been confirmed to regulate various stress responses in plants. However, the maize ERD15 members have not been characterized. In the present study, a total of five ZmERD15 genes were identified from the maize genome and named ZmERD15a , ZmERD15b , ZmERD15c , ZmERD15d , and ZmERD15e . Subsequently, their protein properties, gene structure and duplication, chromosomal location, cis -acting elements, subcellular localization, expression pattern, and over-expression in yeast were analyzed. The results showed that the ZmERD15 proteins were characterized by a similar size (113-159 aa) and contained a common domain structure, with PAM2 and adjacent PAE1 motifs followed by an acidic region. The ZmERD15 proteins exhibited a close phylogenetic relationship with OsERD15s from rice. Five ZmERD15 genes were distributed on maize chromosomes 2, 6, 7, and 9 and showed a different exon-intron organization and were expanded by duplication. Besides, the promoter region of the ZmERD15s contained abundant cis -acting elements that are known to be responsive to stress and hormones. Subcellular localization showed that ZmERD15b and ZmERD15c were localized in the nucleus. ZmERD15a and ZmERD15e were localized in the nucleus and cytoplasm. ZmERD15d was localized in the nucleus and cell membrane. The results of the quantitative real-time PCR (qRT-PCR) showed that the expression of the ZmERD15 genes was regulated by PEG, salinity, and ABA. The heterologous expression of ZmERD15a , ZmERD15b , ZmERD15c , and ZmERD15d significantly enhanced salt tolerance in yeast. In summary, a comprehensive analysis of ZmERD15s was conducted in the study. The results will provide insights into further dissecting the biological function and molecular mechanism of ZmERD15s regulating of the stress response in maize.

Aging is a complex biological process, resulting in gradual and progressive decline in structure and function in many organ systems. Our objective is to determine if structural changes produced by aging vary with sex in a stressful situation such as dehydration. The expression of Slc12a3 mRNA in the renal cortex, α-smooth muscle actin (α-SMA), and fibronectin was evaluated in male and female rats, aged 3 and 18 months, submitted and not submitted to water deprivation (WD) for 48 h, respectively. When comparing ages, 18-month-old males showed a lower expression of Slc12a3 mRNA than 3-month-old males, and control and WD 18-month-old male and female rats exhibited a higher expression of α-SMA than the respective 3-month-old rats. Fibronectin was higher in both control and WD 18-month-old males than the respective 3-month-old males. In females, only the control 18-month-old rats showed higher fibronectin than the control 3-month-old rats. When we compared sex, control and WD 3-month-old female rats had a lower expression of Slc12a3 mRNA than the respective males. The WD 18-month-old male rats presented a higher expression of fibronectin and α-SMA than the WD 18-month-old female rats. When we compared hydric conditions, the WD 18-month-old males displayed a lower relative expression of Slc12a3 mRNA and higher α-SMA expression than the control 18-month-old males. Aging, sex, and dehydration lead to alterations in kidney structure.

Synthetic hexaploid wheat-derived lines (SHW-DL) offers new hope for breeders to restore genes lost during the evolutionary bottleneck. The study of adaptability, variation, and the possibility of selection in SHW-DL for drought tolerance is poorly understood in arid environments. The potential of 184 SHW-DL and their variation for agro-morphological traits were assessed under normal and water stress conditions for 2 years. The mean values of grain yield (YLD) varied from 683.9 g/m 2 (water stress) to 992.1 g/m 2 (normal conditions). Grain yield decreased by 64 and 71% under water stress in the two growing seasons. High genotypic variation was found for measured traits and drought tolerance. Heritability ranged from 19 (harvest index) to 47% (spike length), whereas grain yield indicated a moderate heritability (32%). Using the assessment of the interrelationship of traits, hectoliter (a quality trait) was correlated with drought tolerance and stability indices. Therefore, it can be considered as an important trait to select drought tolerant genotypes. In the following, the priority of yield components entering the regression model was different in two moisture conditions suggesting different strategies in indirect selection programs to improve yield. Spike m -2 and grain spike -1 indirectly and negatively affected yield through thousand-grain weight (TGW) under normal and water stress conditions, respectively. Furthermore, SHW-DL compared to ordinary wheat were significantly superior in terms of early maturity, dwarfing, yield, TGW, stem diameter, and harvest index. Overall, our findings suggest that SHW-DL are a valuable source for improving wheat yield and drought tolerance, and indirect selection might be possible to improve these complex traits., (© 2022. The Author(s).)

