Search

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and blackskinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different redskinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of longterm interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish. [ABSTRACT FROM AUTHOR]

Mesenchymal stem cells (MSCs) have gained tremendous interest due to their overall potent pro‐regenerative and immunomodulatory properties. In recent years, various in vitro and preclinical studies have investigated different priming ("licensing") approaches to enhance MSC functions for specific therapeutic purposes. In this study, we primed bone marrow‐derived human MSCs (hMSCs) with an inflammation cocktail designed to mimic the elevated levels of inflammatory mediators found in serum of patients with severe injuries, such as bone fractures. We observed a significantly enhanced osteogenic differentiation potential of primed hMSCs compared to untreated controls. By RNA‐sequencing analysis, we identified the immediate early response 3 (IER3) gene as one of the top‐regulated genes upon inflammatory priming. Small interfering RNA knockdown experiments established IER3 as a novel positive regulator of osteogenic differentiation. Mechanistic analysis further revealed that IER3 deletion significantly downregulated bone marrow stromal cell antigen 2 (BST2) expression and extracellular signal‐related kinase 1/2 (ERK1/2) phosphorylation in hMSCs, suggesting that IER3 regulates osteogenic differentiation through BST2 and ERK1/2 signaling pathway activation. On the basis of these findings, we propose IER3 as a novel therapeutic target to promote hMSC osteoblastogenesis, which might be of high clinical relevance, for example, in patients with osteoporosis or compromised fracture healing. [ABSTRACT FROM AUTHOR]

Abnormal melanogenesis upon UV exposure causes excessive oxidative stress, leading to hyperpigmentation disorders. As a key rate-limiting enzyme in melanogenesis, tyrosinase is considered a primary target for depigmenting agents. Sophora flavescens is used as a food and in traditional medicine as a valuable source of prenylated flavonoids. The present study aimed to elucidate the anti-melanogenic effect and potential mechanism of kuraridin, one of the major prenylated flavonoids. Kuraridin showed anti-tyrosinase activity with an IC50 value in the nanomolar range, superior to that of kojic acid, a positive control. It significantly reduced tyrosinase activity with the least cytotoxicity, suppressing melanogenesis in α-MSH-induced B16F10 cells. Furthermore, kuraridin considerably reduced melanogenesis in a 3D human skin model. To elucidate the anti-melanogenic mechanism of kuraridin, target genes (KIT, MAP2K1, and PRKCA) and pathways (c-KIT and ETB-R pathways) were identified using network pharmacology. KIT and MAP2K1 are simultaneously involved in the c-KIT cascade and are considered the most important in melanogenesis. PRKCA acts directly on MITF and its downstream enzymes through another pathway. Docking simulation showed strong interactions between kuraridin and c-KIT, ERK1/2, and PKC encoded by target genes. Overall, the present study showed kuraridin to be a novel natural anti-melanogenic agent in hyperpigmentation disorders. [ABSTRACT FROM AUTHOR]

5-Demethylnobiletin is the active ingredient in citrus polymethoxyflavones that could inhibit the proliferation of several tumor cells. However, the anti-tumor effect of 5-Demethylnobiletin on glioblastoma and the underlying molecular mechanisms are remains unknown. In our study, 5-Demethylnobiletin markedly inhibited the viability, migration and invasion of glioblastoma U87-MG, A172 and U251 cells. Further research revealed that 5-Demethylnobiletin induces cell cycle arrest at the G0/G1 phase in glioblastoma cells by downregulating Cyclin D1 and CDK6 expression levels. Furthermore, 5-Demethylnobiletin significantly induced glioblastoma cells apoptosis by upregulating the protein levels of Bax and downregulating the protein level of Bcl-2, subsequently increasing the expression of cleaved caspase-3 and cleaved caspase-9. Mechanically, 5-Demethylnobiletin trigged G0/G1 phase arrest and apoptosis by inhibiting the ERK1/2, AKT and STAT3 signaling pathway. Furthermore, 5-Demethylnobiletin inhibition of U87-MG cell growth was reproducible in vivo model. Therefore, 5-Demethylnobiletin is a promising bioactive agent that might be used as glioblastoma treatment drug. [ABSTRACT FROM AUTHOR]

Progerin causes Hutchinson-Gilford progeria syndrome (HGPS), but how progerin accelerates aging is still an interesting question. Here, we provide evidence linking nuclear envelope (NE) budding and accelerated aging. Mechanistically, progerin disrupts nuclear lamina to induce NE budding in concert with lamin A/C, resulting in transport of chromatin into the cytoplasm where it is removed via autophagy, whereas emerin antagonizes this process. Primary cells from both HGPS patients and mouse models express progerin and display NE budding and chromatin loss, and ectopically expressing progerin in cells can mimic this process. More excitingly, we screen a NE budding inhibitor chaetocin by high-throughput screening, which can dramatically sequester progerin from the NE and prevent this NE budding through sustaining ERK1/2 activation. Chaetocin alleviates NE budding-induced chromatin loss and ameliorates HGPS defects in cells and mice and significantly extends lifespan of HGPS mice. Collectively, we propose that progerin-induced NE budding participates in the induction of progeria, highlight the roles of chaetocin and sustained ERK1/2 activation in anti-aging, and provide a distinct avenue for treating HGPS. [ABSTRACT FROM AUTHOR]

Keratinocytes play an essential role in the inflammatory phase of wound regeneration. In addition to migrating and proliferating for tissue regeneration, they produce a large amount of cytokines that modulate the inflammatory process. Previous studies have shown that subthermal treatment with radiofrequency (RF) currents used in capacitive resistive electric transfer (CRET) therapy promotes the proliferation of HaCat keratinocytes and modulates their cytokine production. Although physical therapies have been shown to have anti-inflammatory effects in a variety of experimental models and in patients, knowledge of the biological basis of these effects is still limited. The aim of this study was to investigate the effect of CRET on keratinocyte proliferation, cytokine production (IL-8, MCP-1, RANTES, IL-6, IL-11), TNF-α secretion, and the expression of MMP9, MMP1, NF-κB, ERK1/2, and EGFR. Human keratinocytes (HaCat) were treated with an intermittent 448 kHz electric current (CRET signal) in subthermal conditions and for different periods of time. Cell proliferation was analyzed by XTT assay, cytokine and TNF-α production by ELISA, NF-κB expression and activation by immunofluorescence, and MMP9, MMP1, ERK1/2, and EGF receptor expression and activation by immunoblot. Compared to a control, CRET increases keratinocyte proliferation, increases the transient release of MCP-1, TNF-α, and IL-6 while decreasing IL-8. In addition, it modifies the expression of MMPs and activates EGFR, NF-κB, and ERK1/2 proteins. Our results indicate that CRET reasonably modifies cytokine production through the EGF receptor and the ERK1/2/NF-κB pathway, ultimately modulating the inflammatory response of human keratinocytes. [ABSTRACT FROM AUTHOR]

Ischaemia‐reperfusion (IR)‐associated acute kidney injury (AKI) is a severe clinical condition that lacks effective pharmacological treatments. Our recent research revealed that pretreatment with the angiotensin II type 2 receptor (AT2R) agonist C21 alleviates kidney damage during IR. Primary cilia are organelles crucial for regulation of epithelial cell homeostasis, which are significantly affected by IR injury. This study aimed to evaluate the impact of AT2R activation on cilia integrity during IR and to identify pathways involved in the nephroprotective effect of C21. Rats were subjected to 40 min of unilateral ischaemia followed by 24 h of reperfusion. Immunofluorescence analysis of the kidneys showed that the nephroprotective effect of C21 was associated with preservation of cilia integrity in tubular cells. AT2R agonists increased α‐tubulin acetylation in primary cilia in tubular cells in vivo and in a cell model. Analysis of ERK phosphorylation indicated that AT2R activation led to diminished activation of ERK1/2 in tubular cells. Similar to AT2R agonists, inhibitors of α‐tubulin deacetylase HDAC6 or inhibitors of ERK activation ameliorated IR‐induced cell death and preserved cilia integrity. Immunofluorescence analysis of tubular cells revealed significant ERK localization at primary cilia and demonstrated that ERK inhibition increased cilia levels of acetylated α‐tubulin. Overall, our findings demonstrate that C21 elicits a preconditioning effect that enhances cilia stability in renal tubular cells, thereby preserving their integrity when exposed to IR injury. Furthermore, our results indicate that this effect might be mediated by AT2R‐induced inhibition of ERK activation. These findings offer potential insights for the development of pharmacological interventions to mitigate IR‐associated AKI. Key points: The AT2R agonist C21 prevents primary cilia shortening and tubular cell deciliation during renal ischaemia‐reperfusion.AT2R activation inhibits ERK1/2 in renal tubular cells.Both AT2R agonists and ERK1/2 inhibitors increase alpha‐tubulin acetylation at the primary cilium in tubular cells.AT2R activation, ERK1/2 inhibition or inhibition of alpha‐tubulin deacetylation elicit protective effects in tubular cells subjected to ischaemia‐reperfusion injury. [ABSTRACT FROM AUTHOR]

