Search

Chemical dealloying is an emerging strategy that can be applied to synthesize porous materials. The structure morphologies of the active materials were precisely regulated by designing the various NaOH corrosion solutions. Three-dimensional micro–nanorods-like structure Ni75Cu25O bimetallic oxide with ultra-high electrochemical properties have been obtained, which used Al65Cu15Ni20 precursors through a dealumination strategy. Meanwhile, three-dimensional micro–nanorods-like structure Ni75Cu25O demonstrates an unusual extraordinary specific capacitance (16.96 F cm−2 at 10 mV s−1) and excellent cycling stability (100.8% retention after 5000 cycles at 10 mV s−1). Here, the transition bimetallic oxides by using the dealloying strategy can be applied to develop novel guidances and ideas for the generation of energy storage devices.

Transition metal phosphides (TMPs) are a hopeful noble-metal-free catalysts for water splitting. In this study, we used a three-dimensional nanostructure on nickel substrate to easily synthesize a nickel–cobalt phosphide electrocatalyst (NixCoyP, x = 1, 1.5, 2; y = 1, 1.5, 2) through hydrothermal reaction and in situ phosphorylation. The NiCo1.5 P exhibited relatively excellent oxygen evolution activity performance, and it only needed the overpotentials of 123 mV for HER in 1 M KOH to perform the current densities of 10 mA cm−2. It is worth mentioning that the Ni2CoP exhibited better bifunctional electrocatalyst characteristics. As to water splitting, the hydrogen evolution reaction (HER) and the oxygen evolution reaction (OER) require 197 and 253 mV overpotentials separately to provide a current density of 10 mA cm−2. Its relatively excellent electrochemical performance can be ascribed to the high-density sea urchin-like three-dimensional structure, which provides greater specific surface area and more active site. Besides, Ni2CoP also shows long-term durability lasting 80,000 s, and on this basis, there is no distinct deactivation. This work emphasizes that Ni2P and CoP play a vital role relative to the good activity of HER. Moreover, the unique morphology with self-supported structure provides a larger specific surface area, making it possible the exposure of higher amount of active sites for HER. These self-supported electrocatalysts that do not require a binder could also make the electrode more active and stable. This work, therefore, presents a strategy that is controllable and feasible strategy for the synthesis of bimetallic phosphides with unique morphology and high HER and OER activity.

Previous reports have confirmed that long non‐coding RNA SOX21‐AS1 could regulate the properties of breast cancer stem cells (BCSCs), although the underlying molecular mechanism is unclear. We verified that SOX21‐AS1 was highly expressed in breast cancer tissues and cell lines, especially in BCSCs. SOX21‐AS1 could promote the stemness viability, proliferation, migration and invasion of BCSCs by inhibiting the Hippo pathway., Breast cancer stem cells (BCSCs) have high tumorigenicity and invasiveness, which contributes to recurrence and metastasis. The long non‐coding RNA SOX21‐AS1 has been previously reported to modulate the properties of breast cancer stem cells via targeting SOX2, although the underlying molecular mechanisms remain unclear. To investigate this issue, we first confirmed that the expression level of SOX21‐AS1 is increased in breast cancer tissues and cell lines (MCF‐7, MDA‐MB‐231, CSC‐MCF‐7, CSC‐MDA‐MB‐231), especially in BCSCs. We demonstrated that SOX21‐AS1 promotes the stemness of CSC‐MCF‐7 cells through western blot detection of stemness‐related proteins, as well as side population and sphere formation assays. Overexpression of SOX21‐AS1 enhanced the proliferation, migration and invasion of CSC‐MCF‐7 cells. We also observed that SOX21‐AS1 inhibited the Hippo pathway. SOX21‐AS1 enhanced the stemness, migration and invasion of CSC‐MCF‐7 cells by increasing the nuclear localization of YAP and decreasing the level of pYAP. Overall, we conclude that SOX21‐AS1 may promote the stemness viability, proliferation, migration and invasion of BCSCs by inhibiting the Hippo pathway. Our findings provide insights into potential biomarkers and prognostic measures for the treatment of breast cancer.

Studies have shown that high-density lipoprotein (HDL) is a powerful anti-atherosclerosis factor in vivo and in vitro, with anti-inflammatory effects, and it also plays an important role in the immune system and central nervous system (CNS). In this study, the BV2 microglia inflammation model and experimental autoimmune encephalomyelitis animal model were used to investigate the potential mechanism of HDL in multiple sclerosis. Our results show that HDL inhibits the activation of BV2 microglia in a model of BV2 microglia inflammation and were validated with primary microglia. HDL can down-regulate the expression of TNF-α, IL-6, iNOS and NO. Western blot results showed that HDL could reduce the expression levels of TLR4, CD14, MyD88 and NF-κB p65 LPS-induced microglia. In a mouse model of experimental autoimmune encephalomyelitis, hematoxylin-eosin (HE) staining showed decreased infiltration of inflammatory cells in brain and spinal cord tissues, and Luxol Fast Blue (LFB) staining showed significant improvement in spinal cord demyelination. We found that HDL reduced spinal cord and brain inflammation after EAE induction, inhibited the infiltration of CD68 and Iba-1 positive inflammatory cells, and reduced the production of multiple pro-inflammatory cytokines, including pro-inflammatory cytokines TNF-α, IL-6, and IL-1β. Western blot showed that EAE mice HDL inhibited the activation of ERK1/2 and JNK in MAPK pathway and p-IκBα and P65 in NF-κB pathway. Taken together, our study suggests that HDL may influence microglia activation and inflammatory response in mice by regulating inflammatory signaling pathways, improving induction of experimental autoimmune encephalomyelitis, an animal model of multiple sclerosis, and provides further insights into HDL therapy for multiple sclerosis.

