Search

The article gives a revision on the species group Dyspessa salicicola (Eversmann, 1848) (Lepidoptera, Cossidae, Cossinae). The group comprises six valid taxa, namely D. salicicola salicicola, D. salicicola aschabadensis Daniel, 1953, D. saissanica Yakovlev, 2014, D. kostjuki Yakovlev, 2005, D. arabesca Yakovlev, 2005 and D. muelleri Yakovlev, sp. nov. (type locality: “Nord Jordanien, Totes Meer-Ostufer, Wadi Ibn Hammad”), united by a specific habitus (the yellow forewing with a remarkable pattern of spots). Detailed data on the distribution of all the species are provided, short diagnoses are given. The article is illustrated with images of specimens from different localities and male genitalia of all the considered taxa.

Dyspessa elbursensis Daniel, 1964 Dyspessa elbursensis Daniel, 1964a, Mitt. M��nch. Ent. Ges. 54: 209. LT: S. v. Chalus [Mazandaran prov., N. Iran]. Type material (holotype) in NMW. Distribution. Iran (Daniel 1964a, 1965b)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 20, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1964 a) Monographie der palaearctishen Cossidae. VII. Genus Dyspessa Hbn. Zweiter Teil, Genus Paropta Stgr. Mitteilungen der Munchner Entomologischen Gesellschaft, 54, 181 - 236.","Daniel, F. (1965 b) Osterreichische Entomologische Iran-Afganistan-Expeditionen. Beitrage zur Lepidopterenfauna, Teil 4. Weitere Beitrage zur Bombyces et Sphinges Fauna. Zeitschrift der Wiener Entomologischen Gesellschaft, 50, 121 - 145."]}

Dyspessa hethitica Daniel, 1932 Dyspessa hethitica Daniel, 1932a, Mitt. M��nch. Ent. Ges. 22: 16. LT: Marash [Turkey]. Type material (holotype) in MWM. Material examined. NHRS: Sine-Sefid, 2200 m, 1937. Distribution. S Turkey, Iran (Daniel 1932a; Wiltshire 1957). Distribution in Iran. Fars Prov.: Sineh Sefid (Fig. 25D)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 20, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1932 a) Neue Schmetterlingsformen und - Arten aus Marasch in Norsyrien. Mitteilungen der Munchner Entomologischen Gesellschaft, 22, 15 - 16.","Wiltshire, E. P. (1957) The Lepidoptera of Iraq. N. Kaye, London, 162 pp., 17 pls."]}

Dyspessa derbenti Daniel, 1964, stat. n. (Fig. 6B) Dyspessa elbursensis derbenti Daniel, 1964a, Mitt. M��nch. Ent. Ges. 54: 210. LT: Derbent, 25 km N Tehera n [Iran]. Type material (holotype) in NMW. Material examined. NMW: Holotype (♂), allotype (♀) and paratypes (8 ♂♂, 2 ♀♀), Iran, Derbent (= Darband), 2000 m, 25 km N. Teheran (= Tehr��n), 2000 m, 7.���15.vi.[19]63, leg. Kasy & Vartian. Diagnosis. Dyspessa elbursensis derbenti Daniel, 1964 is very light colored (including hind wing), with light streaks in the discal area of the forewing. Furtheremore, its forewing has a relatively sharp angle (Fig. 6B). However, D. elbursensis is well distinguished by a dark pattern of the wings, a blunt shorter forewing, and the dark gray hind wing (Fig. 6C). Based on the direct examination of the type specimens and the above mentioned differences, D. elbursensis derbenti Daniel, 1964 is here raised to the species level. Distribution. Iran (Daniel 1964a, 1965b). Distribution in Iran. N Tehran (Daniel 1964a) (Fig. 25B)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 19, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1964 a) Monographie der palaearctishen Cossidae. VII. Genus Dyspessa Hbn. Zweiter Teil, Genus Paropta Stgr. Mitteilungen der Munchner Entomologischen Gesellschaft, 54, 181 - 236.","Daniel, F. (1965 b) Osterreichische Entomologische Iran-Afganistan-Expeditionen. Beitrage zur Lepidopterenfauna, Teil 4. Weitere Beitrage zur Bombyces et Sphinges Fauna. Zeitschrift der Wiener Entomologischen Gesellschaft, 50, 121 - 145."]}

Dyspessa stroehlei Yakovlev, 2008 (Fig. 6F) Dyspessa stroehlei Yakovlev, 2008b, Eversmannia 15/16: 62. LT: Kars [Nordost-Turkei]. Type material (holotype) in MSW. Material examined. HMIM: West ��zarb��ij��n Prov.: 1 ♂, Orumiyeh, 24.vii.1976, no collector given. Distribution. Turkey: Kars (Yakovlev 2008b). Distribution in Iran. NW Iran (Fig. 26C). Remarks. This species is newly reported for the fauna of Iran., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 24, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Yakovlev, R. V. (2008 b) New species of Palaearctic and Oriental Cossidae (Lepidoptera). IV. New taxa of the genus Dyspessa Hubner, [1820] from Mediterranean-Iranian region (Lepidoptera: Cossidae). Eversmannia, 15 / 16, 53 - 68. [in Russian]"]}

Dyspessa serica Brandt, 1938 (Fig. 6E) Dyspessa serica Brandt, 1938, Ent. Rundsch. 58: 699. LT: Fort Sine-Sefid [Fars, Strasse Chiraz-Kazeroun, Iran]. Type material (holotype) in NHRS. Material examined. HMIM: F��rs Prov.: 1 ♀, ��b��deh, Shurjest��n, 2000 m, 30.iv.1985, leg. Mirz��y��ns, H��shemi; Khuzest��n Prov.: 5 ♂♂, Izeh, ��zhgil, 950 m, 26.iv.1995, leg. Parchami-Ar��ghi, Ardeh, Badii (gen. prep. No. HA-1910, HMIM), 1 ♂, Izeh, Susan, 600 m, 26.iv.1995, leg. Badii, Ardeh, Parchami-Ar��ghi (gen. prep. No. HA-2013, HMIM); Kohgiluyeh and Boyerahmad Prov.: 1 ♀, Y��suj, Sisakht, N 30˚53��46˝, E 51˚25��10˝, 2430 m, 22.vi.2005, leg. Zahiri, Montreuil, 2 ♀♀, K��k��n, Hoseinkh��ni, 2100 m, 26.���27.v.1995, leg. Badii, Sarafr��zi, H��shemi. NHRS: 1 ♂ (holotype) and 1 ♀ (paratype), Fars, Strasse Chiraz-Kazeroun (= Shir��z- K��zerun Rd.), Fort Sine Sefid, 2200 m, 2.v.1937, leg. Brandt. MWM: 1 ♀, Fars, Strasse Chiraz (= Shiraz)- Kazeroun, Fort Sine Sefid, 2200 m, 2.v.1937, leg. Brandt; 21 ♂♂, 1 ♀, Fars, 12 km S Kazan, 2545 m, 1.v.2000, leg. Szabo & Hentschel; 1 ♂, Fars, 30 km N Persepolis, 1.v.1975, leg. W. Thomas; 14 ♂♂, prov. Fars, 12 km S Kazan, 2545 m, 1.v.2000, leg. Szabo & Hentschel; 7 ♂♂, prov. Azerbayejan-E-Sharqi (= East ��zarb��ij��n), 10 km NW Miyane (= Mi��neh), 14.vi.2005, leg. Gyulai & Garal; 4 ♂♂, prov. Boyerahmad-va-Kohgiluyeh (= Kohgiluyeh and Boyerahmad), SE Zagros, 3000 m, Kuh e Dena, n. Bijan pass, 6 km N Cisakht (= Sisakht), 5.vi.2005, leg. Gyulai & Garal; 1 ♂, Ilam prov., 75 km E Ilam, 6.v.2002, leg. Gyulai & Garal; 8 ♂♂, Esfahan prov., C Zagros, 2600 m, 2 km NE Semirom, 9.v.2002. leg. Gyulai & Garal. Distribution. Iran (Daniel 1961). Distribution in Iran. NW, W, SW, and S Iran (Fig. 26B). Comment. In the distribution map (Fig. 26B), the following locality, ��� Fars, 12 km S Kazan��� has not been included. Kazan might be the misspelling of Kazerun, but because of uncertainty, it was excluded., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 24, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Brandt, W. (1938) Beitrag zur Lepidopteren-fauna von Iran. Entomologische Rundschau, 55, 698 - 699.","Daniel, F. (1961) Die Bombyces und Sphinges einer Lepidopteren-Ausbeute aus dem Iran. Stuttgarter Beitrage zur Naturkunde, 53, 1 - 5."]}

Dyspessa albosignata Rothschild, 1912 (Fig. 5B) Dyspessa clathrata albosignata Rothschild, 1912, in: Seitz, Gross-Schmett. Erde 2 (1): 451. LT: Imam-baba, Transkaspia [Turkmenistan]. Type material (holotype) in BMNH. Material examined. HMIM: North Khor��s��n Prov.: 1 ♂, Khosrawiyeh, ��l��d��gh, 1600 m, 16.vi.1974, leg. Rajabi, P��zuki, 2 ♂♂, Golest��n National Park, Sulgerd, 1150 m, 8.v.1999, leg. Moghaddam, Bar��ri, Manzari (gen. prep. No. HA-1909, HMIM); Tehr��n Prov.: 1 ♂ 1 ♀, T��r Lake, 2700 m, 24.viii.1992, leg. Ebr��himi, Badii. MWM: 2 ♂♂, NO Persien, Khorassan (= Khor��s��n), Abassabad (= Abb��s ��b��d) NP, 1200 m, 12.v.?, leg. de Freina. Distribution. Turkmenistan, NE Iran (Yakovlev 2011a). Distribution in Iran. N and NE Iran (Fig. 24B). Habitat. Deserts., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on pages 16-17, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Rothschild, W. (1912) Errata and Addenda to the Cossidae. In: Seitz, A. (Ed.), Die Gross-Schmetterlinge der Erde. Band 2. Abteilung 1. Die Palaearktischen Spinner & Schwarmer. Alfred Kernen. Stuttgart, pp. 450 - 452.","Yakovlev, R. V. (2011 a) Catalogue of the Family Cossidae of the Old World. Neue Entomologische Nachrichten, 66, 1 - 129."]}

Dyspessa ulula kasrii Daniel, 1964 (Fig. 8B) Dyspessa ulula kasrii Daniel, 1964a, Mitt. M��nch. Ent. Ges. 54: 196. LT: Berge ostlich von Kasri Schirin [SW Iran]. Type material (holotype) in NMW. Material examined. HMIM: F��rs Prov.: 1 ♀, K��zerun, G��wkoshak, 1150 m, 18.v.1975, leg. P��zuki, Borumand; Kerm��nsh��h Prov.: 10 ♀♀, SE Sar-e Pol-e Zah��b, Sag��n, Nav�� Mt., N 34˚14��12.7˝, E 46˚7��44˝, 1270 m, 26.v.2007, leg. Zahiri, 1 ♀, 5 km S Rij��b, N 34˚27��9.9˝, E 46˚00��51.4˝, 1300 m, 24.v.2007, leg. Zahiri; North Khor��s��n Prov.: 1 ♂, Golest��n National Park, ��lmeh, 1650 m, 17.���25.v.1988, leg. P��zuki (gen. prep. No. HA-1918, HMIM); West ��zarb��ij��n Prov.: 1 ♀, Orumiyeh, Gh��semlu, 10.vi.1975, leg. Ab��i. MWM: 2 ♂♂, paratypes: SW Iran, Berge O. v. Kasri Sohirin (German translation of Mt. at the E Ghasr-e Shirin), 24.v.1963, leg. Kasy & Vartian; 3 ♂♂, Prov. Buyer Ahmad (= Kohgiluyeh and Boyerahmad Province), 3 km N Sisaht (= Sisakht), 2700 m, N 51˚32��, E 31˚09��, 10.���12.v.1998, leg. Fabian & Szekely. RYB: 1 ♂, 3 ♀♀, C. Horasan (= Khor��s��n), 15 km SW Khezry Dasht-e-Bayaz, 1800 m, 8.vi.2011, leg. K. Kolesnichenko; 21 ♂♂, Horasan (= Khor��s��n), Khezri, 30.v.2009, leg. K. Kolesnichenko. Distribution. Iran (Daniel 1964a, 1965b). Distribution in Iran. E, W, NE, and SW Iran (Fig. 26E)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on pages 26-27, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1964 a) Monographie der palaearctishen Cossidae. VII. Genus Dyspessa Hbn. Zweiter Teil, Genus Paropta Stgr. Mitteilungen der Munchner Entomologischen Gesellschaft, 54, 181 - 236.","Daniel, F. (1965 b) Osterreichische Entomologische Iran-Afganistan-Expeditionen. Beitrage zur Lepidopterenfauna, Teil 4. Weitere Beitrage zur Bombyces et Sphinges Fauna. Zeitschrift der Wiener Entomologischen Gesellschaft, 50, 121 - 145."]}