Sleep/wake cycles intricately shape physiological activities including cognitive brain functions, yet the precise molecular orchestrators of sleep remain elusive. Notably, the clinical impact of benzodiazepine drugs underscores the pivotal role of GABAergic neurotransmission in sleep regulation. However, the specific contributions of distinct GABAA receptor subtypes and their principal scaffolding protein, gephyrin, in sleep dynamics remain unclear. The evolving role of synaptic phospho‐proteome alterations at excitatory and inhibitory synapses suggests a potential avenue for modulating gephyrin and, consequently, GABAARs for sleep through on‐demand kinase recruitment. Our study unveils the distinctive roles of two prevalent GABAA receptor subtypes, α1‐ and α2‐GABAARs, in influencing sleep duration and electrical sleep activity. Notably, the absence of α1‐GABAARs emerges as central in sleep regulation, manifesting significant alterations in both non‐rapid eye movement (NREM) and rapid eye movement (REM) sleep during dark or active phases, accompanied by altered electroencephalogram (EEG) patterns across various frequencies. Gephyrin proteomics analysis reveals sleep/wake‐dependent interactions with a repertoire of known and novel kinases. Crucially, we identify the regulation of gephyrin interaction with ERK1/2, and phosphorylations at serines 268 and 270 are dictated by sleep/wake cycles. Employing AAV‐eGFP‐gephyrin or its phospho‐null variant (S268A/S270A), we disrupt sleep either globally or locally to demonstrate gephyrin phosphorylation as a sleep regulator. In summary, our findings support the local cortical sleep hypothesis and we unveil a molecular mechanism operating at GABAergic synapses, providing critical insights into the intricate regulation of sleep. [ABSTRACT FROM AUTHOR]

In this study, we investigated the potential therapeutic mechanism of ginsenoside Rg1 (GRg1) in chronic heart failure (CHF), focusing on its regulation of ERK1/2 protein phosphorylation. H9c2 cardiomyocytes and SD rats were divided into the control group, CHF (ADR) group, and CHF+ginsenoside Rg1 group using an isolated cardiomyocyte model and an in vivo CHF rat model induced by adriamycin (ADR). Cell viability, proliferation, apoptosis, and the expression of relevant proteins were measured to assess the effects of GRg1. The results showed that treatment with GRg1 increased cell activity and proliferation, while significantly reducing levels of inflammatory and apoptotic factors compared to the CHF (ADR) group. Moreover, the CHF+ginsenoside Rg1 group exhibited higher levels of Bcl-2 mRNA and protein expression, as well as lower levels of Caspase3 and Bax mRNA and protein expression, compared to the CHF (ADR) group. Notably, the CHF+ginsenoside Rg1 group displayed decreased serum NT-proBNP levels and heart weight/body weight (HW/BW) index. Furthermore, the electrocardiogram of rats in the CHF+ginsenoside Rg1 group resembled that of rats in the control group. Overall, our findings suggested that GRg1 alleviated CHF by inhibiting ERK1/2 protein phosphorylation, thereby inhibiting apoptosis, enhancing cell activity and proliferation, and reducing cardiac inflammatory responses. [ABSTRACT FROM AUTHOR]

Doxorubicin (Dox) is frequently employed as a chemotherapy agent for breast cancer. As the chemotherapy moves forward, breast cancer cells tend to develop resistance to Dox, besides that, Dox are also easy to cause cardiotoxicity related to cumulative dose. Therefore, how to potentiate the chemosensitivity of breast cancer cells to Dox while attenuating its cardiotoxicity has become a research hotspot. Tanshinone IIA (Tan IIA) is known for its anticancer activity as well as for its cardioprotective effects. In view of the aforementioned facts, we assessed whether Tan IIA possesses synergism and attenuation effect on Dox for breast cancer chemotherapy. Our studies in vitro indicated that, Tan IIA could potentiate the effect of Dox on breast cancer cells proliferation inhibition and apoptosis promotion by inhibiting ERK1/2 pathway, but interestingly, Tan IIA attenuated the cytotoxicity of Dox to myocardial cells by activating ERK1/2 pathway. Additionally, our studies in vivo also suggested that Tan IIA potentiated the chemotherapeutic effect of Dox against breast cancer while attenuating Dox‐induced myocardial injury. Given that Tan IIA had a synergism and attenuation effect on Dox, we believed that Tan IIA can be used as an ideal drug in combination with Dox for breast cancer therapy. [ABSTRACT FROM AUTHOR]

Summary Covalent Bruton's tyrosine kinase‐inhibitors (cBTK‐i) are highly active in MYD88‐mutated (MYD88Mut) Waldenstrom's macroglobulinaemia and suppress nuclear factor kappa‐light‐chain‐enhancer of activated B cells and extracellular signal‐regulated kinases‐1/2 (ERK1/2)‐related signalling. BTKCys481 mutations are associated with cBTK‐i acquired resistance and are accompanied by reactivation of ERK1/2 that promotes inflammatory cytokine secretion and paracrine‐mediated resistance of BTK wild‐type (BTKWT) tumour cells. Pirtobrutinib is a non‐covalent BTK‐inhibitor that binds at non‐BTKCys481 sites. We show that pirtobrutinib blocked p‐ERK1/2, ERK1/2‐driven inflammatory cytokines, and overcame paracrine‐mediated resistance in MYD88Mut lymphoma cells expressing mutated BTKCys481. Our results provide important mechanistic insights for the activity of pirtobrutinib in MYD88Mut lymphomas carrying BTKCys481 mutations. [ABSTRACT FROM AUTHOR]

Metabotropic glutamate receptor 4 (mGluR4) is widely regarded as an umami receptor activated by L-glutamate to exert essential functions. Numerous studies have shown that umami receptors participate in food intake regulation. However, little is known about mGluR4's role in mediating food ingestion and its possible molecular mechanism. Mandarin fish, a typical carnivorous fish, is sensitive to umami substances and is a promising vertebrate model organism for studying the umami receptor. In this study, we identified the mGluR4 gene and conducted evolutionary analyses from diverse fish species with different feeding habits. mGluR4 of mandarin fish was cloned and functionally expressed to investigate the effects of L-glutamate on mGluR4. We further explored whether the signal pathway mGluR4-Ca2+-ERK1/2 participates in the process in mandarin fish brain cells. The results suggest that L-glutamate could regulate Neuropeptide Y (Npy) via the mGluR4-Ca2+-ERK1/2 signaling pathway in mandarin fish. Our findings unveil the role of mGluR4 in feeding decisions and its possible molecular mechanisms in carnivorous fishes. [ABSTRACT FROM AUTHOR]

As a prevalent neurodegenerative disorder, Parkinson's disease is associated with oxidative stress. Our recent investigations revealed that reactive oxygen species (ROS) and PD-toxins like 6-hydroxydopamine (6-OHDA) can induce neuronal apoptosis through over-activation of Akt signaling. Chlorogenic acid (CGA), a natural acid phenol abundant in the human diet, is well-documented for its ability to mitigate intracellular ROS. In this study, we utilized CGA to treat experimental models of PD both in vitro and in vivo. Our study results demonstrated that SH-SY5Y and primary neurons exhibited cell apoptosis in response to 6-OHDA. Pretreatment with CGA significantly attenuated PD toxins-induced large amount of ROS, inhibiting Erk1/2 activation, preventing Akt inhibition, and hindering neuronal cell death. Combining the Erk1/2 inhibitor U0126 with CGA could reverse 6-OHDA-induced Akt inhibition, ROS, and apoptosis in the cells. Crucially, the Akt activator SC79 and ROS scavenger NAC both could eliminate excessive ROS via Akt and Erk1/2 signaling pathways, and CGA further potentiated these effects in PD models. Behavioral experiments revealed that CGA could alleviate gait abnormalities in PD model mice. The neuroprotective effects have been demonstrated in several endocrine regions and in the substantia nigra tissue, which shows the positive tyrosine hydroxylase (TH). Overall, our results suggest that CGA prevents the activation of Erk1/2 and inactivation of Akt by removing excess ROS in PD models. These findings propose a potential strategy for mitigating neuronal degeneration in Parkinson's disease by modulating the Akt/Erk1/2 signaling pathway through the administration of CGA and/or the use of antioxidants to alleviate oxidative stress. • CGA effectively mitigates the axonal damage induced by 6-OHDA in neuronal cells. • CGA inhibits excessive ROS production via the AKT/Erk1/2 signal pathway, preventing 6-OHDA-induced neuronal apoptosis. • CGA ameliorates dyskinesia of the A53T mice. • CGA mitigates the neuronal apoptosis and the histopathologic aberrations via the AKT/Erk1/2 signal pathway in the A53T mice. [ABSTRACT FROM AUTHOR]