Water availability influences all aspects of plant growth and development; however, most studies of plant responses to drought have focused on vegetative organs, notably roots and leaves. Far less is known about the molecular bases of drought acclimation responses in fruits, which are complex organs with distinct tissue types. To obtain a more comprehensive picture of the molecular mechanisms governing fruit development under drought, we profiled the transcriptomes of a spectrum of fruit tissues from tomato (Solanum lycopersicum), spanning early growth through ripening and collected from plants grown under varying intensities of water stress. In addition, we compared transcriptional changes in fruit with those in leaves to highlight different and conserved transcriptome signatures in vegetative and reproductive organs. We observed extensive and diverse genetic reprogramming in different fruit tissues and leaves, each associated with a unique response to drought acclimation. These included major transcriptional shifts in the placenta of growing fruit and in the seeds of ripe fruit related to cell growth and epigenetic regulation, respectively. Changes in metabolic and hormonal pathways, such as those related to starch, carotenoids, jasmonic acid, and ethylene metabolism, were associated with distinct fruit tissues and developmental stages. Gene coexpression network analysis provided further insights into the tissue-specific regulation of distinct responses to water stress. Our data highlight the spatiotemporal specificity of drought responses in tomato fruit and indicate known and unrevealed molecular regulatory mechanisms involved in drought acclimation, during both vegetative and reproductive stages of development., (© American Society of Plant Biologists 2022. All rights reserved. For permissions, please email: journals.permissions@oup.com.)

Isodon rubescens (Hemsley) H. Hara (Lamiaceae) is a traditional Chinese medicine plant that has been used to treat various human diseases. Oridonin is one of the main active ingredients, and the route of its molecular biosynthesis remains to be determined. The study of gene expression patterns can provide clues toward the understanding of its biological functions. The selection of suitable reference genes for normalizing target gene expression is the first steps in any quantitative real-time PCR (RT-qPCR) gene expression study. Therefore, validation of suitable reference genes is necessary for obtaining reliable results in RT-qPCR analyses of I. rubescens. Here, 12 candidate reference genes were chosen, and their expression stability in different tissues of I. rubescens and in leaves under different abiotic stresses (NaCl, dehydration, SA, MeJA, and ABA) was evaluated using the ∆Ct, NormFinder, GeNorm, BestKeeper, and RankAggreg statistical tools. Analysis using the comprehensive tools of RankAggreg algorithm showed that GADPH, 18S and eIF were stably expressed in different tissues; UBQ, Apt, and HIS; Cycl, UBQ, and PP2A; GADPH, 18S, and eIF; eIF, UBQ, and PP2A; TUB, Cycl, and UBQ; were the best three candidate reference genes for the samples of Dehydration, NaCl, SA, MeJA, and ABA treatment, respectively. While for the concatenated sets of ND (NaCl and dehydration) and SMA (SA, MeJA, and ABA), UBQ, HIS, and TUA; UBQ, eIF and Apt were the three appropriate candidate reference genes, respectively. In addition, the expression patterns of HMGR in different tissues and under different treatments were used to confirm the reliability of the selected reference genes, indicating that the use of an inappropriate reference gene as the internal control will cause results with a large deviation. This work is the first study on the expression stability of reference genes in I. rubescens and will be particularly useful for gene functional research in this species., (© 2022. The Author(s).)