Solid-state Li-ion batteries (SSBs) are believed the new future of electrochemical energy storage, while the solid electrolyte membrane is the core part. The development of new electrolyte membrane with easy densification, high stability and high conductivity is crucial for the widespread application of SSBs. In this study, tuning the conductivity and sintering behavior of perovskite-type La2/3-xLi3xTiO3 (LLTO) membranes through a co-doping strategy was proposed and systematically investigated. Specifically, the membranes with the nominal compositions of Li0.33-y+xLa0.557-xMxTi1-yNyO3 (M = Sr, Ba, Ca, N = Ta) were designed and investigated. The results demonstrated that replacement of La3+ by smaller Ca2+ decreased the bulk Li+ conductivity while substitution of La3+ by Sr2+ or Ba2+ with larger ionic radii increased the bulk Li+ conductivity. Besides, Ta5+ and Sr2+ co-doped LLTO with optimized Ta/Sr molar ratio could improve the membrane densification involving the relative density and grain size. Accordingly, a high total Li+ conductivity (1.4 × 10−4 S cm−1) with low electronic conductivity (3.2 × 10−8 S cm−1) could be achieved, and the as-prepared Li0.33La0.457Sr0.1Ti0.9Ta0.1O3 membrane presented prominent electrochemical performance with a high capacity retention (89%) and Coulombic efficiency of 97% for 80 cycles, thus promised co-doping strategy for developing superior perovskite Li-ion conducting membranes for SSBs.

Objective To explore the pharmacodynamic (PD) characteristics of propofol during anesthetic recovery period with target-controlled infusion (TCI), and to identify the clinical variables related to the PD parameters. Materials and methods 20 patients scheduled for otolaryngology surgery were enrolled. After the surgery was finished, target effect site concentration was gradually decreased, blood samples were measured at 7 time points and the differences between the target and measured plasma concentration were compared. Observer's assessment of alertness/sedation (OAA/S) and Narcotrend index (NI) were used as two PD indicators by fitting sigmoid Emax model. Correlations between PD parameter and clinical variables were evaluated. Results Performance of the TCI system showed a positive bias at the end of the anesthesia sedation period and a negative bias in the anesthetic recovery period. PD parameters (EC50, r) calculated with OAA/S and NI were significantly different, EC50 of OAA/S was lower than EC50 of NI (1.53 ± 0.70 vs. 2.16 ± 0.99 µg/mL), r of OAA/S was higher than r of NI (57.07 ± 56.39 vs. 4.35 ± 4.42). Propofol dosage and hemodynamic parameters were significantly correlated with EC50 (OAA/S), lean body weight and gender were significantly correlated with EC50 (NI). Conclusion NI provided a more stable and adequate assessment of the depth of anesthesia than OAA/S, and the influence factors should be taken into account for precise dosing.

A highly efficient catalyst of a Co a Mn b O x mixed oxide prepared by the co-precipitation method was developed for the selective catalytic reduction (SCR) of NO x with ammonia. With an increase in the Mn content, the catalytic activity of the Co a Mn b O x mixed oxide exhibited a volcano-type tendency, and when Co/Mn molar ratio reached 7:3 (Co 7 Mn 3 O x ), the operation temperature for achieving >80% NO x conversion was 170 °C (116–285 °C window). The formation of spinel structured MnCo 2 O 4 is highly important, and the presence of the spinel structure in Co 7 Mn 3 O x contributes to the increase in active sites and thermal stability and promotes SO 2 and/or H 2 O resistance. In comparison with MnO x or CoO x alone, the Co a Mn b O x catalysts possess improved redox properties and more surface acid sites due to synergistic effects between the Co and Mn species. Among the Co a Mn b O x catalysts with different Co/Mn molar ratios, a higher NH 3 and NO + O 2 adsorption ability was found for the Co 7 Mn 3 O x catalyst, originating from its MnCo 2 O 4.5 phase and higher surface area, which leads to the higher activity of the Co 7 Mn 3 O x catalyst. In situ DRIFTs indicated that bridging nitrate and bidentate nitrate are the intermediate species in the NH 3 -SCR reaction, and the high NO adsorption ability and improved redox properties of the Co 7 Mn 3 O x catalyst are beneficial for the formation of nitrate species on the catalyst surface. Furthermore, NH 3 species adsorbed at Lewis acid sites taken part in SCR reaction, while the reactivity of NH 3 species adsorbed at Bronsted acid was not definitized.

BACKGROUND: Postoperative delirium (POD) is a common complication of major surgery and is associated with fortified morbidity, mortality, and long-term cognitive dysfunction. This study sought to evaluate the incidence and risk factors of delirium in elderly (aged ≥65 years) patients who underwent coronary artery bypass grafting (CABG). METHODS: We performed a retrospective cohort analysis. The clinical data of 1,426 elderly patients who underwent CABG at our hospital from October 2018 to October 2020 were collected and analyzed. Delirium was defined as any positive Confusion Assessment Method for Intensive Care Unit examination following surgery during the intensive care unit (ICU) stay. Risk factors for POD were authenticated via univariate and multivariate logistic regression analyses. The intraoperative and postoperative factors were evaluated using a propensity score-matched regression analysis based on preoperative factors. RESULTS: A total of 39.3% (560 of 1,426) of elderly patients who underwent CABG were diagnosed with delirium. Based on the multivariate analysis, age [odds ratio (OR) 1.013], long-term alcohol consumption (OR 2.026), diabetes (OR 1.51), stroke (OR 1.41), and extracardiac arteriopathy (OR 1.61) were found to be independent predictors of post-cardiac surgery delirium. Conversely, high-density lipoprotein cholesterol levels (HDL-C) ≥1.0 mmol/L (OR 0.71) was found to be a protective factor. Among the intraoperative and postoperative factors evaluated, only a prolonged ICU stay (≥48 h; OR 1.62) was identified as a risk factor for developing delirium in the propensity-score matched analysis, after adjusting for potential confounding variables and selection bias. In contrast to the earlier analysis, the multivariate logistic regression further revealed that peri-procedural myocardial infarction and postoperative arterial oxygen partial pressures were not significantly associated with POD. CONCLUSIONS: The incidence of POD in elderly patients undergoing CABG was high. Factors such as older age, long-term alcohol consumption, diabetes, stroke, and extracardiac arteriopathy were independent risk factors for POD in these patients. In relation to the intraoperative and postoperative factors, after adjusting for preoperative confounding factors, only a prolonged ICU stay was identified as a risk factor for POD. Additionally, high levels of HDL-C may be beneficial in reducing the incidence of delirium.