In this study, we aimed to investigate cytoplasmic maturation and miRNA expression of mature oocytes cultured in porcine follicular fluid exosomes. We also examined the effect of miR-339-5p on oocyte maturation. Twenty eight differentially expressed miRNAs were detected using miRNA-seq. We then transfected cumulus oocyte complexes with miR-339-5p mimics and inhibitor during culture. The results showed that exosomes increased endoplasmic reticulum levels and the amount of lipid droplets, and decreased ROS levels, lipid droplet size, and percentage of oocytes with abnormal cortical granule distribution. Overexpressing miR-339-5p significantly decreased cumulus expansion genes, oocyte maturation-related genes, target gene proline/glutamine-rich splicing factor (SFPQ), ERK1/2 phosphorylation levels, oocyte maturation rate, blastocyst rate, and lipid droplet number, but increased lipid droplet size and the ratio of oocytes with abnormal cortical granule distribution. Inhibiting miR-339-5p reversed the decrease observed during overexpression. Mitochondrial membrane potential and ROS levels did not differ significantly between groups. In summary, exosomes promote oocyte cytoplasmic maturation and miR-339-5p regulating ERK1/2 activity through SFPQ expression, thereby elevating oocyte maturation and blastocyst formation rate in vitro. • This study examined the mechanisms behind enhanced in vitro oocyte maturation in pigs with follicular fluid exosomes. • MiRNA sequencing experiments demonstrated that miR-339-5p was differentially expressed between treatment groups. • MiR-339-5p regulated the ERK1/2 pathway through SFPQ and improved various measures of oocyte maturation. [ABSTRACT FROM AUTHOR]

Hypertension is a globally prevalent disease, but the pathogenesis remains largely unclear. AMP-activated protein kinase (AMPK) is a nutrition-sensitive signal of cellular energy metabolism, which has a certain influence on the development of hypertension. Previously, we found a down-regulation of the phosphorylated (p-) form of AMPK, and the up-regulation of the angiotensin II type 1 receptor (AT1-R) and that of p-ERK1/2 in the hypothalamic paraventricular nucleus (PVN) of hypertensive rats. However, the exact mechanism underlying the relationship between AMPK and AT1-R in the PVN during hypertension remains unclear. Thus, we hypothesized that AMPK modulates AT1-R through the ERK1/2-NF-κB pathway in the PVN, thereby inhibiting sympathetic nerve activity and improving hypertension. To examine this hypothesis, we employed a renovascular hypertensive animal model developed via two-kidney, one-clip (2K1C) and sham-operated (SHAM). Artificial cerebrospinal fluid (aCSF), used as vehicle, or 5-amino-1-β-d-ribofuranosyl-imidazole-4-carboxamide (AICAR, an AMPK activator, 60 μg/day) was microinjected bilaterally in the PVN of these rats for 4 weeks. In 2K1C rats, there an increase in systolic blood pressure (SBP) and circulating norepinephrine (NE). Also, the hypertensive rats had lowered expression of p-AMPK and p-AMPK/AMPK, elevated expression of p-ERK1/2, p-ERK1/2/ERK1/2 and AT1-R, increased NF-κB p65 activity in the PVN compared with the levels of these biomarkers in SHAM rats. Four weeks of bilateral PVN injection of AMPK activator AICAR, attenuated the NE level and SBP, increased the expression of p-AMPK and p-AMPK/AMPK, lessened the NF-κB p65 activity, decreased the expression of p-ERK1/2, p-ERK1/2/ERK1/2 and AT1-R in the PVN of 2K1C rats. Data from this study imply that the activation of AMPK within the PVN suppressed AT1-R expression through inhibiting the ERK1/2-NF-κB pathway, decreased the activity of the sympathetic nervous system, improved hypertension. [ABSTRACT FROM AUTHOR]

BackgroundOligodendrocytes are responsible for myelin production in the central nervous system (CNS). Hypomyelination may slow saltatory nerve signal conduction and affect motor performance and behavior in adults. Gestational marginal zinc deficiency in rats significantly decreases proliferation of neural stem cells (NSCs) in the offspring brain.ObjectivesGiven that NSCs are precursors of oligodendrocytes, this study investigated if marginal zinc deficiency during early development in rats affects oligodendrogenesis in the offspring's CNS.MethodsRat dams were fed an adequate (25 μg zinc/g diet) (C) or a marginal zinc diet (MZD) (10 μg zinc/g diet), from gestation day zero until postnatal day (P) 20, and subsequently all offspring was fed the control diet until P60. Oligodendrogenesis was evaluated in the offspring at P2, P5, P10, P20, and P60, by measuring parameters of oligodendrocyte progenitor cells (OPCs) proliferation, differentiation, maturation, and of myelination.ResultsThe expression of 1) proteins that regulate OPC proliferation (Shh, Sox10, Olig2); 2) OPC markers (NG2, PDGFRα); 3) myelin proteins (MBP, MAG, MOG, PLP) were lower in the brain cortex from MZD than C offspring at various stages in development. The amount of myelin after zinc replenishment continued to be low in the MZD young adult at P60. Accordingly, parameters of motor performance and behavior [grip strength, rotarod, elevated T-maze (ETM), and open-field tests] were impaired in the MZD offspring at P60.ConclusionsResults support the concept that maternal and early postnatal exposure to MZD affects oligodendrogenesis causing long-lasting effects on myelination and on motor performance in the young adult offspring.

AbstractContext Asthma presents a global health challenge. The main pharmacotherapy is synthetic chemicals and biological-based drugs that are costly, and have significant side effects. In contrast, use of natural products, such as onion (Allium cepa L., Amaryllidaceae) in the treatment of airway diseases has increased world-wide because of their perceived efficacy and little safety concerns. However, their pharmacological actions remain largely uncharacterized.Objective We investigated whether onion bulb extract (OBE) can (1) reverse established asthma phenotype (therapeutic treatment) and/or (2) prevent the development of the asthma phenotype, if given before the immunization process (preventative treatment).Materials and methods Six groups of male Balb/c mice were established for the therapeutic (21 days) and five groups for the preventative (19 days) treatment protocols; including PBS and house dust mite (HDM)-challenged mice treated with vehicle or OBE (30, 60, and 100 mg/kg/i.p.). Airways inflammation was determined using cytology, histology, immunofluorescence, Western blot, and serum IgE.Results Therapeutic (60 mg/kg/i.p.) and preventative (100 mg/kg/i.p.) OBE treatment resulted in down-regulation of HDM-induced airway cellular influx, histopathological changes and the increase in expression of pro-inflammatory signaling pathway EGFR, ERK1/2, AKT, pro-inflammatory cytokines and serum IgE.Discussion and Conclusion Our data show that OBE is an effective anti-inflammatory agent with both therapeutic and preventative anti-asthma effects. These findings imply that onion/OBE may be used as an adjunct therapeutic agent in established asthma and/or to prevent development of allergic asthma. However, further studies to identify the active constituents, and demonstrate proof-of-concept in humans are needed.

Objective(s): Baicalein (BAI) is one of the main ingredients of Scutellaria baicalensis georgi. Its pharmacological effects have been widely reported in various cancers. However, the specific molecular mechanism of BAI in gastric cancer (GC) has not been defined. This study investigates BAI's inhibitory effect on gastric cancer and its potential mechanisms. Materials and Methods: Gastric normal (GES-1 cells) and cancer cells (MKN-74 and MGC-803 cells) were treated with different concentrations of BAI. Cell proliferation and migration were assessed by MTT, colony formation, wound healing, and transwell assays. Flow cytometry and Hoechst 33342 staining were used to detect the cell apoptosis. IF and WB tests were employed to detect EMT-related protein. Finally, the anti-tumor effects of BAI were verified in in vivo xenograft models. Results: Our results show that the cell viability of MKN-74 and MGC-803 cells was significantly decreased in a time- and dose-dependent manner after BAI treatment by MTT assay. The expression levels of p12-LOX genes, which were determined by quantitative RT-PCR and WB, in MKN-74 cells were higher than those in GES-1 cells. As shown by the wound healing assay and Transwell assay, the treatment with BAI also significantly suppressed GC cell migration and invasion. Besides, BAI inhibited the phosphorylation of ERK1/2 and MEK1/2 in GC cells, as revealed by WB. Furthermore, BAI significantly inhibited tumor growth capacities in a xenograft model. Conclusion: BAI shows a significant anti-tumor effect and inhibition on tumor cell migration and invasion, which is probably through regulation of p12-LOX modulated epithelial-mesenchymal transformation. [ABSTRACT FROM AUTHOR]