Potato ( Solanum tuberosum L.) is one of the most important crops worldwide, but due to its sensitivity to drought, its production can be affected by water availability. In this study, the varieties Agria and Zorba were used to determine the expression differences between control and water-stressed plants. For this purpose, they were sequenced by RNAseq, obtaining around 50 million transcripts for each variety and treatment. When comparing the significant transcripts obtained from control and drought-stressed plants of the Agria variety, we detected 931 genes that were upregulated and 2077 genes that were downregulated under stress conditions. When both treatments were compared in Zorba plants, 735 genes were found to be upregulated and 923 genes were found to be downregulated. Significantly more DEGs were found in the Agria variety, indicating a good stress response of this variety. "Abscisic acid and environmental stress-inducible protein TAS14-like" was the most overexpressed gene under drought conditions in both varieties, but expression differences were also found in numerous transcription factors and heat shock proteins. The principal GO term found was "cellular components", more specifically related to the cell membrane and the cell wall, but other metabolic pathways such as carbohydrate metabolism and osmotic adjustment were also identified. These results provide valuable information related to the molecular mechanisms of tolerance to water stress in order to establish the basis for breeding new, more tolerant varieties.

The higher order structure of the metaphase chromosome has been an enigma for over a century and several different models have been presented based on results obtained by a variety of techniques. Some disagreements in the results between methods have possibly arisen from artifacts caused during sample preparation such as staining and dehydration. Therefore, we treated barley chromosomes with ionic liquid to minimize the effects of dehydration. We also observed chromosomes on a film with holes to keep pristine chromosome structure from being flattened as seen when placed on a continuous support film. A chromosome placed over a hole in a thin carbon film was mounted on a tomography holder, and its structure was observed in three dimensions (3D) using electron tomography. We found that there are periodic structures with 300-400 nm pitch along the axis in barley chromosomes. The pitch sizes are larger than those observed in human chromosomes., (Copyright © 2022. Published by Elsevier Ltd.)

Adapting to unfavorable environments is a necessary step in plant terrestrialization and radiation. The dehydration-responsive element-binding (DREB) protein subfamily plays a pivotal role in plant abiotic stress regulation. However, relationships between the origin and expansion of the DREB subfamily and adaptive evolution of land plants are still being elucidated. Here, we constructed the evolutionary history of the DREB subfamily by compiling APETALA2/ethylene-responsive element-binding protein superfamily genes from 169 representative species of green plants. Through extensive phylogenetic analyses and comparative genomic analysis, our results revealed that the DREB subfamily diverged from the ethylene-responsive factor (ERF) subfamily in the common ancestor of Zygnemophyceae and Embryophyta during the colonization of land by plants, followed by expansions to form three different ancient archetypal genes in Zygnemophyceae species, designated as groups archetype-I, archetype-II/III, and archetype-IV. Four large-scale expansions paralleling the evolution of land plants led to the nine-subgroup divergence of group archetype-II/III in angiosperms, and five whole-genome duplications during Brassicaceae and Poaceae radiation shaped the diversity of subgroup IIb-1. We identified a Poaceae-specific gene in subgroup IIb-1, ERF014, remaining in a Poaceae-specific microsynteny block and co-evolving with a small heat shock protein cluster. Expression analyses demonstrated that heat acclimation may have driven the neofunctionalization of ERF014s in Pooideae by engaging in the conserved heat-responsive module in Poaceae. This study provides insights into lineage-specific expansion and neofunctionalization in the DREB subfamily, together with evolutionary information valuable for future functional studies of plant stress biology., (© American Society of Plant Biologists 2022. All rights reserved. For permissions, please email: journals.permissions@oup.com.)