We describe a coinage-metal-catalyzed site-selective oxidation of secondary C(sp3)–H bonds for aliphatic amine substrates. Broad amine scope, good functional compatibility and late-stage diversification are demonstrated with this method. The steric demand of the β-substituents controlled diastereoselectivities under this catalytic system. The site selectivity favors secondary C(sp3)–H bonds over tertiary ones underscoring the unique synthetic potential of this method.

Recent studies have illuminated that blocking Ca2+ influx into effector cells is an attractive therapeutic strategy for lung injury. We hypothesize that T-type calcium channel may be a potential therapeutic target for acute lung injury (ALI). In this study, the pharmacological activity of mibefradil (a classical T-type calcium channel inhibitor) was assessed in a mouse model of lipopolysaccharide- (LPS-) induced ALI. In LPS challenged mice, mibefradil (20 and 40 mg/kg) dramatically decreased the total cell number, as well as the productions of TNF-α and IL-6 in bronchoalveolar lavage fluid (BALF). Mibefradil also suppressed total protein concentration in BALF, attenuated Evans blue extravasation, MPO activity, and NF-κB activation in lung tissue. Furthermore, flunarizine, a widely prescripted antimigraine agent with potent inhibition on T-type channel, was also found to protect mice against lung injury. These data demonstrated that T-type calcium channel inhibitors may be beneficial for treating acute lung injury. The important role of T-type calcium channel in the acute lung injury is encouraged to be further investigated.

Developing cost-effective and binder-free bifunctional electrocatalysts to boost the hydrogen and oxygen evolution reactions are crucial for overall water splitting. In this work, three-dimensional hierarchical Mn-Co-P/NF electrodes on nickel foam are synthesized by electrodeposition and chemical vapor deposition (CVD) firstly. Provide an excellent and controllable synthesis method by controlling the electrodeposition time and phosphating temperature. The Mn-Co-P composite exhibits the characteristics of vertically grown porous nanosheets, which can effectively expose the active sites. Benefit from the rational design with in-situ growth of functional materials and the unique structure, the Mn-Co-P/NF presents excellent electrocatalytic activities and stability with lower overpotentials of 63 mV and 310 mV to deliver 10 mA cm−2 for hydrogen evolution reaction (HER) and 10 mA cm−2 for oxygen evolution reaction (OER), respectively. Moreover, when directly used as a positive electrode and a negative electrode to form an electrocatalytic device to complete the overall water splitting, Mn-Co-P/NF merely requires a small cell voltage of 1.70 V to obtain 20 mA cm−2. This work offers a controllable method to design and synthesize highly efficient and stable transition metal phosphide catalysts for overall water splitting and other catalytic fields.

We report a copper-catalyzed remote C(sp3)–H bond amination reaction that converts acyclic amines to pyrrolidines. This reaction occurs selectively at the carbon δ to the amine functionality. Primary, secondary and tertiary C–H bonds are all suitable for the amination reactions in the presence of an inexpensive and commercially available copper catalyst.

For low temperature selective catalytic reduction (SCR) of NOx with ammonia, the highly effective Sm-Mn mixed oxide (Sm-Mn-O, the molar ratio Sm/Mn is 0.1) catalysts was developed. The effect of the calcination temperature on the structure, physicochemical and catalytic properties of the Sm-Mn-O catalysts was investigated in detail. The results showed that the Sm-Mn-O catalyst calcined at 450 °C exhibited the highest activity, and after been calcined at >550 °C its catalytic activity markedly decreased. With an increase in the calcination temperature, its surface area firstly increased and then decreased, and the poorly crystallized MnO 2 in Sm-Mn-O was transformed to highly crystalized Mn 2 O 3 phase. These changes influenced the adsorption ability of the Sm-Mn-O catalyst for NH 3 or NO + O 2 . After calcination at >550 °C, the contents of Mn 4+ and adsorbed oxygen (O S ) on the surface of Sm-Mn-O decreased obviously, resulting in the decrease in its catalytic properties for the NO oxidation and transformation of bridged nitrite to active intermediate of bidentate nitrate. Conversely, its catalytic activity for NH 3 oxidation was enhanced after being calcined at high temperature. These adverse factors cause the decrease in the SCR activities of Sm-Mn-O calcined at >550 °C.