Context: Asthma presents a global health challenge. The main pharmacotherapy is synthetic chemicals and biological-based drugs that are costly, and have significant side effects. In contrast, use of natural products, such as onion (Allium cepa L., Amaryllidaceae) in the treatment of airway diseases has increased world-wide because of their perceived efficacy and little safety concerns. however, their pharmacological actions remain largely uncharacterized. Objective: We investigated whether onion bulb extract (OBE) can (1) reverse established asthma phenotype (therapeutic treatment) and/or (2) prevent the development of the asthma phenotype, if given before the immunization process (preventative treatment). Materials and methods: six groups of male Balb/c mice were established for the therapeutic (21 days) and five groups for the preventative (19 days) treatment protocols; including PBs and house dust mite (HDM)-challenged mice treated with vehicle or OBe (30, 60, and 100 mg/kg/i.p.). airways inflammation was determined using cytology, histology, immunofluorescence, Western blot, and serum ige. Results: therapeutic (60 mg/kg/i.p.) and preventative (100 mg/kg/i.p.) OBE treatment resulted in down-regulation of HDM-induced airway cellular influx, histopathological changes and the increase in expression of pro-inflammatory signaling pathway EGFR, ERK1/2, AKT, pro-inflammatory cytokines and serum ige. Discussion and Conclusion: Our data show that OBe is an effective anti-inflammatory agent with both therapeutic and preventative anti-asthma effects. these findings imply that onion/OBE may be used as an adjunct therapeutic agent in established asthma and/or to prevent development of allergic asthma. however, further studies to identify the active constituents, and demonstrate proof-of-concept in humans are needed. [ABSTRACT FROM AUTHOR]

Objective(s): Non-alcoholic fatty liver disease (NAFLD) is a chronic steatohepatitis disorder. If left untreated, it can progress to hepatocellular carcinoma. Several studies have shown that saroglitazar, a PPARα/γ dual agonist, and curcumin (the principal constituent of turmeric) may be effective in the treatment of NAFLD. This research aimed to study the pharmacological mechanism of these compounds in rats with NAFLD.Materials and Methods: NAFLD was induced in male Wistar rats (aged 6–8 weeks) by feeding them a high-fat diet (HFD) for 6 weeks. Subsequently, the rats were divided into four groups, with Group 1 continuing on HFD, while groups 2, 3, and 4 received HFD supplemented with saroglitazar, curcumin, and both saroglitazar and curcumin, respectively. We evaluated the expression of Nrf2, ERK1/2, NOX1,2,4, antioxidant enzymes, PPARα, γ, and genes regulating lipid metabolism in the liver. Histopathology of liver tissue was also examined. Furthermore, we analyzed serum levels of lipid profiles and hepatic enzymes.Results: Rats with NAFLD that received treatment involving saroglitazar and curcumin showed a significant decrease in the expression of ERK1/2, SREBP1, PPARγ, pro-inflammatory cytokines, NOXs, and ROS levels. Additionally, the levels of Nrf2, PPARα, and antioxidant enzymes showed a significant increase. The serum levels of lipid profiles and hepatic enzymes also decreased significantly after drug treatment.Conclusion: Our results confirm that both saroglitazar and curcumin ameliorate NAFLD by regulating the Nrf2 and ERK1/2 signaling pathways. These findings suggest that curcumin could serve as a suitable substitute for saroglitazar, although they appear to have a synergistic effect.

Background and purpose: Herbal components, particularly sesquiterpenes, are progressively recognized as a crucial resource for developing effective therapeutic agents for breast cancer. In this study, the effect of a sesquiterpene lactone known as 8-O-dihydroxy-11a,13-dihydroeudesma-4(15)-en-12,6a-olide (persianolide- A) was examined in breast cancer cell lines. Experimental approach: MDA-MB-231 and MCF-7 cancer cells were grown in DMEM solution with 10% FBS. Then, an MTT assay was performed to evaluate cell viability. Apoptosis was detected by annexin-PI staining. A caspase 3/7 activity assay kit was used to assess the activity of caspase-3 and caspase-7. Protein expression of Bcl-2, Bax, and p-ERK1/2 was determined by western blotting. Findings/Results: This study showed that the IC50 values of the persianolide-A for MCF-7 and MDA-MB- 468 cells are 34.76 and 54.48 μM, respectively. In addition, persianolide-A showed a significant increase in apoptosis in both MDAMB-231 and MCF-7 breast cancer cell lines. Persianolide-A significantly increased the expression of the pro-apoptotic protein Bax and decreased the expression of the anti-apoptotic protein Bcl-2. Also, presinolide-A treatment led to a substantial increase in caspase activity with a ratio of 3/7 in both MCF- 7 and MDA-MB-231 cancer cells. In addition, the study showed that persianolide-A decreased the expression of p-ERK1/2 protein. Conclusion and implications: The results of this study suggest that persianolide-A, sourced from Artemisia kopetdaghensis, induces cell apoptosis in breast cancer cell types. The molecular mechanisms could be implicated in the modulation of the ERK1/2 signaling pathway.

ERK1/2 is a key protein that mediates cell signal transduction, and it is involved in regulating biological processes such as chromatin remodeling, nuclear disintegration, proliferation, survival, metabolism, and cell migration and differentiation. Its overactivation is closely related to the occurrence and progression of cancer, and the mechanism is manifested as the overactivation of ERK1/2 by gene mutations of upstream pathway molecules or regulators and the reactivation of ERK1/2 after inhibition against the above targets. ERK1/2 is a potentially valuable target. In this review, the mechanism of post-translational modification and spatial regulation of ERK1/2 and the application status of corresponding small-molecule inhibitors were discussed. The current antitumor strategy of targeting and regulating ERK1/2 was summarized, and the possibility of exploring potential targets was elucidated, thus providing new insights into the developmental research of ERK1/2 as an ideal anticancer target.

D-aspartate (D-Asp) is an amino acid found in high concentrations in the testis and pituitary gland. Increasing evidence suggests that D-Asp promotes spermatogenesis by activating testosterone production in the Leydig cells via LH release from the pituitary gland. In vitro studies indicate that D-Asp may also influence steroidogenesis and spermatogenesis through autocrine and paracrine signals. D-Asp enhances StAR and steroidogenic enzyme expressions, facilitating testicular cell proliferation via the GluR/ERK1/2 pathway. Moreover, it supports spermatogenesis by enhancing the mitochondrial function in spermatocytes, aiding in the metabolic shift during meiosis. Enhanced mitochondrial function, along with improved MAM stability and reduced ER stress, has been observed in Leydig and Sertoli cells treated with D-Asp, indicating potential benefits in steroidogenesis and spermatogenesis efficiency. Conversely, D-Asp exerts a notable anti-apoptotic effect in the testis via the AMPAR/AKT pathway, potentially mediated by antioxidant enzyme modulation to mitigate testicular oxidative stress. This review lays the groundwork for future investigations into the molecules promoting spermatogenesis by stimulating endogenous testosterone biosynthesis, with D-amino acids emerging as promising candidates. [ABSTRACT FROM AUTHOR]

The endogenous metabolite of estradiol, estradiol 17β-D-glucuronide (E17G), is considered the main responsible of the intrahepatic cholestasis of pregnancy. E17G alters the activity of canalicular transporters through a signaling pathway-dependent cellular internalization, phenomenon that was attributed to oxidative stress in different cholestatic conditions. However, there are no reports involving oxidative stress in E17G-induced cholestasis, representing this the aim of our work. Using polarized hepatocyte cultures, we showed that antioxidant compounds prevented E17G-induced Mrp2 activity alteration, being this alteration equally prevented by the NADPH oxidase (NOX) inhibitor apocynin. The model antioxidant N -acetyl-cysteine prevented, in isolated and perfused rat livers, E17G-induced impairment of bile flow and Mrp2 activity, thus confirming the participation of reactive oxygen species (ROS) in this cholestasis. In primary cultured hepatocytes, pretreatment with specific inhibitors of ERK1/2 and p38MAPK impeded E17G-induced ROS production; contrarily, NOX inhibition did not affect ERK1/2 and p38MAPK phosphorylation. Both, knockdown of p47phox by siRNA and preincubation with apocynin in sandwich-cultured rat hepatocytes significantly prevented E17G-induced internalization of Mrp2, suggesting a crucial role for NOX in this phenomenon. Concluding, E17G-induced cholestasis is partially mediated by NOX-generated ROS through internalization of canalicular transporters like Mrp2, being ERK1/2 and p38MAPK necessary for NOX activation. [Display omitted] • Estradiol 17β- d glucuronide (E17G) elevates reactive oxygen species (ROS) in hepatocytes. • ROS participate in E17G-induced internalization of canalicular Mrp2. • ERK1/2 and p38MAPK are necessary for E17G-induced, NOX-dependent elevation of ROS. • N -acetyl-cysteine prevents E17G-induced cholestasis in isolated perfused rat livers. [ABSTRACT FROM AUTHOR]