Dyspessa wiltshirei Daniel, 1938 (Fig. 8D) Dyspessa wiltshirei Daniel, 1938, Mitt. M��nch. Ent. Ges. 28: 4. LT: Irac, Qaraghan [Iraq]. Type material (holotype) in ZSM. Material examined. HMIM: Alborz Prov: 4 ♀♀, Karaj, Kandov��n, Sarch��l, 2800 m, 4.���8.vii.1977, leg. P��zuki, Mortazavih�� (gen. prep. Nos. HA-2097, HA-2106, HMIM); 5 ♀♀, Karaj, ��z��dbar, 2400 m, 7.���9.v.1995, leg. Sarafr��zi, Badii, Linnavori (gen. prep. No. HA-2108, HMIM); Ch��h��rmah��l and Bakhti��ri Prov.: 1 ♀, Gandom��n, Sabzeh Kuh, Anchuchak, 2500 m, 15.vii.1982, leg. Borumand, P��zuki, 2 ♂♂ 6 ♀♀, Gandom��n, Sabzeh Kuh, 2500 m, 4.���5.vi.1989, leg. Mirz��y��ns, Badii (gen. prep. Nos. HA-2098, HA-2110, HMIM), 1 ♀, Zardkuh, 10 km S Dehno, 2450 m, 9.vii.1982, leg. Borumand, P��zuki; Esfah��n Prov.: 1 ♂ 1 ♀, Kh��ns��r, Golest��n Kuh, 2700 m, 3, 4.vii.1983, leg. Mirz��y��ns, Borumand; F��rs Prov.: 2 ♀♀, Sepid��n, M��rgoon fall, 2020 m, 23.���25.vi.1993, leg. Mirz��y��ns, Badii; Kerm��nsh��h Prov.: 1 ♂, 5 km S Rij��b, N 34˚27��9.9˝, E 46˚00��51.4˝, 1300 m, 24.v.2007, leg. Zahiri; 5 ♀♀, SE Sar-e Pol-e Zah��b, Sag��n, Nav�� Mt., N 34˚14��12.7˝, E 46˚7��44˝, 1270 m, 26.v.2007, leg. Zahiri (gen. prep. No. HA-2112, HMIM); Khuzest��n Prov.: 1 ♀, Izeh, 28 km N B��gh Malek, 800 m, 26.v.1973, leg. Ir��nshahr; Kohgiluyeh and Boyerahmad Prov.: 1 ♂ 1 ♀, 15 km SE Y��suj, 2050 m, 15.vi.1972, leg. Ebert, P��zuki, 1 ♂ 3 ♀♀, Y��suj, Tang-e Sorkh, 12.���13.vi.1986, leg. Mirz��y��ns, H��shemi (gen. prep. No. HA-2104, HMIM), 1 ♂, Meymand Mt. pass, 2450���2800 m, 14, 15.vi.2001, leg. Hofmann, Meineke, Tremewan, 1 ♀, Sisakht, Kh��ridun, N 30˚54��44.07˝, E 51˚24��47.16˝, 1644 m, 9.vii.2011, leg. Falsafi, Sarafr��zi; Kordest��n Prov.: 1 ♂ 1 ♀, 83 km SE B��neh, 1750 m, 5.���6.vii.1975, leg. P��zuki (gen. prep. No. HA-2103, HMIM); Lorest��n Prov.: 1 ♀, Oshtor��nkuh, N Kamand��n, 2040 m, 22.���24.vii.1981, leg. P��zuki, Borumand; Markazi Prov.: 1 ♀, Ar��k, Sh��zand, 1950 m, 21.vii.1981, leg. P��zuki, Borumand, 1 ♀, Salafcheg��n, Garnek��n, 1570 m, 14.v.1994, leg. Sarafr��zi, H��shemi, 2 ♂♂, Khomein, N��zi vill., N 33˚41��50˝, E 50˚02��17.7˝, 1872 m, 7.vi.2013, leg. Afsari��n; North Khor��s��n Prov.: 10 ♂♂ 1 ♀, 42 km W ��shkh��neh, 7 km W Mehm��nak vill., N 37˚29��36.5˝, E 56˚52��27.6˝, 1040 m, 17.vi.2013, leg. ��lipan��h, Falsafi (gen. prep. Nos. HA-2006, HA-2007, HA-2008, HMIM); Zanj��n Prov.: 1 ♀, Taham, T��zehkand, N 36˚55��25.4˝, E 48˚42��51.4˝, 1433 m, 29.vii.2013, leg. Afsari��n. Distribution. Iraq, Lebanon, Iran (Wiltshire 1957; Saldaitis et al. 2007; Yakovlev & Alipanah 2017). Distribution in Iran. N, NE, W, SW, and Central Iran (Fig. 27A)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on pages 27-29, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1938) Neuheiten aus Vorderasien. Mitteilungen der Munchner Entomologischen Gesellschaft, 28, 2 - 6.","Wiltshire, E. P. (1957) The Lepidoptera of Iraq. N. Kaye, London, 162 pp., 17 pls.","Saldaitis, A. & Yakovlev, R. V. & Ivinskis, P. (2007) Carpenter moths (Insecta: Lepidoptera, Cossidae) of Lebanon. Acta Zoologica Lituanica, 17 (3), 191 - 197. https: // doi. org / 10.1080 / 13921657.2007.10512831","Yakovlev, R. V. & Alipanah, H. (2017) Description of the male genitalia of Dyspessa wiltshirei Daniel, 1938 (Lepidoptera, Cossidae) based on the type specimens. Ukrainian Journal of Ecology, 7 (3), 108 - 110. https: // doi. org / 10.15421 / 2017 _ 55"]}

Dyspessa elbursensis elbursensis Daniel, 1964 (Fig. 6C) Material examined. HMIM: Ch��h��rmah��l and Bakhti��ri Prov.: 1 ♂, Gandom��n, Sabzeh Kuh, 2450 m, 11.��� 14.vii.1983, leg. Mirz��y��ns, Borumand; F��rs Prov.: 2 ♀♀, K��zerun, Mi��n Kotal, 1900 m, 11.vi.1972, leg. Ebert, P��zuki (gen. prep. No. HA-2114, HMIM), 1 ♂, K��zerun, Dasht-e Arzhan, 27.v.1977, leg. Ab��i, 1 ♂, Nur ��b��d, Mamasani, Ch��h Chen��r, 26.v.1976, leg. Ab��i, 2 ♀♀, Nur ��b��d, Mamasani, Ch��h Chen��r, 14.v.1976, 3.���19.v.1976, leg. Ab��i, 8 ♂♂ 2♀♀, K��zerun, Nowd��n, 1250 m, 17.v.1975, leg. Ab��i, P��zuki, 1♂, K��zerun, Nowd��n, 1250 m, 15.iv.1975, leg. Borumand (gen. prep. No. HA-1906, HMIM), 4 ♂♂, Kuhmareh, G��wkoshak, 16.iv.1975, leg. Borumand, 8 ♂♂, Shir��z, Kh��nezeni��n, 2000 m, 18.v.1974, leg. Ab��i, P��zuki (gen. prep. No. HA-1908, HMIM), 1 ♀, Shir��z, Sivand, 28.v.1976, leg. Ab��i; Kerm��n Prov.: 1 ♂, Jiroft- B��ft (55 km after Jiroft), Shinger��, 2800 m, 24.v.2004, leg. Raj��ei (gen. prep. No. HA-1914, HMIM); Kerm��nsh��h Prov.: 1 ♂, Rav��nsar, 20.vi.1975, leg. Ab��i; Khuzest��n Prov.: 1 ♂, Bidruyeh, 40 km N Andimeshk, 350 m, 3.v.1976, leg. P��zuki, Ab��i, 1 ♂, Alb��ji, 30 km N Ahw��z, 1.v.1976, leg. P��zuki, Ab��i; Lorest��n Prov.: 1 ♂, Mal��vi, Pol-e Dokhtar, 14.v. 1975, 730 m, leg. P��zuki, Borumand, 2 ♂♂, Tang-e Mal��vi, 720 m, 5.v.1976, leg. P��zuki, 5 ♂♂ 1 ♀, Pol-e Dokhtar, 10 km W B��b��zeyd, 880 m, 9.iv.1977, leg. P��zuki, H��shemi (gen. prep. No. HA-2115, HMIM), 1 ♂, Oshtor��nkuh, Narmi��n, 2400 m, 4.���5.viii.1975, leg. P��zuki. MWM: Paratypes: 2 ♂♂, 1 ♀♀, Elburs, Tacht i Suleiman, Vandarban Tal (= Takht-e Soleym��n, Vand��rbon valley), 19��� 2200 m, 1.���3.vii.1936, leg. Pfeiffer, 4 ♂♂, N Iran, S v. Chalus, 2000 m, 31.v.1963, leg. Kasy & Vartian; 4 ♂♂, 1♀, Iran mer., Kasrun, Kunar Takteh (an erroneous spelling of K��zerun, Ken��r Takhteh), 240 m, ende iii.1938, leg. Brandt. RYB: 1 ♂, Mazandaran prov., Alburz Mts., Azad Kuh Mt., near Minak (= Min��k), Laavash (= L��vash) Pass, 3000 m, 11.vii.2009; 3 ♂♂, Esfahan prov., Zagros Mts., Fereydun Sahr, 27.vi.2005, leg. Hacz, Juhasz, Petranyi. Distribution. Iran (Daniel 1964a, 1965b). Distribution in Iran. N, W, S, and SW Iran (Fig. 25C). Remarks. Considering the new status of D. elbursensis derbenti as one of the previously subspecies of D. elbursensis (see above), the latter species becomes monotypic., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 20, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1964 a) Monographie der palaearctishen Cossidae. VII. Genus Dyspessa Hbn. Zweiter Teil, Genus Paropta Stgr. Mitteilungen der Munchner Entomologischen Gesellschaft, 54, 181 - 236.","Daniel, F. (1965 b) Osterreichische Entomologische Iran-Afganistan-Expeditionen. Beitrage zur Lepidopterenfauna, Teil 4. Weitere Beitrage zur Bombyces et Sphinges Fauna. Zeitschrift der Wiener Entomologischen Gesellschaft, 50, 121 - 145."]}

Dyspessa wagneri Schwingenschuss, 1939 (Fig. 8C) Dyspessa wagneri Schwingenschuss, 1939b, Ent. Zschr. 53 (15): 127. LT: Tarseegebiet (Nordiran) [Elburs, Demavend, Tar lake, Iran]. Type material (holotype) in NMW. Material examined. HMIM: Alborz Prov.: 3 ♂♂, Karaj, Kandov��n, Sarch��l, 2800 m, 4.���8.vii.1977, leg. P��zuki, Mortazavih��; Esfah��n Prov.: 10 ♂♂, Kh��ns��r, Golest��n Kuh, 2700 m, 28, 29.vii.1981, leg. P��zuki, Borumand, 15 ♂♂, Golest��n Kuh, 2750 m, 5.���6.vii.1982, leg. Borumand, P��zuki, 8 ♂♂ 5 ♀♀, Golest��n Kuh, 2700 m, 3, 4.vii.1983, leg. Mirz��y��ns, Borumand, 2 ♂♂, Semirom, Pashmeh Kuh, 2750 m, 18.vi.2001, leg. Hofmann, Meineke, Tremewan, 15 ♂♂ 1 ♀, W Semirom, Pashmeh Kuh valley, 2800 m, 31.v.���2.vi.2004, leg. Hofmann, Meineke, Tremewan, 4 ♂♂, W Semirom, Pashmeh Kuh, 2800 m, 2.���3.vi.2005, leg. Hofmann, Meineke, 2 ♂♂, Fereydun Shahr, 2200 m, 9.vii.1999, leg. Hofmann, Meineke; Kerm��n Prov.: 1 ♂, B��ft, Ghan��t-e Marv��n, 2800 m, 23.v.1977, leg. Safavi, P��zuki, Ab��i; Kordest��n Prov.: 3 ♂♂, 23 km NE B��neh, Saghez- B��neh Rd., 1750 m, 2.vii.1975, leg. P��zuki (gen. prep. No. HA-1723, HMIM), 1 ♂ 1 ♀, 45 km SW Saghez, Saghez- B��neh Rd., 2000 m, 30.vi.1975, leg. P��zuki; North Khor��s��n Prov.: 4 ♂♂, Golest��n National Park, ��lmeh, 1600 m, 26.���29.v.1986, leg. P��zuki, 38 ♂♂, Golest��n National Park, ��lmeh, 1650 m, 17.���25.viii.1988, leg. P��zuki, 1 ♂, Golest��n National Park, ��lmeh, 1650 m, 2.���12.x.1988, leg. P��zuki, 1 ♂, Golest��n National Park, ��lmeh, 1590 m, 6.v.1999, leg. Mofidi-Neyest��nak, Bar��ri, Manzari; Zanj��n Prov.: 1 ♂, Zanj��n, Ghar��vol D��gh, 2500 m, 3, 4.vii.1999, leg. Hofmann, Meineke. MWM: 8 ♂♂, Prov. Mazandaran, Alborz, 3150 m, 12.���13.vi.2005, leg. Gyulai & Caral; 2 ♂♂, Kerman-Qanat Marvan (= Ghan��t-e Marv��n), 24.v.1977, leg. Sojak, ex coll. Kru��ek. Distribution. Ukraine (Crimea), Turkey, Iran (Yakovlev 2005). Distribution in Iran. N, NE, S, W, and Central Iran (Fig. 26F)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 27, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Schwingenschuss, L. A (1939 b) Beitrag zur Lepidopterenfauna von Iran (Persien). Entomologische Zeitschrift, 53 (15), 125 - 128.","Yakovlev, R. V. (2005) New records of distribution and systematic of Cossidae (Lepidoptera) of Europe and adjacent territories. Eversmannia, 3 - 4, 18 - 27."]}