Ceria nanocrystallites with different morphologies and crystal planes were hydrothermally prepared, and the effects of ceria supports on the physicochemical and catalytic properties of Pd/CeO2 for the CO and propane oxidation were examined. The results showed that the structure and chemical state of Pd on ceria were affected by ceria crystal planes. The Pd species on CeO2-R (rods) and CeO2-C (cubes) mainly formed PdxCe1–xO2−σ solid solution with −Pd2+–O2––Ce4+– linkage. In addition, the PdOx nanoparticles were dominated on the surface of Pd/CeO2-O (octahedrons). For the CO oxidation, the Pd/CeO2-R catalyst showed the highest catalytic activity among three catalysts, its reaction rate reached 2.07 × 10–4 mol gPd–1 s–1 at 50 °C, in which CeO2-R mainly exposed the (110) and (100) facets with low oxygen vacancy formation energy, strong reducibility, and high surface oxygen mobility. TOF of Pd/CeO2-R (3.78 × 10–2 s–1) was much higher than that of Pd/CeO2-C (6.40 × 10–3 s–1) and Pd/CeO2-O (1.24 × 10–3 s–1) at 5...

In recent years, the core-shell heterostructure has been considered as one of the most promising candidates for the next generation of electrode materials, which can not only shorten the ion diffusion distance, but also increase the contact area between the electrode and the electrolyte. Herein, two different morphologies of NiCo2O4 nanomaterials were prepared by hydrothermal-calcination method, and then the hybrid structure consisting of needle-like NiCo2O4 core and Ni-Co layered double hydroxide (Ni-Co LDH) shell is composited on carbon fiber cloth (CFC) by constant current electrodeposition as electrode materials. The resultant NiCo2O4@Ni-Co LDH core-shell hybrid arrays exhibits the specific capacitance of 4901.8 m F cm−2 at the current density of 2 mA cm−2, which is much higher than that of needle NiCo2O4 and flake Ni-Co LDH. At the same time, the obtained NiCo2O4@Ni-Co LDH as the positive electrode while the activated (AC) serves as the negative electrode, which is used to assemble the all-solid flexible asymmetric supercapacitor. It delivers an energy density of 0.859 mW h cm-3 at the power density of 2 mA cm−2, as well as an excellent cycling performance with capacitance retention of 92.3 % after 5000 cycles at 16 mA cm−2. These results suggest that this core-shell structured material could be a promising electrode for supercapacitors.

A coinage-metal-catalyzed site-selective trifluoroacetoxylation of remote secondary C(sp3)–H bonds for aliphatic amine substrates was developed., We describe a coinage-metal-catalyzed site-selective oxidation of secondary C(sp3)–H bonds for aliphatic amine substrates. Broad amine scope, good functional compatibility and late-stage diversification are demonstrated with this method. The steric demand of the β-substituents controlled diastereoselectivities under this catalytic system. The site selectivity favors secondary C(sp3)–H bonds over tertiary ones underscoring the unique synthetic potential of this method.

Sm-Mn mixed oxide catalysts prepared by the coprecipitation method were developed, and their catalytic activities were tested for the selective catalytic reduction (SCR) of NO with ammonia at low temperature. The results showed that the amount of Sm markedly influenced the activity of the MnOx catalyst for SCR, that the activity of the Sm-Mn mixed oxide catalyst exhibited a volcano-type tendency with an increase in the Sm content, and that the appropriate mole ratio of Sm to Mn in the catalyst was 0.1. In addition, the presence of Sm in the MnOx catalyst can obviously enhance both water and sulfur dioxide resistances. The effect of Sm on the physiochemical properties of the Sm-MnOx catalyst were investigated by XRD, low-temperature N2 adsorption, XPS, and FE-SEM techniques. The results showed that the presence of Sm in the Sm-MnOx catalyst can restrain the crystallization of MnOx and increase its surface area and the relative content of both Mn4+ and surface oxygen (OS) on the surface of the Sm-MnOx catal...

Cu/ZSM-5 and Ce doped Cu/ZSM-5 catalysts were prepared by the incipient-wetness-impregnation method, and the effect of Ce doping on the structure and the catalytic performance of the Cu/ZSM-5 catalyst was investigated in detail for the selective catalytic reduction (SCR) of NO with NH3. The results showed that the addition of Ce can markedly broaden the operation temperature window of the Cu/ZSM-5 catalyst for NH3-SCR and enhance its H2O and SO2 resistance. The presence of Ce promoted an enrichment of copper species (isolated Cu2+ ions and CuO nanoparticles) on the catalyst surface and the increase in the Lewis acid sites on the surface of the Cu/ZSM-5 catalyst, and strengthened the redox property of the Cu/ZSM-5 catalyst. As a result, Ce-doped Cu/ZSM-5 catalyst possessed the high adsorption ability of NH3 and nitrite/nitrate, which is propitious to the increase in the reactivity of the Ce-doped Cu/ZSM-5 catalyst. In situ DRIFTS results indicated that the NH3-SCR reaction on the Cu/ZSM-5 catalyst and Ce1–Cu4/ZSM-5 catalysts definitely followed Langmuir–Hinshelwood mechanisms, and bridged nitrates and bidentate nitrates were the active intermediate. However, Eley–Rideal mechanism can't be confirmed over the Cu/ZSM-5 and Ce1–Cu4/ZSM-5 catalysts.

Acute lung injury (ALI) is a life-threatening syndrome which causes a high mortality rate worldwide. In traditional medicine, lots of aromatic plants—such as some Thymus species—are used for treatment of various lung diseases including pertussis, bronchitis, and asthma. Thymol, one of the primary active constituent derived from Thymus vulgaris (thyme), has been reported to exhibit potent anti-microbial, anti-oxidant, and anti-inflammatory activities in vivo and in vitro. The present study aims to investigate the protective effects of thymol in lipopolysaccharide (LPS)-induced lung injury mice model. In LPS-challenged mice, treatment with thymol (100 mg/kg) before or after LPS challenge significantly improved pathological changes in lung tissues. Thymol also inhibited the LPS-induced inflammatory cells influx, TNF-α and IL-6 releases, and protein concentration in bronchoalveolar lavage fluid (BALF). Additionally, thymol markedly inhibited LPS-induced elevation of MDA and MPO levels, as well as reduction of SOD activity. Further study demonstrated that thymol effectively inhibited the NF-κB activation in the lung. Taken together, these results suggested that thymol might be useful in the therapy of acute lung injury.