Objective(s): Non-alcoholic fatty liver disease (NAFLD) is a chronic steatohepatitis disorder. If left untreated, it can progress to hepatocellular carcinoma. Several studies have shown that saroglitazar, a PPARα/γ dual agonist, and curcumin (the principal constituent of turmeric) may be effective in the treatment of NAFLD. This research aimed to study the pharmacological mechanism of these compounds in rats with NAFLD. Materials and Methods: NAFLD was induced in male Wistar rats (aged 6-8 weeks) by feeding them a high-fat diet (HFD) for 6 weeks. Subsequently, the rats were divided into four groups, with Group 1 continuing on HFD, while groups 2, 3, and 4 received HFD supplemented with saroglitazar, curcumin, and both saroglitazar and curcumin, respectively. We evaluated the expression of Nrf2, ERK1/2, NOX1,2,4, antioxidant enzymes, PPARα, γ, and genes regulating lipid metabolism in the liver. Histopathology of liver tissue was also examined. Furthermore, we analyzed serum levels of lipid profiles and hepatic enzymes. Results: Rats with NAFLD that received treatment involving saroglitazar and curcumin showed a significant decrease in the expression of ERK1/2, SREBP1, PPARγ, pro-inflammatory cytokines, NOXs, and ROS levels. Additionally, the levels of Nrf2, PPARa, and antioxidant enzymes showed a significant increase. The serum levels of lipid profiles and hepatic enzymes also decreased significantly after drug treatment. Conclusion: Our results confirm that both saroglitazar and curcumin ameliorate NAFLD by regulating the Nrf2 and ERK1/2 signaling pathways. These findings suggest that curcumin could serve as a suitable substitute for saroglitazar, although they appear to have a synergistic effect. [ABSTRACT FROM AUTHOR]

Neuromuscular junction (NMJ) degeneration is one of pathological factors of sarcopenia. Low‐magnitude high‐frequency vibration (LMHFV) was reported effective in alleviating the sarcopenia progress. However, no previous study has investigated treatment effects of LMHFV targeting NMJ degeneration in sarcopenia. We first compared morphological differences of NMJ between sarcopenic and non‐sarcopenic subjects, as well as young and old C57BL/6 mice. We then systematically characterized the age‐related degeneration of NMJ in SAMP8 against its control strain, SAMR1 mice, from 3 to 12 months old. We also investigated effects of LMHFV in SAMP8 on the maintenance of NMJ during the onset of sarcopenia with respect to the Agrin‐LRP4‐MuSK‐Dok7 pathway and investigated the mechanism related to ERK1/2 signaling. We observed sarcopenic/old NMJ presented increased acetylcholine receptors (AChRs) cluster fragmentation and discontinuity than non‐sarcopenic/young NMJ. In SAMP8, NMJ degeneration (morphologically at 6 months and functionally at 8 months) was observed associated with the sarcopenia onset (10 months). SAMR1 showed improved NMJ morphology and function compared with SAMP8 at 10 months. Skeletal muscle performance was improved at Month 4 post‐LMHFV treatment. Vibration group presented improved NMJ function at Months 2 and 6 posttreatment, accompanied with alleviated morphological degeneration at Month 4 posttreatment. LMHFV increased Dok7 expression at Month 4 posttreatment. In vitro, LMHFV could promote AChRs clustering in myotubes by increasing Dok7 expression through suppressing ERK1/2 phosphorylation. In conclusion, NMJ degeneration was observed associated with the sarcopenia onset in SAMP8. LMHFV may attenuate NMJ degeneration and sarcopenia progression by increasing Dok7 expression through suppressing ERK1/2 phosphorylation. [ABSTRACT FROM AUTHOR]

Noise-induced hearing loss (NIHL) is a major cause of hearing impairment and is linked to dementia and mental health conditions, yet no FDA-approved drugs exist to prevent it. Downregulating the mitogen-activated protein kinase (MAPK) cellular pathway has emerged as a promising approach to attenuate NIHL, but the molecular targets and the mechanism of protection are not fully understood. Here, we tested specifically the role of the kinases ERK1/2 in noise otoprotection using a newly developed, highly specific ERK1/2 inhibitor, tizaterkib, in preclinical animal models. Tizaterkib is currently being tested in phase 1 clinical trials for cancer treatment and has high oral bioavailability and low predicted systemic toxicity in mice and humans. In this study, we performed dose–response measurements of tizaterkib's efficacy against permanent NIHL in adult FVB/NJ mice, and its minimum effective dose (0.5 mg/kg/bw), therapeutic index (>50), and window of opportunity (<48 h) were determined. The drug, administered orally twice daily for 3 days, 24 h after 2 h of 100 dB or 106 dB SPL noise exposure, at a dose equivalent to what is prescribed currently for humans in clinical trials, conferred an average protection of 20–25 dB SPL in both female and male mice. The drug shielded mice from the noise-induced synaptic damage which occurs following loud noise exposure. Equally interesting, tizaterkib was shown to decrease the number of CD45- and CD68-positive immune cells in the mouse cochlea following noise exposure. This study suggests that repurposing tizaterkib and the ERK1/2 kinases' inhibition could be a promising strategy for the treatment of NIHL. [ABSTRACT FROM AUTHOR]

Introduction: Osteoarthritis (OA) is an inflammatory disorder of synovial joints which is mainly treated with therapeutic agents showing side effects associated with the gastrointestinal (GI) and metabolic system. Consequently, there is urgent need for a potent, safe and novel agent for treating OA and related disorders. Enoxolone is a pentacyclic triterpenoid obtained from the herb liquorice. Based on earlier findings, we postulated that enoxolone may produce chondroprotective activity by exerting anti-inflammatory, anti-catabolic and oxidative stress-decreasing effects. Material and methods: The chondrocytes were extracted from the femoral head articular cartilage of healthy rats. Immunofluorescence staining was done for identification of chondrocytes. Cell viability and proliferation studies were done using Cell Counting Kit-8. Apoptotic cells were identified by TUNEL assay and flow cytometry analysis. Autophagy was assessed by monodansylcadaverine assay. Western blot analysis was done for expression of proteins. Results: In the present study we investigated the protective effect of enoxolone on interleukin 1β (IL-1β) treated Iry chondrocytes in vitro. Treatment with IL-1β resulted in a significant reduction in cell viability of cells in increasing dose and time. Treatment with enoxolone along with IL-1β caused a significant decrease in growth inhibition. Also, enoxolone inhibited the IL-1β mediated apoptosis and activation of caspase-3 in cells. We also observed that enoxolone elevated the levels of p-ERK1/2, light chain 3 (LC3)-II and Beclin-1 (autophagy markers) in chondrocytes. The expression of (LC3)-II and Beclin-1 was decreased when the cells were treated with U0126 (ERK1/2 inhibitor). Conclusions: Our findings demonstrate that enoxolone could suppress inflammatory signaling and apoptosis via the ERK1/2 pathway in chondrocytes. [ABSTRACT FROM AUTHOR]

ERK1/2 is a key protein that mediates cell signal transduction, and it is involved in regulating biological processes such as chromatin remodeling, nuclear disintegration, proliferation, survival, metabolism, and cell migration and differentiation. Its overactivation is closely related to the occurrence and progression of cancer, and the mechanism is manifested as the overactivation of ERK1/2 by gene mutations of upstream pathway molecules or regulators and the reactivation of ERK1/2 after inhibition against the above targets. ERK1/2 is a potentially valuable target. In this review, the mechanism of post-translational modification and spatial regulation of ERK1/2 and the application status of corresponding small-molecule inhibitors were discussed. The current antitumor strategy of targeting and regulating ERK1/2 was summarized, and the possibility of exploring potential targets was elucidated, thus providing new insights into the developmental research of ERK1/2 as an ideal anticancer target. [ABSTRACT FROM AUTHOR]

