Search

International audience; Cucurbit-infecting tobamoviruses known so far belong to six acknowledged or tentative species. Except for cucumber green mottle mosaic virus (CGMMV), which is present worldwide, they are geographically restricted, mostly to Asia, and have not been observed in Africa so far. A tobamovirus isolate infecting a wild Coccinia grandis plant was collected in central Sudan in 2012. Its host range appeared to be mostly limited to cucurbits. Its full-length genome sequence was determined and found to be 85% identical to those of isolates of cucumber fruit mottle mosaic virus (CFMMV) described in Israel and Korea, whereas the aa sequence identity to CFMMV isolates was 92 to 95%, depending on the protein. Based on its biological and molecular properties, we suggest that the Sudanese isolate should be considered a divergent isolate of CFMMV. This is the first description of CFMMV in Africa. Its high divergence from isolates from Israel and Korea suggests a lack of recent exchanges between CFMMV from Sudan and the other known populations.

In summer 2009, a survey for virus diseases in cucurbits was conducted in open fields and plastichouses in Khartoum State, the most important growing area for cucurbits in Sudan. Chlorosis and yellowing symptoms on middle and lower leaves were observed on many muskmelon (Cucumis melo L.) plants grown in open fields in the Assilat agricultural scheme and on approximately 80% of the cucumber (Cucumis sativus L.) plants grown in plastichouses in Khartoum North. Large populations of whiteflies (Bemisia tabaci L.) were present in both locations. Leaf symptoms that were observed were similar to those caused by Cucurbit chlorotic yellows virus (CCYV), a recently described new Crinivirus species infecting cucurbits in Japan (4), indicating presence of this virus previously only reported from Japan, Taiwan (2), and China (1). Samples from seven symptomatic muskmelon leaves were collected from individual plants grown in different open fields in Assilat and from a symptomatic cucumber plant grown in a plastichouse. Total RNA was extracted from these samples with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) to amplify putative CCYV sequences with primers (Crini-s2 5′-CATTCCTACCTGTTTAGCCA and Crini-as2 5′-TGCACTTATAATCTGCTGGTAC) designed from CCYV sequences available at GenBank. A 353-bp DNA fragment of the HSP70 gene was amplified by reverse transcription (RT)-PCR for all samples. Further analysis by direct sequencing of two PCR products showed 99 to 100% nt sequence identity to Asian CCYV isolates. Amplification of the coat protein sequence with the primer pair (CCYV-CPs 5′-ATGGAGAAGACTGACAATAAACAA and CCYV-CPas 5′-TTTACTACAACCTCCCGGTG) followed by cloning and sequencing yielded a 760-bp fragment having 99% nucleotide sequence identity to all Asian isolates. For confirmation, dsRNA preparations of symptomatic muskmelon tissue (collected in June 2010) were made, showing dsRNA patterns typical for criniviruses after separation on agarose gels. This dsRNA was used as template for random RT-PCR followed by sequencing of the cloned PCR products (3). Comparison with sequences available at GenBank revealed that cDNA sequences from dsRNA also were 99 to 100% identical to the CCYV genome sequence (AB523788.1). Whitefly transmission of the virus was confirmed by giving a population of B. tabaci an acquisition access period of 24 h and a further 24 h on muskmelon and cucumber seedlings. Symptoms were observed after 5 to 7 days, and the presence of CCYV was confirmed by RT-PCR. In conclusion, symptoms, RT-PCR, and dsRNA sequencing results confirm the presence and establishment of CCYV in cucurbit crops in Sudan. It is remarkable that the sequences obtained from the Sudanese samples show only negligible sequence differences from Asian isolates. Because of the large whitefly vector populations, the spread of CCYV to neighboring countries in Africa and potentially southern Europe, or wherever cucurbits are grown, can be expected. To our knowledge, this is the first report of CCYV in Sudan and outside Eastern Asia. The sequences obtained in this study have been submitted to GenBank under Accession Nos. JF807053 to JF807055. References: (1) Q. S. Gu et al. Plant Dis. 95:73, 2011. (2) L. H. Huang et al. Plant Dis. 94:1168, 2010. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Cucumber vein yellowing virus (CVYV) is emerging throughout the Mediterranean Basin, where it causes important damages on cucumber and melon crops. It has been suggested that CVYV originated from the Middle East and has spread only recently to other areas. In this work, an isolate from Sudan was characterized and surveys performed in that country between 1992 and 2012 revealed a long‐term presence of CVYV with a high molecular variability, showing that the virus has long been endemic in Sub‐Saharan Africa. Comparison of the full‐length sequences of 11 CVYV isolates from different geographic origins revealed recombination events in CVYV populations from the Mediterranean Basin and the Middle East, and evidence for different selection pressures along the genome. These results shed a new light on the evolution of CVYV.