We report a copper-catalyzed remote C(sp

The purpose of this study was to compare the pharmacokinetic profiles of tetramethylpyrazine phosphate (TMPP) in plasma and extracellular fluid of the cerebral cortex of rats via three delivery routes: intranasal (i.n.), intragastric (i.g.) and intravenous (i.v.) administration. After i.n., i.g. and i.v. administration of a single-dose at 10 mg/kg, cerebral cortex dialysates and plasma samples drawn from the carotid artery were collected at timed intervals. The concentration of TMPP in the samples was analyzed by HPLC. The area under the concentration–time curve (AUC) and the ratio of the AUCbrain to the AUCplasma (drug targeting efficiency, DTE) was calculated to evaluate the brain targeting efficiency of the drug via these different routes of administration. After i.n. administration, TMPP was rapidly absorbed to reach its peak plasma concentration within 5 min and showed a delayed uptake into cerebral cortex (tmax=15 min). The ratio of the AUCbrain dialysates value between i.n. route and i.v. injection was 0.68, which was greater than that obtained after i.g. administration (0.43). The systemic bioavailability obtained with i.n. administration was greater than that obtained by the i.g. route (86.33% vs. 50.39%), whereas the DTE of the nasal route was 78.89%, close to that of oral administration (85.69%). These results indicate that TMPP is rapidly absorbed from the nasal mucosa into the systemic circulation, and then crosses the blood–brain barrier (BBB) to reach the cerebral cortex. Intranasal administration of TMPP could be a promising alternative to intravenous and oral approaches., Graphical abstract Pharmacokinetic analysis of tetramethylpyrazine phosphate (TMPP) in plasma and extracellular fluid in cerebral cortex of rats after intranasal, intragastric and intravenous administration was carried out with microdialysis sampling and HPLC-UV analysis. The results indicated that TMPP was rapidly absorbed from the nasal mucosa into the systemic circulation and then across the blood–brain barrier to reach the cerebral cortex. Intranasal administration of TMPP may be a promising alternative to intravenous and oral approaches.

In the present study, we cloned, sequenced, and explored the structural and functional characteristics of the major histocompatibility complex (MHC)-DQA gene from mink (Neovison vison) for the first time. The full-length sequence of DQA gene was 1147-bp-long, contained a coding region of 768-bp, which was predicted to encoding 255 amino acid residues. The comparison between DQA from mink (Neovison vison) and other MHC-DQA molecules from different animal species showed that nucleotide and encoded amino acid sequences of the mink DQA gene exhibited high similarity with the ferret (Mustela pulourius furo). Phylogenetic analysis revealed that mink (Neovison vison) DQA is grouped with that of ferret (Mustela pulourius furo). The cloned sequence contained a 23-amino acid NH2-terminal signal sequence with the signal peptide cutting site located in amino acids 23⁻24, and had three Asn-Xaa-Ser/Thr sequons. Three cysteine residues were also identified (Cys-85, Cys-121, and Cys-138). The 218 to 240 amino acids were predicted to be the transmembrane domains. The prediction of the secondary structure revealed three α-helixes and fourteen β-sheets in Neovison vison DQA protein, while random coil was a major pattern. In this study, the whole CDS sequence of Neovison vison DQA gene was successfully cloned, which was valuable for exploring the function and antiviral molecular mechanisms underlying the molecule. The findings of the present study have laid the foundation for the disease resistance and breeding of mink.

Standardized myrtol, an essential oil containing primarily cineole, limonene and α-pinene, has been used for treating nasosinusitis, bronchitis and chronic obstructive pulmonary disease (COPD).To investigate the effects of standardized myrtol in a model of acute lung injury (ALI) induced by lipopolysaccharides (LPS).Male BALB/c mice were treated with standardized myrtol for 1.5 h prior to exposure of atomized LPS. Six hours after LPS challenge, lung injury was determined by the neutrophil recruitment, cytokine levels and total protein concentration in the bronchoalveolar lavage fluid (BALF) and myeloperoxidase (MPO) activity in the lung tissue. Additionally, pathological changes and NF-κB activation in the lung were examined by haematoxylin and eosin staining and western blot, respectively.In LPS-challenged mice, standardized myrtol at a dose of 1200 mg/kg significantly inhibited the neutrophile counts (from 820.97 ± 142.44 to 280.42 ± 65.45, 10Together, these data suggest that standardized myrtol has the potential to protect against LPS-induced airway inflammation in a model of ALI.

The aim of the study was to investigate the factors that promote the development of gout in Chinese patients with hyperuricemia. Chinese cohort with 659 patients with hyperuricemia who had no history of gout at base line had been followed up for 5 years. The baseline data of the general states (gender, age, occupation and education level), lifestyle and behavior (smoking, drinking, and diet), the major chronic diseases (diabetes and hypertension), family history and gout attacks, physical examination (height, weight and blood pressure), and blood parameters (creatinine, urea nitrogen, triglycerides, total cholesterol and high-density lipoprotein cholesterol) were recorded before the follow-up. Over the five-year period, 75 hyperuricemia patients developed gout. In the logistic regression model, shrimp intake and shell intake were the risk factors (P = 0.038 and P < 0.001, respectively) and, combined with diabetes, also served as risk factor for gout developed from hyperuricemia, with relative risk (RR) of 2.571 (95 % confidence interval (95 % CI), 1.110-5.953), and females served as protective factors of gout, with RR of 0.113 (95 % CI, 0.041-0.312, referred to male). We identified that shrimp intake and shell intake, combined with diabetes, were the independent risk factors, and females served as protective factors of gout in those suffering from hyperuricemia in coast regions of Shandong province, China.