Recently, epidermal growth factor-like domain protein 6 (EGFL6) was proposed as a candidate gene for coupling angiogenesis to osteogenesis during bone repair; however, the exact role and underlying mechanism are largely unknown. Here, using immunohistochemical and Western blotting analyses, we found that EGFL6 was downregulated in the femoral head tissue of patients with steroid-induced osteonecrosis of the femoral head (SONFH) compared to patients with traumatic femoral neck fracture (FNF), accompanied by significantly downregulation of osteogenic and angiogenic marker genes. Then, bone marrow mesenchymal stem cells (BMSCs) were isolated from the FNF and the SONFH patients, respectively, and after identification by immunofluorescence staining surface markers, the effect of EGFL6 on their abilities of osteogenic differentiation and angiogenesis was evaluated. Our results of alizarin red staining and tubular formation experiment revealed that BMSCs from the SONFH patients (SONFH-BMSCs) displayed an obviously weaker ability of osteogenesis than FNF-BMSCs, and EGFL6 overexpression improved the abilities of osteogenic differentiation and angiogenesis of SONFH-BMSCs. Moreover, EGFL6 overexpression activated extracellular signal-regulated kinases 1/2 (ERK1/2). ERK1/2 inhibitor U0126 reversed the promoting effect of EGFL6 overexpression on the expression of osteogenesis and angiogenesis-related genes in the SONFH femoral head. In conclusion, EGFL6 plays a protective role in SONFH, it promotes osteogenesis and angiogenesis of BMSCs, and its effect is likely to be related to ERK1/2 activation. [ABSTRACT FROM AUTHOR]

The role of peroxisome proliferator-activated receptor (PPAR)β/δ in hepatic fibrosis remains a subject of debate. Here, we examined the effects of a PPARβ/δ agonist on the pathogenesis of liver fibrosis and the activation of hepatic stellate cells (HSCs), the main effector cells in liver fibrosis, in response to the pro-fibrotic stimulus transforming growth factor-β (TGF-β). The PPARβ/δ agonist GW501516 completely prevented glucose intolerance and peripheral insulin resistance, blocked the accumulation of collagen in the liver, and attenuated the expression of inflammatory and fibrogenic genes in mice fed a choline-deficient high-fat diet (CD-HFD). The antifibrogenic effect of GW501516 observed in the livers CD-HFD-fed mice could occur through an action on HSCs since primary HSCs isolated from Ppard-/- mice showed increased mRNA levels of the profibrotic gene Col1a1. Moreover, PPARβ/δ activation abrogated TGF-β1-mediated cell migration (an indicator of cell activation) in LX-2 cells (immortalized activated human HSCs). Likewise, GW501516 attenuated the phosphorylation of the main downstream intracellular protein target of TGF-β1, suppressor of mothers against decapentaplegic (SMAD)3, as well as the levels of the SMAD3 co-activator p300 via the activation of AMP-activated protein kinase (AMPK) and the subsequent inhibition of extracellular signal-regulated kinase-1/2 (ERK1/2) in LX-2 cells. Overall, these findings uncover a new mechanism by which the activation of AMPK by a PPARβ/δ agonist reduces TGF-β1-mediated activation of HSCs and fibrosis via the reduction of both SMAD3 phosphorylation and p300 levels.

ABSTRACTThyroid cancer is one of the deadliest endocrine cancers, and its incidence has been increasing. While mutations in BRAF are common in thyroid cancer, advanced PTC patients currently lack therapeutic options targeting the MAPK pathway, and despite the approved combination of BRAF and MEK1/2 inhibition for BRAF-mutant ATC, resistance often occurs. Here, we assess growth and signaling responses to combined BRAF and MEK1/2 inhibition in a panel of BRAF-mutant thyroid cancer cell lines. We first showed that combined BRAF and MEK1/2 inhibition synergistically inhibits cell growth in four out of six of the ­BRAF-mutant thyroid cancer cell lines tested. Western blotting showed that the MAPK pathway was robustly inhibited in all cell lines. Therefore, to identify potential mechanisms of resistance, we performed RNA-sequencing in cells sensitive or resistant to MEK1/2 inhibition. In response to MEK1/2 inhibition, we identified a downregulation of Aurora Kinase B (AURKB) in sensitive but not resistant cells. We further demonstrated that combined MEK1/2 and AURKB inhibition slowed cell growth, which was phenocopied by inhibiting AURKB and ERK1/2. Finally, we show that combined AURKB and ERK1/2 inhibition induces apoptosis in BRAF-mutant thyroid cancer cell lines, together suggesting a potential combination therapy for BRAF-mutant thyroid cancer patients.

Relapse to alcohol abuse, often caused by cue-induced alcohol craving, is a major challenge in alcohol addiction treatment. Therefore, disrupting the cue-alcohol memories can suppress relapse. Upon retrieval, memories transiently destabilize before they reconsolidate in a process that requires protein synthesis. Evidence suggests that the mammalian target of rapamycin complex 1 (mTORC1), governing the translation of a subset of dendritic proteins, is crucial for memory reconsolidation. Here, we explored the involvement of two regulatory pathways of mTORC1, phosphoinositide 3-kinase (PI3K)-AKT and extracellular regulated kinase 1/2 (ERK1/2), in the reconsolidation process in a rat (Wistar) model of alcohol self-administration. We found that retrieval of alcohol memories using an odor-taste cue increased ERK1/2 activation in the amygdala, while the PI3K-AKT pathway remained unaffected. Importantly, ERK1/2 inhibition after alcohol memory retrieval impaired alcohol-memory reconsolidation and led to long-lasting relapse suppression. Attenuation of relapse was also induced by post-retrieval administration of lacosamide, an inhibitor of collapsin response mediator protein-2 (CRMP2)—a translational product of mTORC1. Together, our findings indicate the crucial role of ERK1/2 and CRMP2 in the reconsolidation of alcohol memories, with their inhibition as potential treatment targets for relapse prevention. [ABSTRACT FROM AUTHOR]

According to the latest evidence, the microbial metabolite Urolithin A (UA), known for its role in promoting cellular health, modulates CD8+ T cell‐mediated antitumor activity. However, the direct target protein of UA and its underlying mechanism remains unclear. Here, this research identifies ERK1/2 as the specific target crucial for UA‐mediated CD8+ T cell activation. Even at low doses, UA markedly enhances the persistence and effector functions of primary CD8+ cytotoxic T lymphocytes (CTLs) and human chimeric antigen receptor (CAR) T cells both in vitro and in vivo. Mechanistically, UA interacts directly with ERK1/2 kinases, enhancing their activation and subsequently facilitating T cell activation by engaging ULK1. The UA‐ERK1/2‐ULK1 axis promotes autophagic flux in CD8+ CTLs, enhancing cellular metabolism and maintaining reactive oxygen species (ROS) levels, as evidenced by increased oxygen consumption and extracellular acidification rates. UA‐treated CD8+ CTLs also display elevated ATP levels and enhanced spare respiratory capacity. Overall, UA activates ERK1/2, inducing autophagy and metabolic adaptation, showcasing its potential in tumor immunotherapy and interventions for diseases involving ERKs. [ABSTRACT FROM AUTHOR]

Ligusticum chuanxiong Hort (LC) is used in traditional medicine throughout Southeast Asia as a cardiovascular protective herb, antioxidant, vasorelaxant, and anti-inflammatory. To demonstrate the protective mechanisms of LC on hypoxia/reoxygenation (HR) induced injury in H9c2 cardiomyoblasts, intracellular reactive oxygen species (ROS) content was measured using dichlorodihydrofluorescein diacetate. The cardioprotective effects of LC ethanolic (E) and water (W) extracts were measured by the MTT assay. Changes in cell and nuclear morphology were observed under a phase-contrast and a fluorescent microscope. The mitochondrial membrane potential (MMP) was detected by Rhodamine123 staining. The expressions of pERK1/2, ERK1/2, and Bcl-2 were determined by immunoblotting. LCE and LCW extracts caused no cytotoxicity or ROS generation to H9c2 cardiomyoblasts. The incubation of LCE or LCW during hypoxia increased cell survival (p < 0.05) compared to HR without the extracts. HR-induced cells demonstrated cellular atrophy, cell membrane shrinkage, and DNA condensation. Healthy cells were found in the control, LCE and LCW-treated HR-induced cells. LC restored the reduction of MMP, while LCE and LCW increased the pERK/ERK ratio (p < 0.001). Meanwhile, LCW increased Bcl-2 expression (p < 0.05). LC extracts effectively protected H9c2 cardiomyoblasts from injury caused by HR exposure, suggesting a beneficial use of LC in alleviating damaged cardiomyoblasts from acute ischemia. [ABSTRACT FROM AUTHOR]