Dyspessa tsvetaevi Yakovlev, 2008 (Fig. 8A) Dyspessa tsvetaevi Yakovlev, 2008b, Eversmannia 15/16: 61. LT: Shaqlawa, Kurdistan [Iraq]. Type material (holotype) in BMNH. Material examined. HMIM: Kerm��nsh��h Prov.: 1 ♂, Esl��m��b��d-e Gharb- Kerend Rd., G��livand vill., N 34˚13��1.4˝, E 46˚32��5.1˝, 1740 m, 22.v.2007, leg. Zahiri, Montreuil, N��serz��deh; Lorest��n Prov.: 2 ♂♂, Tang-e Mal��vi, 720 m, 5.v.1976, leg. P��zuki. Distribution. Iraq (Yakovlev 2008b). Distribution in Iran. W Iran (Fig. 26D). Remarks. This species is newly reported for the fauna of Iran., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 26, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Yakovlev, R. V. (2008 b) New species of Palaearctic and Oriental Cossidae (Lepidoptera). IV. New taxa of the genus Dyspessa Hubner, [1820] from Mediterranean-Iranian region (Lepidoptera: Cossidae). Eversmannia, 15 / 16, 53 - 68. [in Russian]"]}

Dyspessa ariadne Yakovlev, 2008 (Fig. 5E) Dyspessa ariadne Yakovlev, 2008b, Eversmannia 15/16: 58. LT: Prov. West Azerbaidzan, 5 km E H��y [Iran]. Type material (holotype) in MWM. Material examined. HMIM: Lorest��n Prov.: 1 ♂, Oshtor��nkuh, Parcheh Kabud, 2800 m, 1.���2.viii.1975, leg. P��zuki. MWM: 1 ♂ (holotype), Iran, prov. West Azerbaidzan (��zarb��ij��n), 5 km E H��y (= Khoy), 1020 m, 26.iv.2000, leg. Szabo & Hentschel, paratypes: 34 ♂♂, 4 ♀♀, same data; 4 ♂♂, prov. West Azerbaidzan (��zarb��ij��n), Mt. Sand (an erroneous spelling of Sahand Mt. which is located in the East ��zarb��ij��n Province), 1800 m, 16.v.1999, leg. K. Gasko. Distribution. NW (Yakovlev 2008b) and W Iran (Fig. 24E). Distribution in Iran. East and West Azarbaijan, and Lorestan Provinces., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 17, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Yakovlev, R. V. (2008 b) New species of Palaearctic and Oriental Cossidae (Lepidoptera). IV. New taxa of the genus Dyspessa Hubner, [1820] from Mediterranean-Iranian region (Lepidoptera: Cossidae). Eversmannia, 15 / 16, 53 - 68. [in Russian]"]}

Dyspessa salicicola aschabadensis Daniel, 1953 (Figs. 7A, F) Dyspessa salicicola aschabadensis Daniel, 1953, Mitt. M��nch. Ent. Ges. 43: 260. LT: Asia centr., Aschabad [Turkmenistan]. Type material (holotype) in ZSM. Material examined. HMIM: Alborz Prov.: 1 ♂, 6 km E ��zadbar- T��legh��n Rd., 2350 m, 21.vii.1988, leg. Mirz��y��ns, Badii; Ardebil Prov.: 1 ♂, Ardebil, Namin, 1860 m, 20.vi.2002, leg. H��jiesmaili��n, Mofidi-Neyest��nak, Deuve, Montreuil, 1 ♂, Neur Lake, 2500 m, 26.viii.2010, leg. Kh��ni, Mofidi-Neyest��nak, 1 ♂, Hashtchin- Khalkh��l Rd., N 37˚26��54.5˝, E 48˚24��50.6˝, 837 m, 16.vii.2013, leg. Afsari��n, Sarafr��zi; East ��zarb��ij��n Prov.: 1 ♂, Kaleybar, Ghaleh B��bak, 1500 m, 5.vii.1997, leg. Mofidi-Neyest��nak, Bar��ri; Gil��n Prov.: 1 ♂, Eshkevar, Gil��nch��k��n, 1820 m, 27.vi.1997, leg. Bar��ri, Mofidi-Neyest��nak, 1 ♂, Rudb��r, Darreh Dasht, 900 m, 25.vi.2002, leg. H��jiesmaili��n, Serri, Mofidi-Neyest��nak, Deuve, Monteuil; Golest��n Prov.: 2 ♂♂, 2 ♂♂, Golest��n National Park, Dasht, 960 m, 18.vi.1977, leg. P��zuki, Ab��i, Golest��n National Park, Ghush Cheshmeh, 1000 m, 29.vi.2001, leg. Ebr��himi, Osten, Mofidi-Neyest��nak, 2 ♂♂, Golest��n National Park, Koylar, 1250 m, 23.vii.1996, leg. Ebr��himi, V. Nazari, 1 ♂, Golest��n National Park, Koylar, 1350 m, 29.vii.2001, leg. Gil��si��n, Moghaddam, Ghayurfar, 2♂♂ 1♀, Golest��n National Park, Maz��rli, 350 m, 19.���20.vi.1977, leg. P��zuki, Ab��i, 5 ♂♂ 1 ♀, Golest��n National Park, Tang-e Gol, 620 m, 23.���25.v.1986, leg. P��zuki, 1 ♂, Golest��n National Park, Tang-e Gol, 700 m, 24.���27.vii.1996, leg. Ebr��himi, V. Nazari, 1 ♀, Golest��n National Park, Tang-e R��h, 930 m, 7.v.2000, leg. Badii, Ebr��himi, Mofidi-Neyest��nak, 1 ♂, Kh��nbebin, Shir ��b��d, 80 m, 5.vii.2001, leg. Mofidi-Neyest��nak, Osten, Ebr��himi, 2 ♂♂, ��gh Ghal��, Chinsivly, 0 m, 2.vii.2001, leg. Ebr��himi, Osten, Mofidi-Neyest��nak, 3 ♂♂, Gorg��n, Loveh forest, 10.viii.1967, leg. Ab��i, 4 ♂♂, Tuskast��n, Gorg��n- Sh��hrud Rd., N 36˚44��37.6˝, E 54˚34��02.6˝, 660 m, 15.vii.2007, leg. Zahiri, Karimz��deh; Khuzest��n Prov.: 1 ♂, Izeh, Susan, 600 m, 26.iv.1995, leg. Badii, Ardeh, Parchami-Ar��ghi (gen. prep. No. HA-2386, HMIM); F��rs Prov.: 1 ♂, Firuz ��b��d, Ghir, 11.iv.1975, 1160 m, leg. Borumand; North Khor��s��n Prov.: 14 ♂♂, Golest��n National Park, ��lmeh, 1600 m, 26.���29.v.1986, leg. P��zuki, 8 ♂♂, Golest��n National Park, ��lmeh, 1650 m, 17.���25.v.1988, leg. P��zuki, 3 ♂♂, Golest��n National Park, ��lmeh, 1590 m, 6.v.1999, leg. Mofidi-Neyest��nak, Bar��ri, Manzari, 16 ♂♂, Golest��n National P��rk, Sulgerd, 1150 m, 8.v.1999, leg. Moghaddam, Bar��ri, Manzari (gen. prep. No. HA-1926, HMIM), 2 ♂♂ 1 ♀, Y��khti Kal��n, 2.vi.1986, leg. P��zuki; M��zandar��n Prov.: 1 ♂, Marzan ��b��d, 400 m, 6.vii.1995, leg. Badii, Sarafr��zi, Linnavori, 1 ♂, Si��hbisheh, 10.vi.1974, leg. Ab��i, 1 ♂, Behshahr, Pasand, Pasand Res. Sta., 5.vi.1981, 6.vii.1981, no collector given; West ��zarb��ij��n Prov.: 1 ♂, M��ku, ��v��jigh, B��shkand, 1400 m, 16.vi.1976, leg. P��zuki, Borumand; Zanj��n Prov.: 1 ♂, Elburz Mt., Ghar��vol D��gh, 2500 m, 3, 4.vii.1999, leg. Hofmann, Meineke, 2 ♂♂, Zanj��n- Gilv��n Rd., Ghar��vol D��gh, 2500 m, 9, 26, 27.vi.2001, leg. Hofmann, Meineke, Tremewan, 1 ♂, Armagh��n Kh��neh, M��ri vill., N 36˚59��52.0˝, E 48˚28��39.0˝, 2300 m, 21.vi.2015, leg. N��serz��deh, H��jiesmaili��n, Montreuil. MWM: 2 ♂♂, Iran, Zanjan, Kuh-e-Sindan (= Sand��n Mt.), 25 km NE Zanjan, 2200 m, 15.vii.1997, leg. Eckweiler & Ten Hagen; 7 ♂♂, NO Persien, Khorassan (= Khor��s��n), Abassabad (= Abb��s ��b��d) NP, 1200 m, 12.v.?, leg. de Freina; Mazandaran, Mt. Sah (= Sh��hkuh), Azedsahr (= ��z��d Shahr which is located in Golest��n Province) distr., 1000 m, 2.vi.1999, leg. Gasko; Mazandaran prov., 35 km S Amol, 700 m, 14.v.1998, leg. Fabian & Szekely; 2 ♂♂, 15 km S of Azad Shar (= ��z��d Shahr), 28���29.vi.2000, leg. K. Gasko; 2 ♂♂, Azarbaigan-e, Sarked (an erroneous spelling of Sharghi = East Azarb��ij��n), Dizaj, 15.vi.2000, leg. K. Gasko. RYB: 1 ♂, road Tehran-Chalus, Marzanabad area, 2 km SE Tovir v., 900 m, 23.vi.2010, N 36˚22��26˝; E 51˚17��23˝, leg. K. Kolesnichenko; 2 ♂♂, Golestan, 20 km S Gorgant (= Gorg��n), 900 m, 2.vi.2009, leg. K. Kolesnichenko. Distribution. Daghestan, Turkmenistan, N Iran (Christoph 1876, 1884, 1893). Distribution in Iran. N, NW, NE, S and SW Iran (Fig. 26A)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on pages 23-24, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Daniel, F. (1953) Neue Heterocera-Arten und Formen. Mitteilungen der Munchner Entomologischen Gesellschaft, 43, 252 - 261.","Christoph, H. (1876) Sammelergebnisse aus Nordpersien, Krasnowodsk in Turkmenien und dem Daghestan. Horae Societatis Entomologique Rossicae, 12, 206.","Christoph, H. (1884) Lepidoptera aus dem Achal-Tekke-Gebiete 1. In: Romanoff, N. M. (Ed.), Memoires sur les Lepidopteres, St. - Petersbourg, 1, pp. 93 - 138.","Christoph, H. (1893) Lepidoptera Nova Faunae Palaearcticae. Deutsche Entomologische Zeitschrift Iris, 6, 86 - 96."]}