Temperature cycling is an important reliability qualification test given the differences in thermal expansion coefficients for the materials in integrated circuit packages. In this work, leadfree Plastic-Ball-Grid-Array (PBGA) packages with embedded C1100 copper heatspreaders were exposed to standard qualification testing including MSL3 Moisture Preconditioning with leadfree reflows at 245C followed by Temperature Cycling (TC) with ranges of −55/+125C (TC-B) and 0/+125C (TC-K) per JEDEC JESD47. Electrical performance and package warpage were characterized on as-received, post-preconditioning, and post-TC devices. After 200 cycles TC-B, gross electrical open failures were found on a large percentage of devices in some package lots. Physical failure analysis of the open failures revealed severe package warpage, as high as 20mils on a 31mm package. The severe warpage was accompanied by delamination and sheared wires. In contrast other package lots did not show failures nor severe warpage ( Detailed commonality studies revealed that the copper heatspreader lot used was the only definitive difference between “good” and “warped” package lots. It was found that for “warped” lots exposure to the leadfree reflow at 245C caused a significant reduction in the micro-hardness of the copper heatspreader, while there was minimal change in micro-hardness after exposure to leadfree reflow in the “good” lots. The mechanism for this change is explained by the softening temperature of the C1100 copper heatspreader which is well within the range of leadfree reflows. Above this softening temperature, re-crystallization and grain growth occur, which result in susceptibility to permanent warpage induced by temperature cycling. Control of this warpage is critical to qualifying temperature cycling performance for heatspreader PBGA packages, and this can be achieved through micro-hardness screening of the heatspreaders.

The electrochemical behavior of ortho-phenylphenol (OPP) at a disposable electrode (an improved wax-impregnated graphite electrode) in the presence of sodium dodecyl sulfate (SDS) was studied for the first time. The results demonstrated that the electrocatalytic oxidation process of OPP was accompanied with two-charge-two-proton transference. The electronic transmission coefficient (α) and diffusion coefficient (DR) for OPP were calculated to be 0.8126 and 3.61 × 10−2 cm2/s, respectively. The electrochemical signal was apparently improved by SDS at the disposable electrode and the oxidative peaks current was proportional to the concentration of OPP over the range from 1.0 × 10−9 to 4.0 × 10−6 mol/L with the detection limit of 8.7 × 10−10 mol/L. This novel and highly sensitive method can be successfully applied to detect OPP in the orange rind sample.

Insulin resistant Otsuka-Long-Evans-Tokushima Fatty (OLETF) and its control Long-Evans Tokushima Ohtsuka (LETO) rats were used to generate a model for acute hyperuricemia. Upon the onset of insulin resistance OLETF rats were feed with high-purine diet, and the development of acute hyperuricemic renal injury and gouty-like lesions was monitored. Rosiglitazone was also administered to demonstrate whether improved insulin sensitivity would prevent high-purine diet induced renal injury and gouty-like lesions.Otsuka-Long-Evans-Tokushima Fatty rats showed significant higher incidence of hyperuricemia as compared to the control LETO rats (77 vs. 36.1%, P0.05), indicating that insulin resistance exacerbates the development of hyperuricemia following high-purine load. Consistent with this observation, improvement of insulin sensitivity by administration of rosiglitazone significantly reduced high-purine diet induced renal injury and gouty-like lesions. It was found that insulin resistance is associated with impaired capability for maintaining the homeostasis of renal uric acid excretion and reabsorption. Upon high-purine load, insulin resistance enhances urate reabsorption as manifested by up-regulated URAT1 expression and reduces urate excretion as characterized by down-regulated UAT expression.Our data demonstrated strong evidence indicating that insulin resistance acts as an independent risk factor predisposing OLETF rats more susceptible to the development of hyperuricemia and gouty arthritis following high-purine load.

Pharmacokinetic research in China on the use of voriconazole in critically ill adult patients with different pulmonary diseases remains to be explored. This study evaluated the population pharmacokinetics of the use of voriconazole (VRC) in critically ill patients to determine covariate effects on VRC pharmacokinetics by NONMEM, which could further optimize VRC dosing in this population. A one-compartment model with first-order absorption and elimination best fit the data, giving 4.28 L/h clearance and 93.4 L volume of distribution of VRC. The model variability, described as an approximate percentage coefficient of interindividual variability in clearance and volume of distribution, was 72.94% and 26.50%, respectively. A significant association between Cmin and drug response or grade 2 hepatotoxicity was observed (p=0.002

Objective. We suspect that genes or loci that contribute to coronary artery disease (CAD) may also play a role in the pathogenesis of gout, since hyperuricaemia leads to gout, and serum uric acid (SUA) levels are potential risk factors for CAD. The single nucleotide polymorphism (SNP) rs1333049 (C/G) on chromosome 9p21 has been implicated in previous studies to be associated with CAD. The aim of this study was to evaluate the relationship between this SNP and gout pathogenesis. Methods. Nine hundred Chinese Han were recruited for this study (461 gout patients and 439 gout-free individuals). The rs1333049 SNP and surrounding sequences were PCR sequenced. Results. There was a clear link between the rs1333049 genotypic and allelic frequencies between gout cases and controls (� 2 = 6.81, df = 2, P = 0.033 by genotype; � 2 = 6.63, df = 1, P = 0.01 by allele). There was a significantly increased risk of gout in carriers of the CC genotype (odds ratio = 1.43, 95% CI 1.07, 1.91). Conclusion. To the best of our knowledge, our findings are the first to establish an association of rs1333049 with gout in a Chinese Han population. Meanwhile, this SNP is homologous to miR-519 and miR-520.