paper originating from a presentation made at the 13th International Plant Virus Epidemiology Symposium held at Avignon, France June 6-10, 2016; The “Papaya ringspot virus (PRSV) cluster” of cucurbit-infecting potyviruses contains five acknowledged species that have similar biological, serological and molecular properties. Additional data suggest there are other uncharacterized species from various locations in the world that likely belong to the PRSV cluster including a new PRSV-like virus reported from Sudan in 2003. Molecular and biological data indicated that the virus from Sudan belongs to a new species, tentatively named wild melon vein banding virus (WMVBV). The complete nucleotide sequence of a second virus from Sudan revealed it was a divergent relative of Moroccan watermelon mosaic virus (MWMV). Based on sequence similarity this virus was determined to be a distinct species and tentatively named Sudan watermelon mosaic virus (SuWMV). Molecular analyses indicate that SuWMV is a recombinant between WMVBV- and MWMV-related viruses. Based on surveys performed in Sudan between 1992 and 2012, SuWMV appeared 10 times more frequent than WMVBV in that country (14.6% vs. 1.5% of the samples tested). The geographic structure and molecular diversity patterns of the putative and acknowledged species suggest that the PRSV-like cluster originated in the Old World about 3600 years ago, with an important diversification in Africa.

International audience; Two members of the genus Ipomovirus (family Potyviridae) are known to infect cucurbits: cucumber vein yellowing virus (CVYV), which is emerging throughout the Mediterranean Basin, and squash vein yellowing virus (SqVYV), which has been described in America and the Caribbean Basin, and more recently in Israel. In this work, an ipomovirus different from CVYV and SqVYV, tentatively named coccinia mottle virus (CocMoV), was detected in a sample of the cucurbit Coccinia grandis collected in central Sudan in 2012. Sequence identity in nt was 68 % with CVYV, 59-60 % with SqVYV, cassava brown streak virus and Ugandan cassava brown streak virus, and less than 50 % with other members of the family Potyviridae. Preliminary biological and epidemiological studies indicate that CocMoV has a narrow natural host range and a low prevalence.

During a survey conducted in Sudan in 2012, a virus with spherical particles was isolated from a squash plant showing chlorotic leaf spots. The virus was transmitted mechanically and by two whitefly species, but not by aphids. RT-PCR with generic torradovirus primers yielded a band of expected size from total RNA of a symptomatic plant. Next-generation sequencing confirmed that this is tentatively a new torradovirus, for which we propose the name 'squash chlorotic leaf spot virus'. Using specific RT-PCR primers, the virus was detected in cucurbit samples collected since 1992 at different locations in Sudan.