Dyspessa pallidata Staudinger, 1892 (Fig. 6D) Endagria ulula ab. pallidata Staudinger, 1892, Dtsch. Entomol. Z. Iris 5: 284. As ssp. pallidata Wagner, 1929, Mitt. M��nch. Ent. Ges. 19: 196. TL: Amasia: �� Hadjin, Marasch und Kara Hissar �� [Turkey]. Type material (syntypes) in MHUB. Material examined. HMIM: Alborz Prov.: 1 ♂ 2 ♀♀, T��legh��n, 26.���31.vii.1976, leg. K��vi��n, 1 ♂, Karaj, 30.iv.1974, no collector given; Ch��h��rmah��l and Bakhti��ri Prov.: 1 ♂ 1 ♀, Zardkuh, 10 km S Dehno, 2450 m, 9.vii.1982, leg. Borumand, P��zuki, 9 ♂♂ 1 ♀, Zardkuh, 2300 m, 7.���8.vii.1982, leg. Borumand, P��zuki (gen. prep. No. HA-1903, HMIM), 1 ♂, CW Sur��b, Ghaleh Sorkh, 2800 m, 20.vi.2001, leg. Hofmann, Meineke, Tremewan, 1 ♂, S Gandom��n, Gerdbisheh, 2000 m, 12, 13.vi.2002, leg. Hofmann, Meineke, Kallies, 1 ♂, Kuhrang, Hyreg��n, N 32˚20��31˝, E 50˚26��56˝, 2305 m, 6.vi.2005, leg. Ebr��himi, H��jiesmaili��n; East ��zarb��ij��n Prov.: 11 ♂♂ 1 ♀, Tabriz, Gharah Chaman, 1100 m, 23.vi.1985, leg. Mirz��y��ns, P��zuki (gen. prep. No. HA-1901, HMIM), 3 ♂♂ 2 ♀♀, Bost��n ��b��d, Chini Bol��gh, 2300 m, 25.vi.1985, leg. Mirz��y��ns, P��zuki; Esfah��n Prov.: 2 ♂♂, K��sh��n, Ghohrud, N 33˚39��40.2˝, E 51˚25��15.7˝, 2380 m, 3.vi.2005, leg. H��jiesmaili��n, Ebr��himi (gen. prep. No. HA-1904, HMIM), 1 ♂ 1 ♀, Ni��sar, N 33˚58��10˝, E 51˚07��28˝, 1800 m, 1.vi.2005, leg. Ebr��himi, H��jiesmaili��n, Hes��mi, 1 ♂, Fereydun Shahr, 2200 m, 9.vii.1999, leg. Hofmann, Meineke, 1 ♂, Fereydun Shahr, S Kamar��n Mt. pass, 2900���3200 m, 16, 17.vi.2002, leg. Hofmann, Meineke, Kallies, 1 ♂, 8 km NE An��rak, N 33˚22��43.5˝, E 53˚43��13.5˝, 1560 m, 31.v.2005, leg. Fibiger, Zahiri; F��rs Prov.: 1 ♀, Firuz ��b��d, Ghir, 1160 m, 11.iv.1975, leg. Borumand, 3 ♂♂, Firuz ��b��d, Mehkuyeh, Eshkaft Barm, 1750 m, 21.���22.vi.1993, leg. Mirz��y��ns, Badii (gen. prep. No. HA-1902, HMIM), 1 ♂ 1 ♀, K��zerun, Dasht-e Arzhan, 1950 m, 13.v.1974, leg. Ab��i, P��zuki, 2 ♂♂, K��zerun, Dasht-e Arzhan, 27.v.1977, leg. Ab��i, 3 ♀♀, K��zerun, Far��shband, Sarmashhad, N 29˚17��30.75˝, E 51˚42��27.04˝, 1780 m, 9.iv.1975, leg. Borumand, 1 ♂, Far��shband, Har��t ��b��d, 770 m, 7.v.1985, leg. Mirz��y��ns, H��shemi, 2 ♀♀, Nur ��b��d, Mamasani, Ch��h Chen��r, 25.v.1976, leg. Ab��i, 1 ♂, Nur ��b��d, Mamasani, Ch��h Chen��r, 3.���19.vii.1976, leg. Ab��i, 1 ♂, Shir��z, Kh��nezeni��n, 2000 m, 18.v.1974, leg. Ab��i, P��zuki; Hamed��n Prov.: 2 ♂♂, L��lejin, Soleym��n ��b��d, 1730 m, 13, 14.viii.2007, leg. Ebr��himi, Gil��si��n, Nemati��n; Hormozg��n Prov.: 1 ♂ 1 ♀, Bandar Abb��s- Sirj��n (km 40), 300 m, 30.iii.1973, leg. Ab��i (gen. prep. No. HA-1912, HMIM); Kerm��nsh��h Prov.: 1 ♀, Rav��nsar, 20.vi.1975, leg. Ab��i; Kohgiluyeh and Boyerahmad Prov.: 1 ♂ 1 ♀, K��k��n, Hoseinkh��ni, 2100 m, 26.���27.v.1995, leg. Badii, Sarafr��zi, H��shemi; Kordest��n Prov.: 16 ♂♂ 3 ♀♀, 45 km SW Saghez, Saghez- B��neh Rd., 2000 m, 30.vi.1975, 1.vii.1975, leg. P��zuki (gen. prep. No. HA-1900, HMIM), 5 ♂♂, 23 km NE B��neh, Saghez- B��neh Rd., 1750 m, 2.vii.1975, leg. P��zuki, 3 ♂♂, 83 km SE B��neh, 1750 m, 5.���6.vii.1975, leg. P��zuki; Lorest��n Prov.: 1 ♂, Pol-e Dokhtar, Sh��h ��b��d, 820 m, 4.v.1976, leg. P��zuki, Borumand; Tehr��n Prov.: 8 ♂♂, Kahrizak, Gheysar ��b��d, 1000 m, 22.���23.v.1993, leg. Parchami-Ar��ghi, Badii (gen. prep. No. HA-1905, HMIM); West ��zarb��ij��n Prov.: 1 ♂ 2 ♀♀, Khoy, 1000 m, 7.vi.1975, leg. Ab��i, 2 ♂♂, Sardasht, 14.vi.1975, leg. Ab��i, 1 ♂, Orumiyeh, 3.x.1973, no collector given, 1 ♂, Orumiyeh, 3.viii.1969, no collector given, 1 ♀, Orumiyeh,?. v.1970, leg. Jav��n-Moghaddam, 18 ♂♂ 4 ♀♀, Orumiyeh, 7 km Silv��n��, Kuhe, 1660 m, 22.vii.1976, leg. P��zuki, Borumand, 1 ♂, Orumiyeh, 1410 m, 11.vi.1975, leg. Ab��i, 1 ♂, Orumiyeh, Gh��semlu, 10.vi.1975, leg. Ab��i, 1 ♂, 15 km NE M��ku, 6.vi.1975, leg. Ab��i, 7 ♂♂, Tak��b, Takht-e Soleym��n, N 36˚35��40˝, E 47˚19��43.5˝, 2528 m, 1.vii.2013, leg. Afsari��n; Zanj��n Prov.: 1 ♂, Zanj��n- Gilv��n Rd., Ghar��vol D��gh, 2500 m, 26, 27.vi.2001, leg. Hofmann, Meineke, Tremewan. NHRS: Tohoureum (= Cherom); Sine-Sefid. MWM: 2 ♀♀, Lorestan Prov., 10 km SE Dorud, 1700���1800 m, 1.vi.2001, leg. de Freina; 14 ♂♂, Fars, 115 km W Shiraz, 9.v.1975, leg. W. Thomas. Distribution. Transcaucasia, Caucasus, Turkey, Armenia, Georgia, Azerbaijan, Iran, Lebanon, Jordan, Israel,?N Afghanistan, N Egypt (Staudinger & Rebel 1901; Ellison & Wiltshire 1939; Daniel 1939, 1961, 1971; Schwingenschuss 1938; Yakovlev 2005, 2010, Didmanidze & Yakovlev 2007; Saldaitis et al. 2007). Distribution in Iran. Mid-West of Iran (Fig. 25F)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 21, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Staudinger, O. (1892) Lepidopteres aus Tunis. Deutsche Entomologische Zeitschrift Iris, 5, 283 - 284.","Wagner, F. (1929) Weiterer Beitrag zur Lepidopteren-Fauna Inner-Anatoliens. Mitteilungen der Munchner Entomologischen Gesellschaft, 19 (1, 2 - 4 & 10 - 12), 1 - 28 + pl. 1, 57 - 80, 175 - 206 + pl. 2 (Ersatztafel).","Staudinger, O. & Rebel, H. (1901) In: Staudinger, O. & Rebel, H. (Eds.), Catalog der Lepidopteren des Palaearktischen Faunengebietes I. Theil: Famili. Papilionidae - Hepialidae. Third edition. R. Friedlanger und Sohn, Berlin, pp. 1 - 411","Ellison, R. E. & Wiltshire, E. P. (1939) The Lepidoptera of the Lebanon with notes on their season and distribution. Transactions of the Royal Entomological Society of London, 88, 1 - 56. https: // doi. org / 10.1111 / j. 1365 - 2311.1939. tb 01020. x","Daniel, F. (1939) Zygaenidae-Hepialidae. In: Osthelder, L. & Pfeiffer, E. (Eds.), Lepidopteren-Fauna von Marasch in turkisch Nordsyrien (Sphingidae: pp. 94 - 95). Mitteilungen der Munchner Entomologischen Gesellschaft, 29, 84 - 103.","Daniel, F. (1961) Die Bombyces und Sphinges einer Lepidopteren-Ausbeute aus dem Iran. Stuttgarter Beitrage zur Naturkunde, 53, 1 - 5.","Daniel, F. (1971) Osterreichishe Expeditionen nach Persien und Afghanistan Beitrage zur Lepidopterenfauna, Teil 16. Annalen des Naturhistorischen Museums in Wien, 75, 651 - 660.","Yakovlev, R. V. (2005) New records of distribution and systematic of Cossidae (Lepidoptera) of Europe and adjacent territories. Eversmannia, 3 - 4, 18 - 27.","Yakovlev, R. V. (2010) Cossidae of Israel. Atalanta, 41 (3 / 4), 465 - 469.","Didmanidze, E. A. & Yakovlev, R. V. (2007) Cossidae (Lepidoptera) of Georgia. Entomofauna, 28 (1), 1 - 16.","Saldaitis, A. & Yakovlev, R. V. & Ivinskis, P. (2007) Carpenter moths (Insecta: Lepidoptera, Cossidae) of Lebanon. Acta Zoologica Lituanica, 17 (3), 191 - 197. https: // doi. org / 10.1080 / 13921657.2007.10512831"]}

Dyspessa artemis Yakovlev, 2008 (Fig. 5F) Dyspessa artemis Yakovlev, 2008b, Eversmannia 15/16: 59. LT: Hakkari, Altin Daglari O-Seite, S��varihalil Gecidi [Turkey]. Type material (holotype) in MWM. Material examined. HMIM: Esfah��n Prov.: 2 ♂♂, Fereydun Shahr, Sibak Mt., 2500 m, 17.���18.vi.2002, leg. Meineke, Hofmann, Kallies et al .; F��rs Prov.: 1 ♂, K��zerun, Tang-e Chog��n, 900 m, 9.v.1974, leg. Ab��i, P��zuki, 1 ♂, Shir��z, 10 km N Sivand, 1150 m, 15.v.1974, leg. Ab��i, P��zuki, 1 ♂, Mamasani, Ch��htut, 1.���8.vi.1976, leg. Ab��i, 2 ♂♂, K��zerun, G��wkoshak, 1150 m, 18.v.1975, leg. P��zuki (gen. prep. No. HA-2011, HMIM), Borumand; Kohgiluyeh and Boyerahmad Prov.: 1 ♂, Sisakht, Kh��ridun, N 30˚54��44.07˝, E 51˚24��47.16˝, 1644 m, 9.vii.2011, leg. Sarafr��zi, Falsafi (gen. prep. No. HA-2012, HMIM); Kordest��n Prov.: 1 ♂, 23 km NE B��neh, Saghez- B��neh Rd., 1750 m, 2.vii.1975, leg. P��zuki; Lorest��n Prov.: 1 ♂, Oshtor��nkuh, Parcheh Kabud, 2800 m, 1.���2.viii.1975, leg. P��zuki (gen. prep. No. HA-2010, HMIM). RYB: 1 ♂, 1 ♀, prov. Hamadan (= Hamed��n), near Tuysarkan, vill. Sarkan (= Serk��n), 2300 m, 17.vii.2009. Distribution. Turkey (Yakovlev 2008b). Distribution in Iran. W and SW Iran (Fig. 24F). Remarks. This species is newly reported for the fauna of Iran., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 19, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Yakovlev, R. V. (2008 b) New species of Palaearctic and Oriental Cossidae (Lepidoptera). IV. New taxa of the genus Dyspessa Hubner, [1820] from Mediterranean-Iranian region (Lepidoptera: Cossidae). Eversmannia, 15 / 16, 53 - 68. [in Russian]"]}