Alzheimer’s disease (AD) and Parkinson’s disease (PD) have markedly different clinical and pathological features, but these two diseases are the most common neurodegenerative disorders. Previous studies have showed that there are common mechanisms in AD and PD. Several genetic studies have revealed mutations in genes associated with the risk of AD and PD. Circumstantial evidences have shown that dysregulation of brain iron homeostasis leads to abnormal iron accumulation and results in AD as well as PD.α-Synuclein and tau take part in the mechanisms of these diseases by oxidative stress and mitochondrial dysfunction. Some studies indicated that the loss of LC noradrenergic neurons may occur early in the progression of AD and PD. Nicotinic acetylcholine receptors (nAChRs) are members of the Cys-loop superfamily of pentameric ligand-gated ion channels; some evidence showed that nicotinic receptors may be associated with AD and PD. These experimental and clinical studies may provide a scientific foundation for common shared mechanisms in AD and PD.

A model for corrosion induced failure in wire bond devices made with either Cu or Au wire was developed. The model is based on detailed analysis of the chemical composition, crystallography, and micro structure of the corrosion induced failure sites. The detailed analysis was enabled by both a scanning electron microscope (SEM) and a transmission electron microscope (TEM) equipped with the appropriate analytical detectors. The combined characterization results were used to develop a detailed failure mechanism model which explains not only the overall chemical reactions but also the resultant two phase microstructures of the corrosion product observed in both metal systems. In addition the model helps to explain why Cu wire bonded devices are more susceptible to corrosion than Au wire bonded devices. In both systems corrosion occurs in the IMC not the end components pure metals. It is proposed this is due to the oxide on the surface of the IMCs being less resistant to pitting corrosion than that for Al. Once IMC passivity is broken down, corrosion of the IMC proceeds via selective oxidation of Al. This leads to the formation of a corroded region which is composed of a two phase microstructure, crystalline γ-Al2O3 with embedded crystalline Au and Cu metal particles. The resulting oxidized interface is highly susceptible to fracture, which is the ultimate reason for device failure. Although similar there are differences in the Cu/Al and Au/Al systems. There is a notable difference in the size and distribution of Cu particles in the aluminum oxide corrosion product of the Cu-Al system as compared to the Au particles in the aluminum oxide corrosion product of the Au-Al system. In particular, the Cu particles appear to be more uniformly distributed as compared to their Au counterparts. This difference is likely related to the crystal structure of the IMC from which the corrosion product was formed. It is proposed that this difference is related to the presence and probability of Al to Al bonding in the IMC phase/s. Furthermore, the IMC structures are also suspected to be responsible for the better immunity to contamination (specifically Halide) induced corrosion of Au relative to Cu.

Cu needs a higher level of ultrasound combined with bonding force to be bonded to the Al pad properly, not just because Cu is harder than Au, but it is also harder to initiate intermetallic compounds (IMC) formation during bonding. This increases the chances of damaging the metal/low k stack under the bondpad. This paper presents a fundamental study of IMC as well as one example of a failure mode of Cu/Al bonded devices, all based on detailed analysis using scanning electron microscopy, scanning transmission electron microscopy, energy dispersive spectrometers, and transmission electron microscopy. It presents a case study showing a corrosion mechanism of Cu/Al ballbond after 168hr UHAST stress. It is observed that all Cu9Al4 was consumed, while very little copper aluminide remained after 168 hours of UHAST stressing.

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38℃, either cough or sore throat, and no laboratory-confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 µL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC; and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-ID™ One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 µL containing 12.5 µL of 2×RT-PCR buffer, 1 µL of 2×RT-PCR enzyme, 1.67 µL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 µL of double distilled water (ddH2O), and 5 µL of template. Optimized amplification conditions were as follows: 1 cycle of 50℃ for 30 min, followed by 10 min at 95℃, and 45 cycles of 15 sec at 95℃ and 45 sec at 55℃. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance; they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in period 2, the pandemic H1N1 virus has the capacity to suppress seasonal influenza A virus by competitive circulation with multiple factors such as low preexisting immune capacity and stronger infectivity. Conversely, the seasonal peak time was recorded slightly later than the peak time of the previous period. In winter, period 1 and period 2 were the main peak time of seasonal influenza, while in spring it peaked during periods 3 and 4. There were significant differences in the positive rate of surveillance for the same seasonal influenza virus between the 4 detection periods (P

Pseudohypoparathyroidism type Ia (PHP Ia) is defined as a series of disorders characterized by multihormone resistance in end-organs and Albright hereditary osteodystrophy (AHO) phenotype. PHP Ia is caused by heterozygous inactivating mutations in GNAS, which encodes the stimulatory G-protein alpha subunit (Gsa). A patient with typical clinical manifestations of pseudohypoparathyroidism (PHP) (round face, short stature, centripetal obesity, brachydactyly, and multi-hormone resistance: parathyroid hormone (PTH), thyroid-stimulating hormone (TSH), and gonadotropins) presented at our center. The sequence of the GNAS gene from the patient and her families revealed a novel missense mutation (Y318H) in the proband and her mother. An in vitro Gsa functional study showed that Gsa function was significantly impaired. These results stress the importance of GNAS gene investigation.