Objective To investigate the impact of TRIM48 overexpression on glioma and explore the underlying mechanism. Methods Twelve nude mice were randomly assigned into two groups: one inoculated with U87 glioma cells stably overexpressing TRIM48 (oeTRIM48 group) and the other with the control cell line (Vector group). Tumor volume was measured every 3 days post-inoculation, and after 4 weeks, the tumors were excised and weighed. Tumor tissues underwent hematoxylin and eosin (H&E) staining, and Ki-67 expression was assessed using immunofluorescence. Additionally, the expressions of TRIM48, ERK1/2, and phosphorylated ERK1/2 (p-ERK1/2) in the tumors of nude mice and human glioma tissue arrays were analyzed through Western blot and immunohistochemistry respectively. Results Compared to the Vector group, the oeTRIM48 group exhibited significantly reduced tumor volume and weight (P < 0.0001). H&E staining indicated a decrease in nuclei and mitotic count in the oeTRIM48 group. Furthermore, Ki-67 expression was significantly lower in the oeTRIM48 group than that in the Vector group (P < 0.0001). The oeTRIM48 group also showed a significantly lower expression of p-ERK1/2 protein compared to the Vector group (P < 0.01). Immunohistochemistry on tissue microarrays revealed the high expression of TRIM48 and low expression of p-ERK1/2 in adjacent non-tumoral tissues, with the opposite pattern observed in tumor tissues. Conclusion Overexpression of TRIM48 inhibits the growth and proliferation of glioma, potentially through modulation of the ERK1/2 signaling pathway. [ABSTRACT FROM AUTHOR]

HLA-DR-positive NK cells, found in both healthy individuals and patients with different inflammatory diseases, are characterized as activated cells. However, data on their capacity for IFNγ production or cytotoxic response vary between studies. Thus, more precise investigation is needed of the mechanisms related to the induction of HLA-DR expression in NK cells, their associations with NK cell differentiation stage, and functional or metabolic state. In this work, HLA-DR-expressing NK cell subsets were investigated using transcriptomic analysis, metabolic activity assays, and analysis of intercellular signaling cascades. We demonstrated that HLA-DR+CD56bright NK cells were characterized by a proliferative phenotype, while HLA-DR+CD56dim NK cells exhibited features of adaptive cells and loss of inhibitory receptors with increased expression of MHC class II trans-activator CIITA. The activated state of HLA-DR-expressing NK cells was confirmed by higher levels of ATP and mitochondrial mass observed in this subset compared to HLA-DR− cells, both ex vivo and after stimulation in culture. We showed that HLA-DR expression in NK cells in vitro can be induced both through stimulation by exogenous IL-2 and IL-21, as well as through auto-stimulation by NK-cell-produced IFNγ. At the intracellular level, HLA-DR expression depended on the activation of STAT3- and ERK1/2-mediated pathways, with subsequent activation of isoform 3 of the transcription factor CIITA. The obtained results broaden the knowledge about HLA-DR-positive NK cell appearance, diversity, and functions, which might be useful in terms of understanding the role of this subset in innate immunity and assessing their possible implications in NK cell-based therapy. [ABSTRACT FROM AUTHOR]

Cornulin (CRNN) and repetin (RPTN) belong to the fused‐type S100 protein family. Although these proteins have been reported to be expressed in the granular layer of the epidermis and have been suggested to be associated with barrier formation in the epidermis, their exact function remains unclear. This study examined the effects of ultraviolet B (UVB) irradiation on CRNN and RPTN expression in human skin xenotransplantation. The CRNN expression increased in the granular layer of UVB‐irradiated skin 2 days after UVB irradiation compared to that in sham‐irradiated skin. Interestingly, CRNN signals were observed not only in the cytoplasm, but also in the peripheral regions of granular keratinocytes. In contrast, RPTN was rarely expressed in sham‐irradiated skin; however, RPTN signals were markedly increased in the granular layer of the UVB‐irradiated skin. In addition, activation of ERK1/2 and STAT3 was observed in UVB‐irradiated skin. Accordingly, the present study demonstrated that CRNN and RPTN are novel proteins whose expression can be increased by UVB irradiation. The activation of ERK1/2 and STAT3 may be associated with the regeneration of a UVB‐damaged epidermis, and CRNN and RPTN may be induced to repair any dysfunction in the epidermal barrier during this regeneration process. [ABSTRACT FROM AUTHOR]

TG‐interacting factor 1 (TGIF1) contributes to the differentiation of murine white preadipocyte and human adipose tissue‐derived stem cells; however, its regulation is not well elucidated. Insulin is a component of the adipogenic cocktail that induces ERK signaling. TGIF1 phosphorylation and sustained stability in response to insulin were reduced through the use of specific MEK inhibitor U0126. Mutagenesis at T235 or T239 residue of TGIF1 in preadipocytes led to dephosphorylation of TGIF1. The reduced TGIF1 stability resulted in an increase in p27kip1 expression, a decrease in phosphorylated Rb expression and cellular proliferation, and a reduced accumulation of lipids compared to the TGIF1‐overexpressed cells. These findings highlight that insulin/ERK‐driven phosphorylation of the T235 or T239 residue at TGIF1 is crucial for adipocyte differentiation. [ABSTRACT FROM AUTHOR]

ADP-ribosylation plays a significant role in various biological processes including genomic stability maintenance, transcriptional regulation, energy metabolism, and cell death. Using macrodomain pull-down assay with microglia lysates and MALDI-TOF-MS analysis, we identified vimentin as a major protein highly ADP-ribosylated by the poly(ADP-ribose) polymerases-1 (PARP-1) in response to LPS. ABT-888, a potent inhibitor of PARP-1/2 blocks the disassembly and ADP-ribosylation of vimentin. PARP-1 is a highly abundant nuclear protein. Its nuclear functions in repairing DNA damages induced by various stress signals, such as inflammatory stresses, have been well studied. In contrast, limited studies have been done on the cytoplasmic role(s) of PARP-1. Our study focuses on the cytoplasmic role of PARP-1 during microglia activation. Using immunofluorescence microscopy and Western blotting, we showed that a significant amount of PARP-1 is present in the cytosol of microglia cells stimulated and activated by LPS. Live cell imaging showed the translocation of nuclear PARP-1-EGFP to the cytoplasm in vesicular structures upon LPS stimulation. ABT-888 and U0126 can block this translocation. Immunofluorescence staining with various organelle marker antibodies revealed that PARP-1 vesicles show colocalization with Lamin A/C, suggesting they might be derived from the nuclear envelope through nuclear envelope budding. In conclusion, we demonstrated that PARP-1 is translocated from the nucleus to cytoplasm via vesicles upon LPS stimulation and that cytoplasmic PARP-1 causes ADP-ribosylation and disassembly of vimentin filaments during microglia activation induced by LPS. [ABSTRACT FROM AUTHOR]

Rotavirus (RV) is the main pathogen that causes severe diarrhea in infants and children under 5 years of age. No specific antiviral therapies or licensed anti-rotavirus drugs are available. It is crucial to develop effective and low-toxicity anti-rotavirus small-molecule drugs that act on novel host targets. In this study, a new anti-rotavirus compound was selected by ELISA, and cell activity was detected from 453 small-molecule compounds. The anti-RV effects and underlying mechanisms of the screened compounds were explored. In vitro experimental results showed that the small-molecule compound ML241 has a good effect on inhibiting rotavirus proliferation and has low cytotoxicity during the virus adsorption, cell entry, and replication stages. In addition to its in vitro effects, ML241 also exerted anti-RV effects in a suckling mouse model. Transcriptome sequencing was performed after adding ML241 to cells infected with RV. The results showed that ML241 inhibited the phosphorylation of ERK1/2 in the MAPK signaling pathway, thereby inhibiting IκBα, activating the NF-κB signaling pathway, and playing an anti-RV role. These results provide an experimental basis for specific anti-RV small-molecule compounds or compound combinations, which is beneficial for the development of anti-RV drugs. [ABSTRACT FROM AUTHOR]

Ulcerative colitis (UC) is a chronic disorder of the large intestine with inflammation and ulceration. The incidence and prevalence of UC have been rapidly increasing worldwide, but its etiology remains unknown. In patients with UC, the accumulation of eosinophils in the large intestinal mucosa is associated with increased disease activity. However, the molecular mechanism underlying the promotion of intestinal eosinophilia in patients with UC remains poorly understood. Here, we show that uridine diphosphate (UDP)-glucose mediates the eosinophil-dependent promotion of colonic inflammation via the purinergic receptor P2Y14. The expression of P2RY14 mRNA was upregulated in the large intestinal mucosa of patients with UC. The P2Y14 receptor ligand UDP-glucose was increased in the large intestinal tissue of mice administered dextran sodium sulfate (DSS). In addition, P2ry14 deficiency and P2Y14 receptor blockade mitigated DSS-induced colitis. Among the large intestinal immune cells and epithelial cells, eosinophils highly expressed P2ry14 mRNA. P2ry14 −/− mice transplanted with wild-type bone marrow eosinophils developed more severe DSS-induced colitis compared with P2ry14 −/− mice that received P2ry14 -deficient eosinophils. UDP-glucose prolonged the lifespan of eosinophils and promoted gene transcription in the cells through P2Y14 receptor-mediated activation of ERK1/2 signaling. Thus, the UDP-glucose/P2Y14 receptor axis aggravates large intestinal inflammation by accelerating the accumulation and activation of eosinophils. [ABSTRACT FROM AUTHOR]