Dyspessa salicicola (Eversmann, 1848) Cossus salicicola Eversmann, 1848, Bull. Soc. Imp. Nat. Moscou 21: 211. LT: Saratovischen Gournevement, in der Gegend von Wolsk [Russia, Saratov Reg., Volsk]. Type material (holotype) in ZISP. Synonymy: = Dyspessa salicicola f. lutescens Silbernagel, 1944, Z. Wien. Ent. Ges. 29: 187. LT: Ochrid (Ochrid lake) [Macedonia]. Type material (holotype) in MWM. Distribution. Bulgaria, Macedonia, Albanien, Greece, Ukraine, SW Russia, Transcaucasia, Turkey, China (Xinjang), Kazakhstan (Spuler 1910; Didmanidze 1978; de Freina 1983, 1996; de Freina & Witt 1990; Gevorkian 1986; Yakovlev 2004d, 2005; Didmanidze & Yakovlev 2007; Yakovlev 2009c). Host plants. Salix fragilis L. (Salicaceae). Remarks. This species is represented by two subspecies: Dyspessa salicicola salicicola (Eversmann, 1848) and D. salicicola aschabadensis Daniel, 1953. The latter one is known from Iran (Christoph 1876) and is distributed in the northern parts of the country. Among the examined material there were two specimens collected in the south and south-western parts of Iran, with a few differences in the wing pattern and length of the pecten processes of the antennae from D. salicicola aschabadensis. These differences are as follows: the oval dark brown spots at the middle part of the forewing are indistinct and partly faded both at upper- and undersides. Only some traces of them are remained which are mainly visible at the upperside (Figs. 7A, B). Moreover, length of the pecten process is almost 3.5 times longer than the antennal segment diameter (Figs. 7C, E) comparing being two times longer in D. salicicola aschabadensis (Figs. 7D, F). Here we consider these differences as intrasubspecific variations pending conducting a molecular study., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 23, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Eversmann, E. (1848) Beschreibung einiger neuen Falter Russlands. Bulletin de la Socieitei impeiriale des naturalistes de Moscou, 21, 205 - 232.","Silbernagel, A. (1944) Die Schmetterlinge der Ochrid-Gegend in Macedonien. Zeitschrift derWiener Entomologischen Gesellschaft, 29, 184 - 187.","Spuler, A. (1910) Die Schmetterlinge Europas. Bd. 2. E. Schweizerbart, Stuttgart, 523 pp.","Didmanidze, E. A. (1978) Moths (Lepidoptera, Heterocera) of arid landscapes of Georgia. Tbilisi: Metzniereba, 318 pp. [in Russian]","Freina, J. J. de (1983) 4. Beitrag zur systematischen Erfassung der Bombyces- und Sphinges- Fauna Kleinasiens. Neue Kenntnisse uber Artenspektrum, Systematik und Nomeklatur sowie Beschreibungen neuer Taxa. Mitteilungen der Munchner Entomologischen Gesellschaft, 72, 57 - 127.","Freina, J. J. de & Witt, T. J. (1990) Die Bombyces und Sphinges der Westpalaearktis (Insecta, Lepidoptera). Bd. 2. Cossoidea, Hepialoidea, Pyraloidea, Zygaenoidea. Edition Forschung & Wissenschaft, Munchen, 134 S, 10 taf.","Gevorkian, M. R. (1986) Fauna of Heterocera (Lepidoptera) of gorges of the Razdan river and its tributary Marmarik (Armenian SSR). Entomologicheskoe Obozrenie [Entomological Review], 65, 683 - 684.","Yakovlev, R. V. (2004 d) Carpenter-moths (Lepidoptera, Cossidae) of Siberia. Euroasian Entomological Journal, 3 (2), 155 - 163. [in Russian]","Didmanidze, E. A. & Yakovlev, R. V. (2007) Cossidae (Lepidoptera) of Georgia. Entomofauna, 28 (1), 1 - 16.","Yakovlev, R. V. (2009 c) New Cossidae for Chinese fauna (Lepidoptera). Eversmannia, 17 / 18, 54 - 56.","Daniel, F. (1953) Neue Heterocera-Arten und Formen. Mitteilungen der Munchner Entomologischen Gesellschaft, 43, 252 - 261.","Christoph, H. (1876) Sammelergebnisse aus Nordpersien, Krasnowodsk in Turkmenien und dem Daghestan. Horae Societatis Entomologique Rossicae, 12, 206."]}

Dyspessa zurvan Yakovlev, 2008 (Fig. 8E) Dyspessa zurvan Yakovlev, 2008b, Eversmannia 15/16: 54. LT: Prov. West Azerbaidzan, 5 km E H��y [Iran]. Type material (holotype) in MWM. Material examined. HMIM: Il��m Prov.: 1 ♂, Mehr��n, 19.iii.1970, leg. Ab��i, H��shemi; Kordest��n Prov.: 1 ♂, Saghez- B��neh Rd., 21 km NE B��neh, 1950 m, 30.vi.���2.vii.1975, leg. Ebert, Falkner. MWM: 1 ♂ (holotype), Iran, prov. West Azerbaidzan (��zarb��ij��n), 5 km E H��y (= Khoy), 1020 m, 26.iv.2000, leg. Szabo & Hentschel; paratypes, 10 ♂♂, same locality. Distribution. NW Iran (Yakovlev 2008b). Distribution in Iran. West Azarbaijan, Kordestan and Ilam Provinces (Fig. 27B)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 29, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Yakovlev, R. V. (2008 b) New species of Palaearctic and Oriental Cossidae (Lepidoptera). IV. New taxa of the genus Dyspessa Hubner, [1820] from Mediterranean-Iranian region (Lepidoptera: Cossidae). Eversmannia, 15 / 16, 53 - 68. [in Russian]"]}

Dyspessa alipanahae Yakovlev, 2008 (Fig. 5C) Dyspessa alipanahae Yakovlev, 2008b, Eversmannia 15/16: 56. LT: Prov. Kordestan, Sanandag district [Iran]. Type material (holotype) in MWM. Material examined. HMIM: Hormozg��n Prov.: 1 ♀, Isin, 150 m, 6.iii.1985, leg. Borumand, H��shemi (gen. prep. No. HA-2100, HMIM). MWM: 1 ♂ (holotype), Iran, prov. Kordestan, Sanandag (= Sanandaj) district, 1900 m, 18.���19.v.1999, leg. Gasko, paratypes: 2 ♀♀, same data; 1 ♀, Iran, Prov. Hamadan (= Hamed��n), Nehavand (= Nah��vand) distr., 2500 m, 20.���21.v.1999, leg. K. Gasko. Distribution. NW Iran (Yakovlev 2008b). Distribution in Iran. W and S Iran (Fig. 24C)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 17, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Yakovlev, R. V. (2008 b) New species of Palaearctic and Oriental Cossidae (Lepidoptera). IV. New taxa of the genus Dyspessa Hubner, [1820] from Mediterranean-Iranian region (Lepidoptera: Cossidae). Eversmannia, 15 / 16, 53 - 68. [in Russian]"]}

Dyspessa ulula (Borkhausen, 1790) Phal.[aena] Bombyx ulula Borkhausen, 1790, Naturgesch. Europ. Schmett. 3: 142. LT: Europe. Type material is lost. Synonymy: = Phalaena pantherina H��bner, 1790, Beitr. Ges. Schmett. 2: 29 (as hepialina). LT: Florence [Italy]. Type material is lost. = Phalaena hepialica Borkhausen, 1790, Naturgesch. Europ. Schmett. 3: 469. LT: Frankfurt [Germany]. Type material is probably lost. = Bombyx hepialina H��bner, 1790, Beitr. Ges. Schmett. 2: 123. LT: Florenz [Italy]. Type material is probably lost. = Endagria marmorata Rambur, 1858, Cat. Syst. L��pid. Andalousie: 332. LT: Grenade [Spain]. Type material (holotype) in MNHN. Distribution. S Europe, Caucasus, Transcaucasia (Eversmann 1844; Erschoff & Fild 1870; Staudinger 1871a, b, 1879a; Romanoff 1885; Staudinger & Rebel 1901; Bachmetjev 1902; Rebel 1904, 1911, 1916; Spuler 1910; Zhuravlev 1910; Dannehl 1929; Buresch & Tuleschkow 1932; Povoln�� 1951; Daniel & Friese 1966; Didmanidze 1975, 1976 a, 1978, 1980; G��mez-Bustillo & Fern��ndes-Rubio 1976; Leraut 1980; Ganev 1984; Gevorkian 1986; de Freina 1996; Bertaccini et al. 1997; Anikin et al. 2000; Fazekas 2001, 2002a, b; Yakovlev 2004d, 2007a),? Syria (El-Hariri 1968). Host plants. Different species of Allium in Europe (Hrub�� 1964; G��mez-Bustillo & Fern��ndes-Rubio 1976; Buser et al. 2000; Piskunov et al. 2000). Remarks. This species includes three subspecies, Dyspessa ulula ulula (Borkhausen, 1790), D. ulula kasrii Daniel, 1964 and D. ulula nigrita Wagner, 1931, of which the second one is distributed in Iran (Daniel 1964a, 1965b; Yakovlev 2011a)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 26, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Borkhausen, M. B. (1790) Naturgeschichte der Europaischen Schmetterlinge nach systematischer Ordnung. Dritter Theil, der Phalanen erste Horde, die Spinner. Varrentrap und Wenner, Frankfurt, [X] + 476 pp.","Hubner, J. (1790) Beitrage zur Geschichte der Schmetterlinge. 2 (4). der Verfasser, Augsburg, 134 pp., 16 pls.","Rambur, P. (1858 - 1866) Catalogue Systematique des Lepidopteres de l'Andalousie, J. B. Bailliere, Paris, 412 pp., 22 pls. https: // doi. org / 10.5962 / t. 173069","Eversmann, E. (1844) Fauna lepidopterologica volgo-uralensis exhibens Lepidopterorum species quas per viginti quinque annos in provonciis Volgam fluvium inter et montes Uralenses sitis observavit et descripsit. T ypis Universitatis, Casani, 633 pp.","Erschoff, N. G. & Fild, A. (1870) Catalogus lepidopterorum imperii Rossici. Proceedings of the Russian Entomological Society, 4, 130 - 205.","Staudinger, O. (1871 a) In: Staudinger, O. & Wocke, M. F. (Eds.), Catalog der Lepidopteren des europaeischen Faunengebiets. I. Macrolepidoptera. Hofbuchhandlung von Hermann Burdach, Dresden, pp. 61 - 63.","Romanoff, N. M. (1885) Les Lepidopteres de la Transcaucasie 2. In: Romanoff, N. M. (Ed.), Memoires sur les Lepidopteres, St. - Petersbourg, 2, pp. 1 - 118.","Staudinger, O. & Rebel, H. (1901) In: Staudinger, O. & Rebel, H. (Eds.), Catalog der Lepidopteren des Palaearktischen Faunengebietes I. Theil: Famili. Papilionidae - Hepialidae. Third edition. R. Friedlanger und Sohn, Berlin, pp. 1 - 411","Bachmetjev, P. (1902) Die Schmetterlinge Bulgariens. Horae Societatis Entomologique Rossicae, 35, 422 - 423.","Rebel, H. (1904) Studien uber die Lepidopterenfauna der Balkanlander. Annalen des K. K. Naturhistorischen Hofmuseum, 19 (2 - 3), 303.","Rebel, H. (1911) Die Lepidopterenfauna von Herkulesbad und Orsova. Eine zoogeographische Studie. Annalen des K. K. Naturhistorischen Hofmuseum, 25, 253 - 430.","Rebel, H. (1916) Die Lepidopterenfauna Kretas. Annalen des K. K. Naturhistorischen Hofmuseum, 30, 144.","Spuler, A. (1910) Die Schmetterlinge Europas. Bd. 2. E. Schweizerbart, Stuttgart, 523 pp.","Zhuravlev, S. M. (1910) Materials on the fauna Lepidoptera Uralsk Sity and different places of Ural'skaya oblast'. Horae Societatis Entomologique Rossicae, 50, 463. [in Russian]","Dannehl, F. (1929) Betrage zur Lepidopteren-Fauna Sudtirols. Entomologische Zeitschrift, 43 (12), 146 - 149.","Buresch, I. & Tuleschkow, K. (1932) Die horizontale Verbreitung der Schmetterlinge in Bulgarien. III (1). Teil: Noctuiformes. Mitteilungen aus den Koniglichen Naturwissenschaftlichen Instituten in Sofia 5, 67 - 144. [in Bulgarian]","Daniel, F. & Friese, G. (1966) Ergebnisse der Albanien-Expedition 1961 des Deutschen Entomologischen Institutes. Beitrage zur Entomologie, 16 (3 / 4), 483 - 486.","Didmanidze, E. A. (1975) Materials on fauna of Macrolepidoptera of Minor Caucasus (Meskhet-Dzhavakheti, South Georgia). Vestnik Gosudarstvennogo Muzeia Gruzii, 28 A, 293 - 336. [in Russian]","Didmanidze, E. A. (1976 a) At the investigation of fauna of Macrolepidoptera of Minor Caucasus (Tsalka-Dmanisi districts). Vestnik Gosudarstvennogo Muzeia Gruzii, 29 A, 154 - 183. [in Russian]","Didmanidze, E. A. (1978) Moths (Lepidoptera, Heterocera) of arid landscapes of Georgia. Tbilisi: Metzniereba, 318 pp. [in Russian]","Didmanidze, E. A. (1980) Materials on fauna of Macrolepidoptera of Tusheti. Vestnik Gosudarstvennogo Muzeia Gruzii, 30 A, 126 - 166. [in Russian]","Gomez-Bustillo, M. R. & Fernandes-Rubio, F. (1976) Mariposas de la Peninsula Iberica. Heteroceros I. Ministerio de Agricultura, Pesca y Alimentacion Instituto Nacional para la Conservacion de la Naturaleza. Madrid, 304 pp.","Leraut, P. (1980) Liste systematique et synonymique des Lepidopteres de France, Belgique et Corse. Supplement a Alexanor et au Bulletin de la Societe entomologique de France. Alexanor, Paris, 526 pp.","Ganev, J. (1984) Catalogue of the Bulgarian Bombyces and Sphinges (Lepidoptera: Notodontidae, Dilobidae, Thaumetopoei- dae, Ctenuchidae, Saturniidae, Endromidae, Lasiocampidae, Sphingidae, Hepialidae, Cossidae, Thyrididae, Limacodidae, Drepa- nidae, Thyatiridae, Lymantriidae, Arctiidae, Nolidae). Entomofauna, 5 (3 / 4), 391 - 419.","Gevorkian, M. R. (1986) Fauna of Heterocera (Lepidoptera) of gorges of the Razdan river and its tributary Marmarik (Armenian SSR). Entomologicheskoe Obozrenie [Entomological Review], 65, 683 - 684.","Freina, J. J. de (1996) Cossidae. In: Karsholt, O. & Razowski, J. (Eds.), The Lepidoptera of Europe. A distributional Checklist. Apollo Books, Soro, pp. 129 - 130.","Bertaccini, E., Fiumi, G. & Provera, P. (1997) Cossidae / Bombici e Sfingi d' Italia (Lepidoptera, Heterocera). Vol. 2. Natura- Giuliano Russo Editore, Monterenzio, Bologna, 256 pp., 16 Tavv.","Anikin, V. V., Sachkov, S. A., Zolotuhin, V. V. (2000) \" Fauna lepidopterologica Volgo-Uralensis \" 150 years later: changes and additions. Part 2. Bombyces and Sphinges (Insecta, Lepidoptera). Atalanta, 31 (1 / 2), 265 - 292.","Fazekas, I. (2001) Somogy megye molylepke faunaja (Lepidoptera, Microlepidoptera). Natura Somogyiensis, 1, 303 - 327.","Fazekas, I. (2002 a) Systematisches und synonymisches Verzeichnis der Microlepidopteren Ungarns (Lepidoptera, Microlepidoptera). Folia historico-naturalia Musei Matraensis, 26, 289 - 327.","Yakovlev, R. V. (2004 d) Carpenter-moths (Lepidoptera, Cossidae) of Siberia. Euroasian Entomological Journal, 3 (2), 155 - 163. [in Russian]","Yakovlev, R. V. (2007 a) Carpenter-moths (Lepidoptera: Cossidae) of Russia. Eversmannia, 9, 11 - 33. [in Russian]","El-Hariri, G. (1968) A list of recorded Syrian insects and Acari, Faculty of Agriculture, University of Aleppo, Syria. 160. [In Arabic]","Hruby, K. (1964) Cossidae. In: Prodromus Lepidopter Slovenska. Vydavatel'stvo Slovenskej akademie vied, Bratislava, pp. 161 - 163. [in Slovak and Latin]","Buser, H., Huber, W. & Joos, R. (2000) Cossidae-Holzbohrer. In: Pro Natura (Ed.), Schmetterlinge und ihre Lebensraume. Arten. Gefahrdung. Schutz. Schweitz und angrenzende Gebiete. Vol. 3. Schweizerischer Bund fur Naturschutz. Fotorotar AG, Druck, Verlag, Neue Medien, pp. 97 - 116.","Piskunov, V. L, Dorofeev, A. M. & Lakotko, A. A. (2000) Carpenter-Moths or Cossids (Lepidoptera, Cossidae Walker, 1855) of Northern Belarus' [Belorussia]. Tribune Vitebsk University, 18 (4), 101 - 107. [in Russian]","Daniel, F. (1964 a) Monographie der palaearctishen Cossidae. VII. Genus Dyspessa Hbn. Zweiter Teil, Genus Paropta Stgr. Mitteilungen der Munchner Entomologischen Gesellschaft, 54, 181 - 236.","Daniel, F. (1965 b) Osterreichische Entomologische Iran-Afganistan-Expeditionen. Beitrage zur Lepidopterenfauna, Teil 4. Weitere Beitrage zur Bombyces et Sphinges Fauna. Zeitschrift der Wiener Entomologischen Gesellschaft, 50, 121 - 145.","Yakovlev, R. V. (2011 a) Catalogue of the Family Cossidae of the Old World. Neue Entomologische Nachrichten, 66, 1 - 129."]}