Calmodulin, a primary calcium sensor in eukaryotes, binds calcium and regulates the activity of effector proteins in response to calcium signals that evoked in response to abiotic and biotic stress. To identify physiological responses associated with improved tolerance under dehydration stress that may be regulated by calmodulin in rice, the transgenic rice overexpressing OsCaM1-1, the control, and the wild-type KDML105 differing in their dehydration tolerance were compared 24 h after exposure to dehydration stress. The results demonstrated a greater increase in relative water content, relative growth rate, abscisic acid, photosynthetic pigment and proline contents, and antioxidant activities in the transgenic rice plants, whereas Na/K and Na/Ca ratio, lipid peroxidation, and electrolytic leakage decreased. The OsCaM1-1 gene overexpression in the transgenic rice showed greater tolerance to dehydration stress than non-transgenic rice, suggesting that OsCaM1-1 might play an important role in mitigating dehydration stress., (© The Author(s) 2022. Published by Oxford University Press on behalf of Japan Society for Bioscience, Biotechnology, and Agrochemistry.)

Background: Low grain water content (GWC) at harvest of maize (Zea mays L.) is essential for mechanical harvesting, transportation and storage. Grain drying rate (GDR) is a key determinant of GWC. Many quantitative trait locus (QTLs) related to GDR and GWC have been reported, however, the confidence interval (CI) of these QTLs are too large and few QTLs has been fine-mapped or even been cloned. Meta-QTL (MQTL) analysis is an effective method to integrate QTLs information in independent populations, which helps to understand the genetic structure of quantitative traits., Results: In this study, MQTL analysis was performed using 282 QTLs from 25 experiments related GDR and GWC. Totally, 11 and 34 MQTLs were found to be associated with GDR and GWC, respectively. The average CI of GDR and GWC MQTLs was 24.44 and 22.13 cM which reduced the 57 and 65% compared to the average QTL interval for initial GDR and GWC QTL, respectively. Finally, 1494 and 5011 candidate genes related to GDR and GWC were identified in MQTL intervals, respectively. Among these genes, there are 48 genes related to hormone metabolism., Conclusions: Our studies combined traditional QTL analyses, genome-wide association study and RNA-seq to analysis major locus for regulating GWC in maize., (© 2022. The Author(s).)

This study sought to characterize the impact of long-term dehydration in terms of physiological and biochemical parameters, as well as renal transcriptomes. Furthermore, we assessed whether consumption of specific types of water elicit more beneficial effects on these health parameters. To this end, C57BL/6 mice were either provided water for 15 min/day over 2 and 4 weeks (water restricted; RES), or ad libitum access to distilled (CON), tap, spring, or purified water. Results show that water restriction decreases urine output and hematocrit levels while increasing brain vasopressin mRNA levels in RES mice compared to control mice (CON). Meanwhile, blood urea nitrogen and creatinine levels were higher in the RES group compared to the CON group. Kidney transcriptome analysis further identified kidney damage as the most significant biological process modulated by dehydration. Mechanistically, prolonged dehydration induces kidney damage by suppressing the NRF2-signaling pathway, which targets the cytoprotective defense system. However, type of drinking water does not appear to impact physiological or blood biochemical parameters, nor the renal transcriptome profile, suggesting that sufficient water consumption is critical, irrespective of the water type. Importantly, these findings also inform practical action for environmental sustainability by providing a theoretical basis for reducing bottled water consumption., (© 2022. The Author(s).)

Myrothamnus flabellifolia is the only woody resurrection plant found in the world. It has a strong tolerance to drought and can survive long-term exposure to desiccated environments. However, few genes related to its drought tolerance have been functionally characterized and the molecular mechanisms underlying the stress tolerance of M. flabellifolia are largely unknown. In this study, we isolated a dehydration-inducible bHLH transcription factor gene MfbHLH145 from M. flabellifolia . Heterologous expression of MfbHLH145 enhanced the drought and salt tolerance of Arabidopsis. It can not only promote root system development under short-term stresses, but also improve growth performance under long-term treatments. Further investigation showed that MfbHLH145 contributes to enhanced leaf water retention capacity through the promotion of stomatal closure, increased osmolyte accumulation, and decreased stress-induced oxidative damage through an increase in antioxidant enzyme activities. These results suggest that MfbHLH145 may be involved in the positive regulation of stress responses in M. flabellifolia . This study provides insight into the molecular mechanism underlying the survival of M. flabellifolia in extreme dehydration conditions.