Zucchini yellow mosaic potyvirus (ZYMV) is prevalent in different cucurbit growing agro-ecosystems in Sudan. A study of the biological and serological variability of isolates originating from different regions was conducted to better understand ZYMV epidemiology and to develop adapted and durable control strategies. Variability was detected among isolates regarding symptomatology, host range and virulence towards the Zym resistance gene in melon (Cucumis melo L.) PI 414723. Serological variability was also revealed using a set of seven differential monoclonal antibodies (mAbs) raised against a French isolate (ZYMV-E9). Six serotypes were differentiated, but a majority of isolates (88%) reacted with all the mAbs as did the reference strains from Italy and France. All isolates from Sudan were equally well controlled by the resistance genes described in squash (Cucurhita moschata (Duchesne) Duchesne ex Poir. cvs. Menina and Nigeria) and in cucumber (Cucumis sativus L. cv. TMG), or by cross protection with the mild ZYMV-WK strain. All isolates were transmitted in a nonpersistent manner by Aphis gossypii Glover and Myzus persicae Sulzer. Zusammenfassung Das Zucchini yellow mosaic Potyvirus (ZYMV) kommt haufig in verschiedenen Cucurbitanbauagro-Okosystemen im Sudan vor. Um die Epidemiologie des ZYMV besser verstehen zu konnen, wurde eine Studie der biologischen und serologischen Variabilitat von Isolaten, die aus verschiedenen Regionen stammten, vorgenommen. Dadurch sollten angepaste und dauerhafte Kontrollstrategien entwickelt werden. Bei den Isolaten wurde eine Variabilitat in bezug auf deren Symptomatologie, Wirtsspektrum sowie Virulenz gegenuber dem Zym-Resistenzgen in Melonen (Cucumis melo L.) PI 414723 feslgestellt. Serologische Variabilitat wurde auch durch das Anwenden von einem Satz von 7 differentialen monoklonalen Antikorpern (mAbs), die gegen ein franzosisches Isolat (ZYMV-E9) entwickelt worden waren. Es wurden sechs Seroptypen unterschieden, obwohl 88% der Isolate und auch die Referenzstamme aus Italien und Frankreich mit alien mAbs reagierten. Gleich erfolgreich kontrolliert wurden alle Isolate aus den Sudan durch die resistenten Gene, die in Kurbis (Cucurbita moschata (Duchesne) Duchesne ex Poir. Cvs Menina tind Nigeria) und in der Gurke (Cucumis sativus L. cv. TMG) vorkommen bzw. durch die Kreuzreaktion mit dem milden ZYMV-WK-Stamm. Alle Isolate wurden durch Aphis gossypii Glover und Myzus persicae Sulzer in einer nicht persistenten Weise ubertragen.

International audience; Melon rugose mosaic virus (MRMV) was isolated from snake cucumber (Cucumis melo var. flexuosus) in the Kassala region of Sudan in 1993. The host range of the virus was mostly limited to cucurbits, where it induced severe mosaic and leaf deformations. Cytopathological studies revealed severe chloroplast alterations, including vesicles at their periphery and the tendency to aggregate, which are typical of tymovirus infections, providing further evidence that MRMV is a tentative member of the genus Tymovirus. In melon and snake cucumber, MRMV was found to be seed transmitted at rates of 0.9 and 3.8%, respectively. Seed dissection experiments revealed that the virus could be detected in the seed coat, papery layer, and embryo. Seed disinfection treatments did not reduce seed transmission rates, which suggests an internal transmission. A preliminary screening for resistance in melon revealed some resistance in two out of 367 accessions tested.

Publication Inra prise en compte dans l'analyse bibliométrique des publications scientifiques mondiales sur les Fruits, les Légumes et la Pomme de terre. Période 2000-2012. http://prodinra.inra.fr/record/256699; International audience; A virus isolate (Su-95-67) was obtained from a snake melon (Cucumis melo var. flexuosus) plant presenting severe chlorotic spots, mosaic,stunting, and leaf deformations collected in Eastern Sudan in 1995. Su-95-67 was easily mechanically transmissible and had a host range limited to a few cucurbit species. Isometric virus particles approximately 30 nm in diameter were observed in leaf dip preparations. A cytopathological study did not reveal alterations specific for a virus genus or family. A polyclonal antiserum was obtained and used in double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Su-95-67 was transmitted by seed at a low rate, by the red melon beetle (Aulacophora foveicollis), but not by the melon aphid (Aphis gossypii. Because Su-95-67 shared several properties with sobemoviruses, generic Sobemovirus reverse-transcription polymerase chain reaction primers were developed. They allowed amplification of a 384-bp fragment from extracts of plants infected by two sobemoviruses or by Su-95-67 but not from healthy plants extracts. Sequence comparison confirmed that Su-95-67 belongs to a new tentative Sobemovirus species for which we propose the name Snake melon asteroid mosaic virus (SMAMV). DAS-ELISA tests conducted on extracts of virus-infected cucurbit plants collected from 1992 to 2003 revealed the presence of SMAMV in 10.2% of 600 samples originating from different regions of Sudan.

International audience; A potyvirus (Su-94-54) was isolated from a naturally infected snake cucumber (Cucumis melo var. flexuosus) plant with severe mosaic and leaf deformation symptoms collected in Eastern Sudan. This isolate has a host range limited to cucurbits and is serologically distantly related to Moroccan watermelon mosaic virus (MWMV) and to Papaya ringspot virus (PRSV). Coat protein sequence analysis of Su-94-54 and MWMV and comparison with other potyviruses indicate that Su-94-54 is more closely related to MWMV than to any other potyvirus. Based on the amino acid sequence identity in the core part of the coat protein with MWMV (86%), this isolate could be regarded as a distinct species. However, because of biological, cytological, and serological affinities with MWMV, we propose that this isolate be considered as a strain of MWMV, possibly an evolutionary intermediate between MWMV and PRSV, until more is known on the structure of the PRSV subgroup within the genus Potyvirus.