To study the molecular mechanisms responsible for fibrosis in endometriosis by investigating whether the protein expression levels of sphingosine-1-phosphate receptor 3 (S1PR3), one of the five specific receptors of the bioactive sphingolipid sphingosine-1-phosphate (S1P), correlate with fibrosis extent in endometriotic lesions and which are the cellular mechanisms involved in this process. Case-control laboratory study and cultured endometriotic cells. University research institute and university hospital. A total of 33 women, with and without endometriosis, were included in the study. Endometriotic lesions were obtained from women with endometriosis (ovarian endometrioma, n = 8; deep infiltrating endometriosis, n = 15; [urological n = 5, gastrointestinal n = 6, and posterior n = 4]) and control endometrium from healthy women, n = 10, by means of laparoscopic and hysteroscopic surgery. The expression of S1PR3 was evaluated using immunohistochemistry and the extent of fibrosis was assessed using Masson's trichrome staining. Human-cultured epithelial endometriotic 12Z cells were used to evaluate the mechanisms involved in the profibrotic effect of S1PR3 activation. The expression of S1PR3 in endometriotic lesions is positively correlated with endometriosis-associated fibrosis. In addition, S1P induced epithelial-mesenchymal transition (EMT) and fibrosis in epithelial endometriotic cells. Using RNA interference and pharmacological approaches, the profibrotic effect of S1P was shown to rely on S1PR3, thus unveiling the molecular mechanism implicated in the profibrotic action of the bioactive sphingolipid. The protein expression levels of S1PR3 were significantly augmented in the glandular sections of endometrioma and deep infiltrating endometriosis of different localizations with respect to the control endometrium and positively correlated with the extent of fibrosis. Sphingosine-1-phosphate was shown to have a crucial role in the onset of fibrosis in epithelial endometriotic cells, stimulating the expression of EMT and fibrotic markers. Genetic approaches have highlighted that S1PR3 mediates the fibrotic effect of S1P. Downstream of S1PR3, ezrin and extracellular-signal-regulated kinases 1 and 2 signaling were found to be critically implicated in the EMT and fibrosis elicited by S1P. Sphingosine-1-phosphate receptor 3 may represent a possible innovative pharmacological target for endometriosis. [ABSTRACT FROM AUTHOR]

The promotion of early osseointegration is crucial for the success of biomedical titanium implants. Physical and chemical modifications to the material surface can significantly compensate for the lack of biocompatibility and early osseointegration of the implant. In this study, we implanted strontium onto titanium plates and analyzed the effect of strontium-doped materials on angiogenesis and biocompatibility in the human bone structure. Our findings demonstrated that strontium-loaded titanium sheet materials effectively promote human umbilical vein endothelial cell (HUVEC) biocompatibility and vascular differentiation ability, as evidenced by proliferation-apoptosis assays, RT-qPCR for vascular neogenesis markers, ELISA for vascular endothelial growth factor (VEGF) levels, and nitric oxide (NO) analysis. Mechanism studies based on RNAseq and Western blotting analysis revealed that strontium can promote titanium material biocompatibility with HUVEC cells and vascular neovascularization ability by activating the extracellular signal-regulated kinase 1/2 (ERK1/2) signaling pathway. Meanwhile, blocking the ERK1/2 signaling pathway could reverse the promotional effect of vascular formation. Overall, we have successfully fabricated a multifunctional biocompatible bone implant with better histocompatibility and angiogenesis compared to uncoated implants. [ABSTRACT FROM AUTHOR]

Background: Dynamin-related protein Drp1 --a major mitochondrial fission protein-- is widely distributed in the central nervous system and plays a crucial role in regulating mitochondrial dynamics, specifically mitochondrial fission and the organelle's shaping. Upregulated Drp1 function may contribute to the pathological progression of neurodegenerative diseases by dysregulating mitochondrial fission/fusion. The study aims to investigate the effects of Drp1 on retinoic acid-BDNF-induced (RA-BDNF) neuronal differentiation and mitochondrial network reorganization in SH-SY5Y neuroblastoma cells. Methods: We generated an SH-SY5Y cell line with stably depleted Drp1 (shDrp1). We applied RNA sequencing and analysis to study changes in gene expression upon stable Drp1 knockdown. We visualized the mitochondria by transmission electron microscopy and used high-content confocal imaging to characterize and analyze cell morphology changes and mitochondrial network reorganization during neuronal differentiation. Results: shDrp1 cells exhibited fused mitochondrial ultrastructure with perinuclear clustering. Stable knockdown of Drp1 resulted in the upregulation of genes involved in nervous system development. High content analysis showed improved neurite outgrowth, segmentation, and extremities in differentiated shDrp1 cells. Neuronal differentiation was associated with a significant reduction in ERK1/2 phosphorylation, and ERK1/2 phosphorylation was independent of the dual specificity phosphatases DUSP1/6 in shDrp1 cells. Differentiated control underwent mitochondrial morphology remodeling, whereas differentiated shDrp1 cells retained the highly fused mitochondria and developed long, elongated structures. The shDrp1 cells responded to specific apoptotic stimuli like control in vitro, suggesting that Drp1 is not a prerequisite for apoptosis in SH-SY5Y cells. Moreover, Drp1 downregulation reduced the formation of toxic mHtt aggregates in vitro. Discussion: Our results indicate that Drp1 silencing enhances RA-BDNF-induced neuronal differentiation by promoting transcriptional and mitochondrial network changes in undifferentiated cells. We also demonstrate that the suppression of Drp1 reduces toxic mHtt aggregate formation in vitro, suggesting protection against neurotoxicity. Thus, Drp1 may be an attractive target for further investigation in future strategies to combat neurodegenerative diseases. [ABSTRACT FROM AUTHOR]

NK cells play a decisive role in controlling hCMV infection by combining innate and adaptive-like immune reactions. The hCMV-derived VMAPRTLFL (LFL) peptide is a potent activator of NKG2C+ NK cells. Proposed here is an autologous system of LFL stimulation without T lymphocytes and exogenous cytokines that allows us to evaluate NK-cell hCMV-specific responses in more native settings. In this model, we evaluated LFL-induced IFNγ production, focusing on signaling pathways and the degranulation and proliferation of NK cells orchestrated by microenvironment cytokine production and analyzed the transcriptome of expanded NK cells. NK cells of individuals having high anti-hCMV-IgG levels, in contrast to NK cells of hCMV-seronegative and low-positive donors, displayed increased IFNγ production and degranulation and activation levels and enhanced proliferation upon LFL stimulation. Cytokine profiles of these LFL-stimulated cultures demonstrated a proinflammatory shift. LFL-induced NK-cell IFNγ production was dependent on the PI3K and Ras/Raf/Mek signaling pathways, independently of cytokines. In hCMV-seropositive individuals, this model allowed obtaining NK-cell antigen-specific populations proliferating in response to LFL. The transcriptomic profile of these expanded NK cells showed increased adaptive gene expression and metabolic activation. The results complement the existing knowledge about hCMV-specific NK-cell response. This model may be further exploited for the identification and characterization of antigen-specific NK cells. [ABSTRACT FROM AUTHOR]

Introduction: Eosinophils contribute to the pathogenesis of allergic diseases, including asthma, allergic rhinitis, and atopic dermatitis. We previously reported that human tissue eosinophils have high CD69 expression compared to blood eosinophils, and its expression is correlated with disease severity and the number of infiltrated eosinophils. However, biological CD69 signaling activity in eosinophils remains unclear. Methods: CD69 expression on lung tissue eosinophils obtained from mice with ovalbumin-induced asthma was measured using flow cytometry. CD69 crosslinking was performed on eosinophils purified from the spleen of IL-5 transgenic mice to investigate CD69 signaling and its function in eosinophils. Then, qPCR, Western blot, enzyme-linked immunosorbent assay, and survival assay results were analyzed. Results: Surface CD69 expression on lung tissue eosinophils in the asthma mice model was 2.91% ± 0.76%, whereas no expression was detected in the healthy group. CD69-expressed eosinophils intrinsically have an upregulation of IL-10 mRNA expression. Moreover, CD69 crosslinking induced further pronounced IL-10 production and apoptosis; these responses were mediated via the Erk1/2 and JNK pathways, respectively. Conclusions: Our results suggested that CD69+ eosinophils play an immunoregulator role in type 2 inflammation, whereas activated tissue eosinophils contribute to the pathogenesis of asthma. [ABSTRACT FROM AUTHOR]