Search

Hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) are an essential species in marine aquaculture. However, they are susceptible to high temperatures, which can reduce disease resistance, slow growth rates, and decrease production efficiency, resulting in significant economic losses. This study aims to investigate the differences in heat tolerance between hybrid grouper and their parental species, tiger grouper (Epinephelus fuscoguttatus) and giant grouper (E. lanceolatus), and to identify heat stress-related signaling pathways and key genes. Through controlled temperature experiments, we measured the physiological and biochemical parameters of serum (ACP, AKP, TG, COR) and liver (HSP70, HSP90, SOD, CAT) in pearl gentian grouper and their parents, followed by liver transcriptome analysis of the three grouper species. The results showed that the lethal temperature of tiger grouper is 41°C, and the lethal temperature of hybrid tiger grouper and saddle grouper is 40°C. Significant changes in antioxidant and heat stress-related indicators were observed in the early stages of stress. Comparative analysis of DEGs related to heat tolerance between pearl gentian grouper and their parents revealed common DEGs including the hsp family, danaj family, slc family, pnpla2, magot, actalb, and prodh. Among these, the gene expression trends in hybrids were similar to those of their maternal parent and varied between the same or opposite trends compared to those of their paternal parent. These findings suggest that the hybrids inherit heat regulation genes from both parents, with a higher proportion from the maternal parent, which likely explains their intermediate heat tolerance. This research provides insights into the potential relationship between heat tolerance in pearl gentian grouper and their parents and identifies key genetic information affecting heat tolerance.

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.

Triploid fish sometimes grow faster and larger than diploids, making them valuable in aquaculture. Their underdeveloped gonads redirect energy from reproduction to muscle growth. This study compared embryonic development and antioxidant responses between allotriploid and hybrid diploid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) after cold shock, aiming to support large-scale allotriploid production. The diploid group had a 99.08% fertilization rate and 82.87% hatching rate, while the triploid group had lower rates (95.71% fertilization, 39.63% hatching, 11.52% deformity). Triploids developed later, with higher incidences of abnormalities and mortality, especially in the gastrula and neuro-embryo stages. Triploid larvae exhibited shortened tails, abnormal yolk sacs, and impaired swimming. Flow cytometry showed triploids that had 1.55 times more DNA and larger red blood cells. Triploids had lower midgut trypsin and lipase levels than diploids (p < 0.05) but similar glucose, liver malondialdehyde, and total cholesterol levels (p > 0.05). However, they had higher liver and spleen lactate dehydrogenase, catalase, and alkaline phosphatase, along with lower spleen malondialdehyde and liver superoxide dismutase (p < 0.05). These findings offer insights into reducing mortality in allotriploid grouper aquaculture, aiding large-scale production efforts.