International audience; Zucchini yellow mosaic potyvirus (ZYMV) was isolated in 1993 from a squash plant (Cucurbita pepo cv. Eskandrani) showing severe leaf and fruit distortions, collected in the Gezira region (Sudan). This isolate (ZYMV-Su) was found to be very closely serologically related if not identical to the type strain from Italy. The host range was mostly limited to Cucurbitaceae but systemic infection was found to occur on sesame (Sesamum indicum), an important cultivated crop in Sudan. ZYMV-Su induced mosaic symptoms on the resistant melon accession PI 414723, indicating that it belongs to pathotype 2, but did not cause wilting of melon cv. Dobulon. ZYMV-Su was efficiently transmitted by Myzus persicae and Aphis gossypii in a non-persistent manner. Surveys conducted from 1993 to 1995 revealed that ZYMV occurred in the major cucurbit growing areas in Sudan, in a diversity of crops and agroecosystems.

)in fields in the Gezira area and northern parts of Sudan. Symptoms in beanswere coincident with a high level of crop infestation by Aphis craccivorathat might play a role in the transmission of the virus.Chlorotic mottling and/or mosaic symptoms were accompanied byblack streaks on stems and leaf petioles. In some bean varieties, severe leafchlorosis subsequently developed into browning and blackening of theentire leave), resulting in plant death.Extracts from bean leaves were mechanically inoculated on to range ofhost plants, and Nicotiana benthamiana and Chenopodium quinoa wereidentified as suitable propagation hosts. Electron microscope analysis ofleaf extracts from infected C. quinoa revealed virus-like particles with iso-metric particles approximately 30 nm in diameter.A specific antiserum raised against the purified virus was produced, andin Western-immunoblot analysis the size of the putative coat protein wasestimated to be between 29 and 30 kDa. Using several reference virusesavailable at the DSMZ collection in Braunschweig, Germany, for aserological comparison, the virus isolated from faba bean was found to berelated to Tobacco streak virus (TSV) (Scott, 2001), a virus that is a seriouspathogen of groundnut, sunflower and okra in India (Reddy et al., 2002;Bhat et al., 2002; Krishnareddy et al., 2003). The identity of the faba beanvirus isolate was confirmed by reverse transcription-polymerase chainreaction (RT-PCR) and sequence analysis. A fragment of 717 nucleotidescorresponding to the complete TSV coat protein region was sequenced byusing specific TSV primers (TSV Cps ATGAATACTTTGATCCAAGG–TSVCPcTCAGTCTTGATTCACCAGGA) (GenBank Acc. No. CAP71888).A comparison of the deduced 237 aa coat protein sequence revealedbetween 90 and 92% sequence identity with the coat proteins of TSV isolatesfrom sunflower, cotton and a number of other crops in India (ABU55372,AY061928 and AF515824). The closest relationship (98% aa cp identity)of TSV from the Sudan was found with a TSV isolate from the ornamentalImpatiens neuguinea (DSMZ PV-0909, origin unknown). An analysis ofTSV isolates from legumes including Vicia faba revealed a 92% amino acidsequence identity with a soybean isolate from India (ABM 53 867) andonly a distant relationship to a TSV soybean isolate from Brazil (AAQ99 137, 83%). This shows a distinct geographic distribution of the TSVisolates from faba bean in Sudan. This is the first report of the natural occurrence of TSV in Vicia faba.ReferencesReddy AS , Prasada Rao RDVJ, Thirumala-Devi K

A survey of faba bean and chickpea for virus infection, conducted during February 1994 in the Sudan, showed that bean yellow mosaic potyvirus and broad bean mottle bromovirus occurred commonly in both crops. Chickpea chlorotic dwarf geminivirus (CCDV) was detected for the first time in naturally infected chickpeas and faba beans. This is the first report of natural CCDV infection of chickpeas outside India and the first record of chickpea and faba bean infection in West Asia and North Africa (WANA). Zusammenfassung Das naturliche Vorkommen des chickpea chlorotic dwarf Geminmnis in Kichererbsen and Fababobnen im Sudan Eine im Februar 1994 im Sudan durchgefuhrte Untersuchung uber Virusinfektionen bei der Fababohne und der Kichererbse zeigte. das das bean yellow mosaic Potyvirus und das broad bean mottle Bromovirus in beiden Pflanzen haufig vorkamen. Das chickpea chlorotic dwarf Geminivirus (CCDV) wurde zum ersten Mal in naturlich infizierten Kichererbsen- und Fababohnenpftanzen nachgewiesen- Es wird zum ersten Mal uber eine naturliche Infektion von Kichererhsen mit dem CCDV auBerhalb von Indien berichtet und es ist der erste Bericht einer Kichererhsen- und Fababohneninfektion in Westasien und Nordafrika (WANA).