Kodo millet (Paspalum scrobiculatum L.) is a small millet species known for its excellent nutritional and climate-resilient traits. To understand the genes and pathways underlying dehydration stress tolerance of kodo millet, the transcriptome of cultivar 'CO3' subjected to dehydration stress (0 h, 3 h, and 6 h) was sequenced. The study generated 239.1 million clean reads that identified 9201, 9814, and 2346 differentially expressed genes (DEGs) in 0 h vs. 3 h, 0 h vs. 6 h, and 3 h vs. 6 h libraries, respectively. The DEGs were found to be associated with vital molecular pathways, including hormone metabolism and signaling, antioxidant scavenging, photosynthesis, and cellular metabolism, and were validated using qRT-PCR. Also, a higher abundance of uncharacterized genes expressed during stress warrants further studies to characterize this class of genes to understand their role in dehydration stress response. Altogether, the study provides insights into the transcriptomic response of kodo millet during dehydration stress., (Copyright © 2022. Published by Elsevier Inc.)

Xenopus laevis, the African clawed frog, undergoes seasonal estivation to survive periods of drought when its lake-bed habitats dry up. The frog can lose ∼30% of its total body water, leading to conditions of impaired blood flow and ischemia which risk cellular survival under these harsh conditions. MicroRNAs are short, noncoding, single-stranded RNAs 21-24 nt long that have been widely implicated in hypometabolic responses, and serve functions including apoptosis survival. The levels of three pro-apoptotic and four anti-apoptotic miRNAs were measured in liver and skeletal muscle of estivating X. laevis, and bioinformatic analysis was performed to verify potential mRNA targets of these miRNAs. Members of pro-apoptotic miRNAs miR-15a, miR-16, and miR-101 showed upregulation as a result of dehydration stress, while anti-apoptotic miRNAs miR-19b, miR-21, miR-92a, and miR-155 showed differential regulation between the two tissues. Together, these miRNAs act in a more diverse fashion than arbitrarily pro- or anti-apoptotic, and encompass functions ranging from the inhibition of cell proliferation through cell cycle arrest to the prevention of skeletal muscle atrophy., (Copyright © 2022 Elsevier B.V. All rights reserved.)

'Sugars Will Eventually be Exported Transporters' (SWEETs) are a group of sugar transporters that play crucial roles in various biological processes, particularly plant stress responses. However, no information is available yet for the CaSWEET family in chickpea. Here, we identified all putative CaSWEET members in chickpea, and obtained their major characteristics, including physicochemical patterns, chromosomal distribution, subcellular localization, gene organization, conserved motifs and three-dimensional protein structures. Subsequently, we explored available transcriptome data to compare spatiotemporal transcript abundance of CaSWEET genes in various major organs. Finally, we studied the changes in their transcript levels in leaves and/or roots following dehydration and exogenous abscisic acid treatments using RT-qPCR to obtain valuable information underlying their potential roles in chickpea responses to water-stress conditions. Our results provide the first insights into the characteristics of the CaSWEET family members and a foundation for further functional characterizations of selected candidate genes for genetic engineering of chickpea., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Wood frogs are a few vertebrate species that can survive whole-body freezing. Multiple adaptations support this, including cryoprotectant production (glucose), metabolic rate depression, and selective changes in gene and protein expression to activate pro-survival pathways. The role of DNA methylation machinery (DNA methyltransferases, DNMTs) in regulating nuclear gene expression to support freezing survival has already been established. However, a comparable role for DNMTs in the mitochondria has not been explored in wood frogs. We examined the mitochondrial protein levels of DNMT-1, DNMT-3A, DNMT-3B, and DNMT-3L as well as mitochondrial DNMT activity in the liver and heart to assess the involvement of DNMT in the survival of freezing and dehydration stresses (cellular dehydration being a component of freezing). Our results showed stress- and tissue-specific responses to mitochondrial DNMT-1 in the liver and heart, respectively. During 24 h of freezing and whole-body dehydration, we observed an overall downregulation of mitochondrial DNMT-1, a major protein involved in maintaining methylation levels related to its role in the selective transcription of mitochondrial genes as well as antioxidant response. Tissue-specific responses of protein levels of DNMT-3A, DNMT-3B, DNMT-3L, and DNMT activity in the liver suggested a preference for a higher methylation state in the liver under both freezing and dehydration stress, but not in the heart.