Dyspessa alpherakyi (Christoph in Romanoff, 1885) (Fig. 5D) Endagria alpherakyi Christoph in Romanoff, 1885, M��m. L��p. 2: 202. LT: Ordoubad [Azerbaidzhan]. Type material (syntypes) in ZISP. Material examined. HMIM: West ��zarb��ij��n Prov.: 1 ♂, B��zarg��n, 1450 m, 5.vi.1975, leg. Ab��i. Distribution. Georgia, Azerbaijan (Nakhchivan), Armenia (Staudinger & Rebel 1901; Didmanidze 1976b, 1978; Didmanidze & Zurashvili 1981; Gevorkian 1986; Didmanidze & Yakovlev 2007). Distribution in Iran. NW Iran (Fig. 24D). Remarks. This species is newly reported for the fauna of Iran., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on page 17, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Romanoff, N. M. (1885) Les Lepidopteres de la Transcaucasie 2. In: Romanoff, N. M. (Ed.), Memoires sur les Lepidopteres, St. - Petersbourg, 2, pp. 1 - 118.","Staudinger, O. & Rebel, H. (1901) In: Staudinger, O. & Rebel, H. (Eds.), Catalog der Lepidopteren des Palaearktischen Faunengebietes I. Theil: Famili. Papilionidae - Hepialidae. Third edition. R. Friedlanger und Sohn, Berlin, pp. 1 - 411","Didmanidze, E. A. (1976 b) New species of Lepidoptera for fauna of Georgia from Vashlovanskii State Reserve. Bulletin of the Academy of Sciences of the Georgian SSR, 84 (3), 717 - 719. [in Russian]","Didmanidze, E. A. (1978) Moths (Lepidoptera, Heterocera) of arid landscapes of Georgia. Tbilisi: Metzniereba, 318 pp. [in Russian]","Didmanidze, E. A. & Zurashvili, T. M. (1981) Materials on study of Macrolepidoptera of Vashlovanskii Reserve. Zapovedniki Gruzii, 5, 76 - 118. [in Russian]","Gevorkian, M. R. (1986) Fauna of Heterocera (Lepidoptera) of gorges of the Razdan river and its tributary Marmarik (Armenian SSR). Entomologicheskoe Obozrenie [Entomological Review], 65, 683 - 684.","Didmanidze, E. A. & Yakovlev, R. V. (2007) Cossidae (Lepidoptera) of Georgia. Entomofauna, 28 (1), 1 - 16."]}

Dyspessa kabylaria A. Bang-Haas, 1906 Dyspessa kabylaria A. Bang-Haas, 1906, Dtsch. Entomol. Z. Iris 19: 143. LT: Gafsa [Tunis]. Type material (syntypes) in MHUB. Material examined. NHRS: 5 ♂♂, Iran, Fars, Strasse Kazeroun-Bouchir, Tohoureum (= Kazerun- Bushehr Rd., Cherom), 1000 m, 20.iii.���6.iv.1937, leg. Brandt. Distribution. Tunis, Algeria, Egypt, Saudi Arabian, Iran,?S Turkey, Israel, Jordan (Rothschild 1917; Andres & Seitz 1923; Chneour 1955; Rungs 1979; Wiltshire 1990; Hacker 1999; Yakovlev 2010). Distribution in Iran. SW Iran (Fars) (Fig. 25E)., Published as part of Alipanah, Helen, Yakovlev, Roman, Falsafi, Hossein, Witt, Thomas & Saldaitis, Aidas, 2021, 5062, pp. 1-100 in Zootaxa 5062 (1) on pages 20-21, DOI: 10.11646/zootaxa.5062.1.1, http://zenodo.org/record/5808035, {"references":["Bang-Haas, A. (1906) Neue oder wenig bekannte palaearktishce Macrolepidopteren. Deutsche Entomologische Zeitschrift Iris, 19, 143 - 144.","Rothschild, W. (1917) Supplemental notes to Mr. Charles Oberthur's faune des Lepidoptdres de la Barbarie, with lists of the specimens contained in the Tring Museum. Novitates Zoologicae, 24, 393 - 409.","Chneour, A. (1955) Macrolepidopteres de Tunisie IV - Bombyces. Bulletin de la Societe des Sciences Naturelles de Tunisie, 8 (3 - 4), 287 - 289.","Rungs, Ch. E. E. (1979) Catalogue Raisonne des Lepidoptdres du Maroc. Inventaire Faunistique et observations ecologiques Tome I, [in] Travaux de 1 Institut Scientifi que, Serie Zoologie, Rabat, 39, [i] - [x], 1 - 244, 2 maps.","Wiltshire, E. P. (1990) An Illustrated Annotated Catalogue of the Macro-Heterocera of Saudi Arabia. Fauna of Saudi Arabia, 11, 91 - 250.","Yakovlev, R. V. (2010) Cossidae of Israel. Atalanta, 41 (3 / 4), 465 - 469."]}

We described a new cossid species, Dyspessa ulgen sp. nov. from the Tarbagatai and Altai Mountains and compared it to other taxa of Dyspessa reported from the region (D. tristis, D. saldaitisi, D. saissanica), as well as to morphologically similar D. ulula. The new species is most closely related to D. ulula but differs from the latter in the characteristics of the male genitalia, wing pattern, and molecular data (a 658 bp fragment of the mitochondrial COI gene).