Objective.The common polymorphism rs4994 [c. T387C, p. Trp64Arg (W64R)] of the lipolysis regulator beta-3-adrenergic receptor (ADRB3) was identified as a marker in the pathogenesis of hyperuricemia. As gout is characterized by elevated serum concentrations of uric acid, we investigated ADRB3 as a potential candidate for gout.Methods.This was a prospective case-control study in a group of 421 male patients with gout and 312 gout-free male controls to genotype the single-nucleotide polymorphism rs4994 of ADRB3 gene.Results.Our results showed that the C allele carrier confers a significantly higher risk for development of gout [chi-square = 4.91, df = 1, p = 0.027, OR 1.95 (adjusted by age, total cholesterol level, and body mass index), 95% CI 1.22–3.13 by dominant mode]. There was significantly higher uric acid level in carriers of the Arg64/Arg64 genotype in controls compared to non-carriers (480.5 mmol/l vs 315.0 mmol/l, respectively).Conclusion.ADRB3 rs4994 polymorphism is a potential candidate for the pathogenesis of gout in a male Chinese population.

This paper presents decapsulation solutions for devices bonded with Cu wire. By removing mold compound to a thin layer using a laser ablation tool, Cu wire bonded packages are decapsulated using wet chemical etching by controlling the etch time and temperature. Further, the paper investigates the possibilities of decapsulating Cu wire bonded devices using full wet chemical etches without the facilitation of laser ablation removing much of mold compound. Additional discussion on reliability concerns when evaluating Cu wirebond devices is addressed here. The lack of understanding of the reliability of Cu wire bonded packages creates a challenge to the FA engineer as they must develop techniques to help understanding the reliability issue associated with Cu wire bonding devices. More research and analysis are ongoing to develop appropriate analysis methods and techniques to support the Cu wire bonding device technology in the lab.

Gout is the most frequent inXammatory joint disease in men above 40 years of age (Luk and Simkin 2005). Recently, a genome-wide association study identiWed substantial associations between single nucleotide polymorphism (SNPs), rs2231142, in the ATP-binding cassette, sub-family G (WHITE), member 2 (ABCG2) and uric acid concentration and gout in both white and black individuals and may be a causal candidate variant (Dehghan et al. 2008). To clarify the global relevance of the variant rs2231142 (c. C421A), the association needs to be conWrmed by independent studies in diVerent ethnic groups. The objective of this study is to assess the genetic association of SNP in ABCG2 gene with gout in a Chinese Han male population. A total of 200 gout patients and 235 gout-free control were recruited in this study from Qingdao University. The diagnosis of gout was based on the preliminary criteria which was published by the American College of Rheumatology in 1977 for the classiWcation of gout for use in either clinical settings or population-based epidemiologic studies (Wallace et al. 1977). The rs2231142 and nearby regions were ampliWed by polymerase chain reaction (PCR) (PCR primers were shown on supplementary Table 1) and PCR product was sequenced by ABI 3730XL (Applied Biosystems, Foster City, CA) to perform mutational analysis. The associations between biochemical data and gout are listed in Table 1. There were signiWcant diVerence in rs2231142 genotypic and allelic frequencies between gout cases and controls (shown in Table 2). Compared with controls, there was a higher A/A genotype and A allele frequency of rs2231142 in the gout cases (21.8 vs. 8.4% by genotype; 44.9 vs. 32.3% by allele). And the association to gout reached signiWcance ( 2 = 15.91, P < 0.001, crude OR = 3.02, 95% CI 1.36–4.90 and OR (adjusted by age) = 1.80, 95% CI 1.32–2.45 by dominant mode; 2 = 6.82, P = 0.009, OR = 1.67 95% CI 1.54–2.27 by recessive mode). Compared with C/C genotype carriers, there was higher uric acid level in A allele carriers in the gout cases. However, the diVerence did not reach signiWcance (P = 0.066). Rs2231142, the missense SNP in ABCG2 (Q141 K) was associated with uric acid concentration and gout in both white and black individuals and may be a causal candidate variant also for Chinese Han people. The eVects of the polymorphism on the functions of ABCG2 in vitro have been revealed using transfectants that the individuals with the C/C genotype are presumed to have the highest transporter activity (Imai et al. 2002; Kondo et al. 2004; Mizuarai et al. 2004; Woodward et al. 2009). C421A also aVects the B. Wang and Z. Miao contributed equally to the work.

A comparative study is made for black carbon aerosol (BC) in this text based on BC and PM 10 observations as well as their air pollution indices during January-December 2006 in Beijing and Lhasa regions. BC concentration is considerably higher in Beijing than in Lhasa because of anthropogenic activities, with an annual mean of 9.3 μg/m 3 versus 3 μg/m 3 from the standard channel of 880 nm (below is the same). It is higher in winter and lower in summer for both of the regions, with the value in a heating season being more than twice as high as in non-heating season in Beijing area. The highest monthly means of 16.8 μg/m3 vs 5.5 μg/m 3 occur in January in Beijing and Lhasa regions, respectively; whereas the lowest values of 4.5 μg/m 3 vs 2.2 μg/m 3 are in July. The daily higher values of BC in Beijing start from 1600 BST (Beijing standard time) and maintain until 0700 BST of the next day, with keeping lower values during other daytime hours, especially around the noon. The daily maximum and minimum values of 30 μg/m 3 and 1.4 μg/m 3 happens in December and April in Beijing in 2006, respectively. Generally, BC emissions in Lhasa are much smaller than in Beijing, with relative high values observed in the morning and afternoon; the 2006 daily maximum and minimum of 12.4 μg/m 3 and 0.8 μg/m 3 appear in the December and the March, respectively. The BC in Lhasa mainly comes from the local emission from vehicles to the atmosphere.