Background: Sustainable production of high-quality feedstock has been of great interest in bioenergy research. Despite the economic importance, high temperatures and water deficit are limiting factors for the successful cultivation of switchgrass in semi-arid areas. There are limited reports on the molecular basis of combined abiotic stress tolerance in switchgrass, particularly the combination of drought and heat stress. We used transcriptomic approaches to elucidate the changes in the response of switchgrass to drought and high temperature simultaneously., Results: We conducted solely drought treatment in switchgrass plant Alamo AP13 by withholding water after 45 days of growing. For the combination of drought and heat effect, heat treatment (35 °C/25 °C day/night) was imposed after 72 h of the initiation of drought. Samples were collected at 0 h, 72 h, 96 h, 120 h, 144 h, and 168 h after treatment imposition, total RNA was extracted, and RNA-Seq conducted. Out of a total of 32,190 genes, we identified 3912, as drought (DT) responsive genes, 2339 and 4635 as, heat (HT) and drought and heat (DTHT) responsive genes, respectively. There were 209, 106, and 220 transcription factors (TFs) differentially expressed under DT, HT and DTHT respectively. Gene ontology annotation identified the metabolic process as the significant term enriched in DTHT genes. Other biological processes identified in DTHT responsive genes included: response to water, photosynthesis, oxidation-reduction processes, and response to stress. KEGG pathway enrichment analysis on DT and DTHT responsive genes revealed that TFs and genes controlling phenylpropanoid pathways were important for individual as well as combined stress response. For example, hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase (HCT) from the phenylpropanoid pathway was induced by single DT and combinations of DTHT stress., Conclusion: Through RNA-Seq analysis, we have identified unique and overlapping genes in response to DT and combined DTHT stress in switchgrass. The combination of DT and HT stress may affect the photosynthetic machinery and phenylpropanoid pathway of switchgrass which negatively impacts lignin synthesis and biomass production of switchgrass. The biological function of genes identified particularly in response to DTHT stress could further be confirmed by techniques such as single point mutation or RNAi., (© 2022. The Author(s).)

Background: Small interfering RNAs (siRNAs) target homologous genomic DNA sequences for cytosine methylation, known as RNA-directed DNA methylation (RdDM), plays an important role in transposon control and regulation of gene expression in plants. Repressor of silencing 1 (ROS1) can negatively regulate the RdDM pathway., Results: In this paper, we investigated the molecular mechanisms by which an upstream regulator ACD6 in the salicylic acid (SA) defense pathway, an ABA pathway-related gene ACO3, and GSTF14, an endogenous gene of the glutathione S-transferase superfamily, were induced by various abiotic stresses. The results demonstrated that abiotic stresses, including water deficit, cold, and salt stresses, induced demethylation of the repeats in the promoters of ACD6, ACO3, and GSTF14 and transcriptionally activated their expression. Furthermore, our results revealed that ROS1-mediated DNA demethylation plays an important role in the process of transcriptional activation of ACD6 and GSTF14 when Arabidopsis plants are subjected to cold stress., Conclusions: This study revealed that ROS1 plays an important role in the molecular mechanisms associated with genes involved in defense pathways in response to abiotic stresses., (© 2022. The Author(s).)