Several techniques of fluorescence, light and electron microscopy were used to detect MLOs in sieve tube elements of phyllody diseased faba bean plants. The DNA-binding fluorochrome Bisbenzimid H 33258 provided satisfactory results when used with sections prepared from fresh materials using freezing microtome or cryostat and with fixed materials embedded in paraffin or historesin. While sections from fresh materials provided rapid means of indexing, historesin and paraffin have the advantage of better preservation of anatomical characteristics of plant tissues. This was particularly the case of historesin since sections were processed without removing the embedding medium. Semi-thin sections (250-350 nm) prepared from epoxy resin-embedded plant tissue are not amenable to staining with DNA-specific fluorochromes, hence they could not be used for fluorescence microscopy. Alternatively, 2 methods of ordinary light microscopy could be utilized with such sections. The first was to examine unstained sections in a light microscope with differential interference contrast of Nomarski, and the second implied staining with thionin and acridine orange and observation in a bright field microscope. Both techniques, though non-specific to MLO provided additional tool in cytopathological studies of diseased plants and could be useful in determining areas meriting further examination in electron microscopy. The presence of MLOs in plant tissues, used for light and fluorescence microscopy, was confirmed in ultrathin and semi-thin sections observed by transmission electron microscopy., Plusieurs techniques de microscopie photonique en fluorescence et en lumière normale ainsi que de microscopie électronique ont été utilisées pour détecter les MLO à l’intérieur des tubes criblés de la féverole atteinte de phyllodie. Un fluorochrome spécifique de l’ADN, Bisbenzimid H 33258 ou réactif de Hoechst, a donné des résultats satisfaisants quel que soit le mode de préparation du matériel végétal : tissu frais coupé au cryostat, tissu fixé et inclus dans la paraffine ou dans l’historésine. Les coupes préparées à partir de matériel frais ont permis l’indexage rapide de l’infection alors que l’inclusion dans la paraffine et surtout dans l’historésine a l’avantage de faciliter la caractérisation des structures anatomiques des tissus. L’historésine présente un intérêt particulier car les coupes peuvent être colorées en présence du milieu d’inclusion. De plus, des coupes semi-fines de 250 à 350 nm d’épaisseur ont été préparées à partir de tissus fixés et inclus dans une résine époxy. Elles ne présentent pas de fluorescence. Aussi, 2 méthodes de microscopie photonique en lumière normale ont été alternativement employées : la première consiste en l’observation des coupes non colorées en contraste interférentiel de Nomarski et, la deuxième utilise la coloration par la thionine et l’acridine orange. Ces 2 techniques, bien que non spécifiques, facilitent la localisation des zones qui nécessitent une étude ultérieure en microscopie électronique. La présence des MLO à l’intérieur des tubes criblés des tissus malades a été confirmée sur les coupes ultrafines observées en microscopie électronique par transmission.

A disease characterized by complete chlorosis of plant foliage was recently observed in Cynodon dactylon L. naturally growing in central Sudan. Severely affected plants were stunted with short internodes and small inward folded leaves. Examination of sections from paraffin embedded leaf and rhizome fractions, stained with a DNA-binding fluorochrome Bisbenzimid H 33258, and observed in a fluorescent microscope revealed abnormal amounts of DNA material in the phloem sieve tubes of diseased plants. More intense fluorescence was also observed in the xylem region and was shown to be due to the presence of a rod-shaped bacterium. No such anomalies were observed in healthy plants. Electron microscopy of ultrathin sections prepared from phloem zones, reacting with fluorescence in light microscopy revealed the presence of pleomorphic prokaryotes in the sieve tube elements of such zones. No helical forms were observed in semi-thin sections from the same plant material, suggesting the MLO nature of these prokaryotes.