Dyspessa ulgen Yakovlev, Shapoval, Ivonin, Knyazev & Kuftina, sp. nov. (Figs. 4 A���B) Type. Holotype. Male, sample ID���YK500, GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401259; NE Kazakhstan, Tarbagatai Mts. range, 6 km W Karabuirat Village, 1020 m, 47��21���N / 81��06���E, 02.06.2018, P. Gorbunov leg. (GenPr # 9, coll. Yakovlev / 2018), deposited in the Zoological Institute of the Russian Academy of Sciences (St. Petersburg). Paratypes: 12 females, field codes YK501 (Gen-Bank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401260), YK502, YK503, YK504, YK505, YK506, YK507, YK508, YK509, YK510, YK511, YK512, same data and locality (deposited in ZISP, MWM, and RYB private collection); 9 females, field codes YK513, YK514, YK515, YK516, YK517, YK518, YK519, YK520, YK521), Eastern Kazakhstan, Kalba Mts, 40 km NW Kokpekty, 49��00���N / 82��00���, 760 m, 19.06.2018, R. Yakovlev, V. Doroshkin, V. Rudoj & A. Naydenov leg. (in RYB private collection); 4 females, field codes YK522, YK523, YK524, YK525, Eastern Kazakhstan, Kalba Mts., 6 km NW Panteleymonovka vill., 1130 m, 49��12���N / 83��12���E, 14.06.2012, R. Yakovlev leg. (in RYB private collection); 1 female, field code YC051 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401262), Russia, Altai Republic, Kosh-Agach distr., 5 km E Tebeler, Yustyt river valley, 1800 m, 24��� 25.06.2015, V. Ivonin leg. (private col-lection of Vadim Ivonin, Novosibirsk); 1 female, field code YC050 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401261) E Kazahstan, Kurchum distr., 26 km SE of Barsk-Batyr vill., 1800 m, 48��29���N / 84��07���, 20.06.2014, A. Volynkin, S. Titov leg. (in RYB private collection); 3 females, field codes YK701, YK702, YK703, Russia, Altai Krai, Loktevsky distr., Aley river valley, 1 km N of Ust���yanka vill., 51��09���47.6���N / 81��35���45.8���E, 330 m, 17��� 18.05.2020, leg. A.E. Naydenov (in RYB private collection). Diagnosis. The new species is most similar to D. ulula (Fig. 4D), from which it differs by: - the dark wings (D. ulula is much paler, the basic background is yellowish, the pale spots are much more expressed); - the expressed stepped bending on the costal edge of the valve (in D. tristis (Fig. 5A) and D. saldaitisi (Fig. 5B) the finely serrated surface on the costal edge of the valve in medium third; in D. ulula (Fig. 5C), the costal edge of valve is smoothly rounded; in D. saissanica (Fig. 5D) the proximal end of the process on the costal edge of the valve is sharp; - the phallus strongly bent in the medium third (in D. ulula, the phallus is less curved). The new species also differs from D. saissanica, D. saldaitisi D. tristis, and D. ulula (Figs 4C, 4E, 4F,) by the well-expressed dark color of the wings. Genetically, the new species differs from most closely related D. ulula by at least 36 fixed nucleotide substitutions (p-distance is 5.5%) within the studied 658bp fragment of the mitochondrial COI gene. COI barcode sequence of the holotype, 658 base pairs. AACATTATATTTTATTTTTGGAATTTGATCCGGAATAGTAGGTACTTCCTTAAGTCTATTAATTC- GAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTAATGATCAAATTTATAATACTATTGTGACAACT- CATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTTGGTAATTGATTAG TGCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTACTCCCCCCTTCTT- TA A C C C T T T TA AT T T C TA G G A G TAT T G T T G A A A AT G G A G C T G G A A C A G G AT G A A C A G T T- TA C C C T C C C C TAT C C T C TA ATAT C G C T C AT G G T G G A A G T T C A G T C G AT C TA G C TAT T T T T T C T TTACACTTAGCAGGAATTTCTTCCATCTTAGGAGCAATTAATTTTATTACCACTATCATTAATATAC- GCCCCTATAATATATCATTCGATCAAATACCCCTTTTTGTTTGAGCAGTTGGAATTACCGCATTAT- TACTTTTACTATCTCTTCCAGTATTAGCGGGAGCTATCACTATATTATTAACAGATCGAAATTTAAA TACTTCATTTTTTGACCCTGCGGGAGGGGGAGATCCAATTTTATACCAACATTTATTT Description. Male. (Fig. 4A) Length of forewing 10 mm. Antenna bipectinate, equal to half of the forewing length, antenna crest 1.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Forewing grey with a poorly developed pale pattern of pale cream spots along the costal edge in the discal cell, and two spots in the cubital area (one at wing base, second in the discal area). Fringe mottled, dark at veins, pale between veins. Hindwing ground colour and hindwing fringe grey, unicolorous. Female (Fig. 4B). Length of forewing 9��� 11 mm. Antenna bipectinate, equal to half of the forewing length, an-tenna crest 0.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Wing pattern resembles that of males. Female genitalia (Fig. 5F). Ovipositor long, papillae analis semicircular, anterior apophyses three times shorter than posterior apophyses, ostium aperture slit-shaped, narrow. Male genitalia (Fig. 5E). Uncus triangle, apically blunt; gnathos arms short, thick; gnathos small, poorly sclerotized; valve basally sclerotized, caudal end membranous, lanceolately narrowing, stepped bending on the costal edge of the valve (in medium third); transtilla process short, basally very wide, apically narrowing, apex semicircular; juxta tiny, with a pair of short rod-shaped lateral processes; saccus semicircular, robust; phallus equal to 3/4 of valve length, thin, apically narrowing, strongly bent in the medium third, vesica aperture in dorso-apical position, equal to 2/3 of phallus length, vesica without cornuti. Distribution. Kazakhstan (Eastern Kazakhstan Province), Russia (Altai Krai Province). Etymology. Ulgen������demiurge, the supreme deity in shamanism of Altaians, Khakas, and Shors., Published as part of Yakovlev, Roman V., Shapoval, Nazar A., Ivonin, Vadim V., Knyazev, Svyatoslav A., Kuftina, Galina N. & Masharskiy, Alexey E., 2020, A new species of Carpenter Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains, pp. 85-95 in Zootaxa 4896 (1) on pages 91-94, DOI: 10.11646/zootaxa.4896.1.3, http://zenodo.org/record/4359282

Dyspessa peri sp. n. (Lepidoptera: Cossidae) is described from Sarobi in Central Afghanistan. The new species is closely related to D. tristis A. Bang-Haas, 1912, and is distinguished by peculiarities of the wing pattern and structure of the male genitalia. http://www.zoobank.org/urn:lsid:zoobank.org:pub:D58AAAC5-90F2-4D06-9DB2-C4D3CDE36265

The article gives a detailed illustrated redescription of the rare little-known species, Dyspessa wiltshirei Daniel, 1938, including description of the male genital structure which is presented for the first time. The differences of this species from its closely related species are also provided.

Dyspessa kashgarica sp. n. (Figs 1���2, 7, 8) Type material. Holotype: male (Fig. 1), China, Xinjiang, SW from Kashi, Keng Tau Mts, Oytag loc., N 38 �� 54 ' 383 '', E075�� 12 ' 747 '', h- 2750 m, 1.vi. 2013, leg. Floriani, (slide OP 2749m) (coll. ASV/ WIGJ). Paratypes: 2 males (Fig. 2), with the same data as the holotype, 6 males (Fig. 2), China, Xinjiang, SW from Kashi, Keng-Tau Mts, Oytag loc., N 38 �� 54 ��� 363 ���, E 75 �� 13 ��� 788 ���, h- 2650 m, 4���6.vi. 2013, leg. Floriani, (slide OP 2750m) in the AFM, ASV, OP, RYB and WIGJ collections. Diagnosis. Externally D. kashgarica sp. n. differs from all Central Asiatic congeners by its larger size and a characteristic light-yellow pattern of forewing. In male genitalia, it differs from D. tristis (Figs 5, 6, 10) and D. saissanica (Figs 4, 11) by the narrower upper part of the valva and larger, dent-like costal prominence; from D. ruekbeili (Figs 3, 9) D. kashgarica differs by its significantly more massive sacculus, as well as the wider and less acute lateral transtilla processes. Description. Wingspan 23���25 mm (holotype 23 mm), length of forewing 11���12 mm (holotype 11 mm) (Figs 1, 2). Thorax and abdomen densely covered with light-yellow hair-like scales. Antenna bipectinate along the full length, with processes twice as long as diameter of flagellum. Forewing narrow, elongated; costa heavily sclerotized, concave subapically; apex rounded; termen slightly oblique; dorsum concave; ground colour grey with light yellow patches and streaks in medial and post medial areas; subbasal line present as dark patch; antemedial line disconnected, present as a dark dot on costa; medial line visible as dark patches near veins; postmedial line wide, incised with darkened sectors near veins; terminal line grey; subapical patch presented; fringe yellowish with scattered grey scales. Hindwing uniformly light grey with group of dark scales in the centre on CuA and CuA 1 junction, fringe yellowish. Male genitalia (Fig. 8). Symmetrical, uncus wide, tapering; tegumen strong; gnathos arms long, narrow, somewhat narrowing at base; valva tapering, wide at base with heavily sclerotized proximal part and weakly sclerotized distal part, costa curved in the middle forming large sclerotized dent-like prominence bordering upper part of valva; paired lateral transtilla processes near triangle with acute tips; juxta small, anterior ridge concave, lateral lobes of juxta cylindrical, apically pointed; saccus rounded; phallus narrow, curved at the ends, caecum broadened, bulbus ejaculatorius wide, vesica membranous. Female unknown. Etymology. The name is toponymical to Kashgar (Kashi), Xinjiang, China. Bionomics and distribution. Nine males were collected at ultraviolet light in the beginning of June 2013 in west China's Xinjiang Province, in a remote area at the northwestern edge of the Kunlun Shan Mountains, Keng Tau Mts (Fig. 7). The new species was collected at altitudes ranging from 2600 to 2750 metres in particularly dry mountains slopes covered by sparse bushes and Juniperus., Published as part of Yakovlev, Roman V., Saldaitis, Aidas & Pekarsky, Oleg, 2016, A new species of Dyspessa H��bner, (Lepidoptera, Cossidae) from Western China, with catalogue of Chinese species of the genus, pp. 85-88 in Zootaxa 4107 (1) on pages 85-88, DOI: 10.11646/zootaxa.4107.1.5, http://zenodo.org/record/267332

Dyspessa rueckbeili Yakovlev, 2007 (Fig. 3) Yakovlev, 2007: 21. Type locality: Asia Centr., Altyn Tagh [China, Xinjiang?, Qinghai? or Gansu? Provinces. Altun Shan Mountains]. Type material (holotype, male) in MNHU. Distribution: China, Xinjiang, Qinghai, Gansu Provinces, Altun Shan Mountains., Published as part of Yakovlev, Roman V., Saldaitis, Aidas & Pekarsky, Oleg, 2016, A new species of Dyspessa H��bner, (Lepidoptera, Cossidae) from Western China, with catalogue of Chinese species of the genus, pp. 85-88 in Zootaxa 4107 (1) on page 88, DOI: 10.11646/zootaxa.4107.1.5, http://zenodo.org/record/267332, {"references":["Yakovlev, R. V. (2007) New species of Palearctic Carpenter-Moths (Lepidoptera: Cossidae). Eversmannia, 10, 3 - 23. [in Russian]"]}

Dyspessa tristis A. Bang-Haas, 1912 (Figs 5, 6) A. Bang-Haas, 1912: 110. Type locality: Karagai-tau [Kazakhstan]. Type material (cotypes) in MNHU. Distribution: North West China, Xinjiang (Mongolian Altai), Kazakhstan, Tadzhikistan, Kirgizia (Yakovlev 2011)., Published as part of Yakovlev, Roman V., Saldaitis, Aidas & Pekarsky, Oleg, 2016, A new species of Dyspessa H��bner, (Lepidoptera, Cossidae) from Western China, with catalogue of Chinese species of the genus, pp. 85-88 in Zootaxa 4107 (1) on page 88, DOI: 10.11646/zootaxa.4107.1.5, http://zenodo.org/record/267332, {"references":["Bang-Haas, A. (1912) Neue oder wenig bekannte palaearktische Macrolepidopteren IV. Deutsche Entomologische","Yakovlev, R. V. (2011) Catalogue of the Family Cossidae of the Old World. Neue Entomologische Nachrichten, 66, 1 - 129."]}

Dyspessa kashgarica Yakovlev, Saldaitis & Pekarsky sp. n. (Figs 1, 2) Type locality: China, Xinjiang, SW from Kashi, Keng-Tau Mts, Oytag loc, N 38 �� 54 ��� 363 ���, E 75 �� 13 ��� 788 ���. Type material (holotype, male) in Saldaitis collection, later will be deposited in WIGJ. Distribution: China, Xinjiang, Keng-Tau Mts., Published as part of Yakovlev, Roman V., Saldaitis, Aidas & Pekarsky, Oleg, 2016, A new species of Dyspessa H��bner, (Lepidoptera, Cossidae) from Western China, with catalogue of Chinese species of the genus, pp. 85-88 in Zootaxa 4107 (1) on page 88, DOI: 10.11646/zootaxa.4107.1.5, http://zenodo.org/record/267332

Dyspessa saissanica Yakovlev, 2014 (Fig. 4) Yakovlev, 2014: 657. Type locality: E. Kazakhstan, Kurchum distr., Bukombaj Mts, 550 m, 48 �� 13 ���N; 84 �� 43 ���E. Type material (holotype, male) in ZISP. Distribution: East Kazakhstan, North West China, Xinjiang (near Hami)., Published as part of Yakovlev, Roman V., Saldaitis, Aidas & Pekarsky, Oleg, 2016, A new species of Dyspessa H��bner, (Lepidoptera, Cossidae) from Western China, with catalogue of Chinese species of the genus, pp. 85-88 in Zootaxa 4107 (1) on page 88, DOI: 10.11646/zootaxa.4107.1.5, http://zenodo.org/record/267332, {"references":["Yakovlev, R. V. (2014) Carpenter-Moths (Lepidoptera, Cossidae) of Altai Mountains Country. Zoologicheskiy Zhurnal, 93 (5), 651 - 661. [in Russian] http: // dx. doi. org / 10.7868 / S 0044513414050080"]}

Dyspessa kostyuki Yakovlev, 2005 Yakovlev, 2005: 22. Type locality: Ukraine, ���Proval���skaya Stepp��� Naturschutsgebiete. Type material (holotype) in MWM, examined. Distribution: SE Ukraine and SW Russia (Yakovlev 2011). Material examined: 9 males (paratypes), Russland, Rostov-Don, 40km W Nedwigovka, 12.06. 1993, ex coll. Schintlmeister (MWM); 1 male, 8 km S Makhachkala (MWM); 1 male, Daghestan, Makhachkala city, Karaman- 2 distr., 25.06. 2009 (APC); 1 male, Daghestan, Makhachkala city, Karaman- 2 distr., 21.06. 2011 (APC); 1 male, Bessergenevskaja, 3.06. 2009 (APC); 1 ex., Volochaevsky, 7.07. 2009 (APC); Gigant, 1 male, 7.06.2011, 2 males, 4.06. 2012 (APC); 2 males, Kamensk, 9.06. 2008 (APC); Konygin, 1 males, 16.06.1993, 3 males, 2 ��� 18.06.2007, 1 male, 5.06. 2010 (APC); 2 males, Kuibyshevo, 20.05. 2009 (APC); 4 males, Nesvetay, 9.06. 2008 (APC); 4 males, Nizhnesazonov, 22.06. 2011 (APC); 7 males, Olympia-camp, 6 ���8.06.2011 (APC); Rasswet, 1 male, 29.05.2013, 6 males, 9 ��� 30.06.2013 (APC); 1 male, Ternovoy, 10.06. 2012 (APC)., Published as part of Yakovlev, Roman V., Poltavsky, Alexander N., Ilyina, Elena V., Shchurov, Valeriy I. & Witt, Thomas J., 2015, Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species, pp. 270-288 in Zootaxa 4044 (2) on page 284, DOI: 10.11646/zootaxa.4044.2.5, http://zenodo.org/record/232713, {"references":["Yakovlev, R. V. (2005) New data on distribution and systematic of Cossidae (Lepidoptera) of Europe and adjacent territories. Eversmannia, 3 - 4, 18 - 27. [in Russian]"]}

Genus Dyspessa H��bner, [1820] 1816 H��bner, [1820] 1816: 194. Type species: Phalena pantherina H��bner, 1790, by subsequent designation by Kirby (1892). Dyspessa sp. (Figs 56, 84, 89, 110) Material examined: male, Afghanistan, Bamian, Band-e-Amir, Sabzel vill., 2900 m, 19.0 7.2013, leg. I. Pljustch, Yu. Skrylnik & O. Pak (RYB). Notes. We were unable to identify the single specimen from the large Palaearctic genus Dyspessa. The specimen resembles the Iranian D. serica Brandt, 1938 (type locality: Fort Sine-Sefid [Iran, Fars, Strasse Chiraz-Kazeroun]). Differences in the genitalia are insufficient, and external characters cannot be used due to the poor condition of the specimen. It will be possible to determine the species when new specimens are obtained. Daniel listed four specimens of the genus for Afghanistan: D. tristis A. Bang-Haas, 1912 (type locality: Karagai-tau [Kazakhstan]) for Herat, D. nigritula (Staudinger, 1887) (type locality: Transalai [S. Kyrgyzstan]) for Sarekanda and Kandaharkuna, Dyspessa sp. for Balkh (Daniel 1964) and D. pallidata Staudinger, [1892] (type locality: Amasia: ��Hadjin, Marasch und Kara Hissar�� [Turkey]) for Khurd-Kabul (Daniel 1971). Poor quality black-and-white photos pictured in the papers do not allow to identify the species with certainty. The material was not examined. Thus the composition of the Afghan fauna of Dyspessa cannot be ascertained., Published as part of Yakovlev, Roman V., Pljustch, Igor G., Skrylnik, Yuriy, Pak, Oleg & Witt, Thomas J., 2015, The Cossidae (Lepidoptera) of Afghanistan with description of three new species and special notes on the fauna of Bande-Amir National Park, pp. 41-72 in Zootaxa 3990 (1) on page 52, DOI: 10.11646/zootaxa.3990.1.3, http://zenodo.org/record/289113, {"references":["Hubner, J. ([1820]) Verzeichniss bekannter Schmetterlinge. Augsburg, 431 s.","Kirby, W. F. (1892) A synonymic Catalogue of Lepidopteren Heterocera. Vol. 1. Sphinges and Bombyces, London, 951 pp.","Bang-Haas, A. (1912) Neue oder wenig bekannte palaearktische Makrolepidopteren. IV. Deutsche Entomologische Zeitschrift, Iris, 26, 103 - 110.","Staudinger, O. (1887) Centralasiatische Lepidopteren. Entomologische Zeitung herausgegeben von dem entomologischen Vereine zu Stettin, 48 (1 - 3), 49 - 102.","Daniel, F. (1964) Cossidae aus Afganistan (Lep.). Opuscula Zoologica, 77, 1 - 8.","Daniel, F. (1971) Osterreichische Expeditionen nach Persien und Afghanistan. Annalen des Naturhistorischen Museums in Wien, 75, 651 - 660."]}

Dyspessa ulula (Borkhausen, 1790) Phal.[aena] Bombyx ulula Borkhausen, 1790: 142 Type locality: Europe. Type material is lost. Distribution: S. Europe, Caucasus, Transcaucasia. Material examined: 7 males, 10 females, Mashuk Mt., 15.06. 938 (ZISP); 12 males, 2 females, Makhachkala, 12.06. 950, Rjabov leg. (ZISP); 2 females, Pyatigorsk, 21.06. 1936 (ZISP); 1 male, Daghestan, Gubden, 29.06. 2006 (APR); 1 male, Daghestan, Kosob, 10.07. 1999 (APR); 1 male, Daghestan, Kayakent, 28.05. 2002 (APR); 1 male, Bolshekrepinskaja, 28.05. 2005 (APC); 3 ex., Volochaevsky, 28.05. 2011 (APC); 2 males, Kirsanovka, 25.06. 2014 (APC); 1 ex., Rasswet, 25.05. 2013 (APC); 1 male, Sukko, 23.05. 1997 (VSC); mass flying in light trap, Papay, 18.06. 1998 (VSC); 1 male, 3 female, Lysaja 3, 31.05.2007, 3 males, 9.05.1998, 2 males, 8.06. 1998 (VSC); 1 female, Shakhan, 7.06.2002, 1 female, 28.05.2008, 8 males, 2 females, mass flying in light trap (more than 120 individuals for 150 minutes), 17.06. 2009 (VSC); 1 male, Lysaja 1, 19.06. 2003 (VSC); 7 males, 1 females, Shize, 22.06.2004, 4 males, 29.05. 2005 (VSC); 6 males, 1 females, Verkhnebakanskiy, 18.05. 2007 (VSC); 3 males, Janina Gorge, 28.06.2000, 1 male, 2 females, 27.05. 2008 (VSC); 1 male, 1 female, Oblego, 18.06. 2009 (VSC)., Published as part of Yakovlev, Roman V., Poltavsky, Alexander N., Ilyina, Elena V., Shchurov, Valeriy I. & Witt, Thomas J., 2015, Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species, pp. 270-288 in Zootaxa 4044 (2) on page 283, DOI: 10.11646/zootaxa.4044.2.5, http://zenodo.org/record/232713, {"references":["Borkhausen, M. (1790) Naturgeschichte der europaischen Schmetterlinge, etc. Vol. 3. Barrentrapp and Wenner, Frankfurt, 8 + 476 pp."]}

Dyspessa pallidata (Staudinger, 1892) Endagria fuscula ab. pallidata Staudinger, 1892: 284. Type locality: Amasia. Type material (cotypes) in MHUB, examined. Distribution: Russia (Daghestan), Turkey, Armenia, Georgia, Azerbaidzhan, Iran, Lebanon, Jordan, Israel (Yakovlev 2011) Material examined: 1 male, USSR, NE Caucasus, Furtoug, 1100 m, 2.07. 1991, leg. Herczig, Marco et Meszaros (MWM)., Published as part of Yakovlev, Roman V., Poltavsky, Alexander N., Ilyina, Elena V., Shchurov, Valeriy I. & Witt, Thomas J., 2015, Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species, pp. 270-288 in Zootaxa 4044 (2) on page 284, DOI: 10.11646/zootaxa.4044.2.5, http://zenodo.org/record/232713, {"references":["Staudinger, O. (1892) Neue Arten und Varietaten von Lepidopteren des palaarktischen Faunengebiets. Deutsche Entomologische Zeitschrift, Iris, 4, 224 - 339."]}

Dyspessa salicicola (Eversmann, 1848) (fig. 10���11) Cossus Salicicola Eversmann, 1848: 211. Type locality: Saratovischen Gournevement, in der Gegend von Wolsk [Russia, Saratov Reg., Volsk]. Type material (syntypes) in ZISP, examined. Distribution: Bulgaria, Macedonia, Albanien, Grecee, Ukraine, SW Russia, Transcaucasia, Turkey, China (Xinjang), Kazakhstan (Yakovlev 2011). Material examined: 7 males, Groznyi, 17.05. 908, Rodnensky leg. (ZISP); 8 males, Mashuk Mt., 9.06. 908 (ZISP); 1 male, Gelendzhik, 9.06. 908 (ZISP); 2 males, Stavropol���, 12.06. 920, Filip���jev leg. (ZISP); 2 males, Tarki, 2.07. 945, Rjabov leg. (ZISP); 2 males, Neftekumsk (MWM); 1 male, Derbendt (MWM); 1 male, 1 female, Rostov Don Reg., Manytch Gudilo lake (MWM); 2 males, Daghestan, Kapchugaj (ZMKU); 1 male, Gigant, 1 ex., 17.06. 2014 (APC); Rasswet, 9 males, 23 ��� 25.05.2013, 6 males, 12 ��� 18.06.2014, 3 males, 2.07. 2014 (APC); 4 males, 1 female, Sober-Oaschkh, 19.06.1999, 5 male, 2 females, 29.06. 2006 (VSC); 2 males, Janina Gorge, 26.06.2000, 11 males, 1 female 27.05. 2008 (VSC); 6 males, 1 female, Jakhno, 13 ��� 15.06.2003, 11 males, 13.07.2003, 1 male, 3.06.2005, 3 males, 2 females, mass flying in light trap, 31.05 ���1.06.2007 (VSC); 1 male, Shize, 22.06. 2004 (VSC); 1 female, Voronezhskaja, 31.06. 2006 (VSC); 3 male, Lysaja 3, 31.05.2007, 3 males, 20.06.2007, 1 male, 5.07. 2010 (G. Schemberger) (VSC); 4 males, Akhilleon, 13.06. 2009 (VSC); more than 30 individuals for 150 minutes, Shakhan, 17.06. 2009 (VSC); 3 males, mass flying in light trap, Oblego, 18.06. 2009 (VSC); 3 males, Leninskiy Put, 25.06. 2009 (VSC); 1 male, Suzdal���skaja, 26.06. 2009 (VSC); 1 male, 1 female, Gajduk, 23.06. 2010 (VSC); 2 males, Red October, 23.06. 2011 (VSC); 1 male, Sapun, 22.07. 2011 (VSC); 3 males, 1 female Lysaja 3, 26.06.2004, 3 males, 7.07. 2014 (VSC); 1 male, Il���skaja, 16.06.2014, 1 male, 29.06. 2014 (E. Zhukov) (VSC)., Published as part of Yakovlev, Roman V., Poltavsky, Alexander N., Ilyina, Elena V., Shchurov, Valeriy I. & Witt, Thomas J., 2015, Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species, pp. 270-288 in Zootaxa 4044 (2) on page 284, DOI: 10.11646/zootaxa.4044.2.5, http://zenodo.org/record/232713, {"references":["Eversmann, E. (1848) Beschreibung einiger neuen Falter Russlands. Bulletin de la Societe Imperiale des Naturnalistes de Moscou, 21 (3), 205 - 232."]}

Dyspessa infuscata (Staudinger, 1892) End. [agria] Ulula ab. Infuscata Staudinger, 1892: 284. Type locality: Amasia. Type material (cotypes) in MHUB, examined. Distribution: Syria, Turkey, Russia (N. Caucasus), Ukraine (Crimea) (Yakovlev 2011). Material examined: 1 female, Pyatigorsk, Beshtau, 15.06. 1992, Tikhonov (MWM); 1 male, N. Caucasus, Terskol Mts., 2100 m, 30.07.0 4, leg. Kljuchko Z. (MSW); 1 male, Ciscaucasia, Mashuk (ZMKU); 2 males, Daghestan, Kapshugaj, Temir-Chan-Shura (ZMKU)., Published as part of Yakovlev, Roman V., Poltavsky, Alexander N., Ilyina, Elena V., Shchurov, Valeriy I. & Witt, Thomas J., 2015, Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species, pp. 270-288 in Zootaxa 4044 (2) on page 283, DOI: 10.11646/zootaxa.4044.2.5, http://zenodo.org/record/232713, {"references":["Staudinger, O. (1892) Neue Arten und Varietaten von Lepidopteren des palaarktischen Faunengebiets. Deutsche Entomologische Zeitschrift, Iris, 4, 224 - 339."]}

Despite the generally good knowledge of the European fauna of Cossidae, several new species (Lepidoptera) have been described in recent years: Dyspessa kostyuki Yakovlev, 2005 (type locality Ukraine, [Lugansk region], “Proval’skaya Stepp” Naturschutsgebiete), D. aphrodite Yakovlev & Witt, 2007 (type locality Greece, Peloponnes, Mega Spileon), and Stygia nilssoni Saldaitis & Yakovlev, 2008 (type locality Islas Canarias, Gran Canaria, Puerto de Mogan) (Yakovlev 2005; Yakovlev & Witt 2007; Saldaitis & Yakovlev 2008). However, a number of European cossids are still poorly known.