Search

Stored grains are subjected to infestations with more than 60 species of insects, that responsible for millions of dollars’ loss and cause several health problems including allergies and gastrointestinal disorders. Traditional detection techniques are laborious, expensive and not sensitive to detect insect contamination at the egg and larvae stages. Therefore, alternative methods are needed for rapid and sensitive detection. One obvious approach is to develop a molecular approach utilizing genetic information of the potential insect species that infest grains for amplification of specific target gene fragment utilizing polymerase chain reaction [PCR]. In the present study, a number of known infested grain samples were used in standardizing a method to isolate larvae and adult insects that were based on centrifugation washing method and a filtration washing method. The isolated insects were subjected to DNA extraction and PCR amplification of defined regions of cytochrome oxidase I (COI) gene followed by sequencing to identify the di"erent pest species. For PCR amplification new primers were designed and for this purpose the obtained COI sequences from di"erent insects were aligned to design two sets of primers (named: COI-PCR4 and COI-PCR5) specific for the indicated insect mitochondrial COI gene. The designed primers were tested for their specificity and sensitivity. The suitability of PCR primers and DNA extraction methods were evaluated on eleven samples of commercial grains utilizing each primer set with the two extraction methods.

Summary This study evaluated the association of vitamin D and bone markers with the development osteoporosis in Palestinian postmenopausal women. Even though vitamin D deficiency was very high for the recruited subjects, it was not associated with osteoporosis except for bones of the hip. Age and obesity were the strongest determining factors of the disease. Purpose The purpose of this study was to investigate the association of bone mineral density (BMD) with serum vitamin D levels, parathyroid hormone (PTH), calcium, obesity, and bone turnover markers in Palestinian postmenopausal women. Methods Three hundred eighty-two postmenopausal women (≥45 years) were recruited from various women clinics for BMD assessment (131 women had osteoporosis and 251 were normal and served as controls). Blood samples were obtained for serum calcium, PTH, 25(OH)D, bone formation (N-terminal propeptide (PINP)), and bone resorption (serum C-terminal telopeptide of type I collagen (CTX1)) markers. Results Women with osteoporosis had statistically significant lower mean weight, height, body mass index (BMI), and serum calcium (p

The need for simple self-assessment tools is necessary to predict women at high risk for developing osteoporosis. In this study, tools like the IOF One Minute Test, Fracture Risk Assessment Tool (FRAX), and Simple Calculated Osteoporosis Risk Estimation (SCORE) were found to be valid for Palestinian women. The threshold for predicting women at risk for each tool was estimated. The purpose of this study is to evaluate the validity of the updated IOF (International Osteoporosis Foundation) One Minute Osteoporosis Risk Assessment Test, FRAX, SCORE as well as age alone to detect the risk of developing osteoporosis in postmenopausal Palestinian women. Three hundred eighty-two women 45 years and older were recruited including 131 women with osteoporosis and 251 controls following bone mineral density (BMD) measurement, 287 completed questionnaires of the different risk assessment tools. Receiver operating characteristic (ROC) curves were evaluated for each tool using bone BMD as the gold standard for osteoporosis. The area under the ROC curve (AUC) was the highest for FRAX calculated with BMD for predicting hip fractures (0.897) followed by FRAX for major fractures (0.826) with cut-off values ˃1.5 and ˃7.8%, respectively. The IOF One Minute Test AUC (0.629) was the lowest compared to other tested tools but with sufficient accuracy for predicting the risk of developing osteoporosis with a cut-off value ˃4 total yes questions out of 18. SCORE test and age alone were also as good predictors of risk for developing osteoporosis. According to the ROC curve for age, women ≥64 years had a higher risk of developing osteoporosis. Higher percentage of women with low BMD (T-score ≤−1.5) or osteoporosis (T-score ≤−2.5) was found among women who were not exposed to the sun, who had menopause before the age of 45 years, or had lower body mass index (BMI) compared to controls. Women who often fall had lower BMI and approximately 27% of the recruited postmenopausal Palestinian women had accidents that caused fractures. Simple self-assessment tools like FRAX without BMD, SCORE, and the IOF One Minute Tests were valid for predicting Palestinian postmenopausal women at high risk of developing osteoporosis.

article i nfo Pregnancy is a hypercoagulable state with increased tendency for thrombus formation, a condition that is increased when combined with acquired or inherited risk factors that lead to thrombophilia. Among the inherited risk factors is Factor V Leiden mutation, an autosomal dominant trait with reduced penetrance. The mutation seems to be associated with different poor pregnancy outcomes including recurrent miscarriages. In the present study, we performed a case-control study to investigate the association between the Leiden mutation and poor pregnancy outcome among the Palestinian population in the West bank region of Palestine. The study included 145 subjects with recurrent miscarriages and 205 matched control subjects with successful pregnancies who experienced normal delivery and no apparent complications. Leiden mutation was detected in 41 of the145 study subjects (28.2%), and in 24 of the 205 control subjects (11.7%). Subjects homozygous with the mutant allele were identified only among the test and not the control group. Data analysis indicates a significant association between the mutant allele and recurrent miscarriages (p- valueb0.05). Furthermore, this association is significant between the mutant haplotype with miscarriages compared to control group showing time effect where there is no association for miscarriages before week 10. Results here also show strong association of factor V leiden polymorphism among primary aborters compared to secondary aborters or control groups. The odds ratio for the primary aborters was 75 and pb0.0001. In conclusion, these results provide evidence for a significant correlation between recurrent miscarriages and Factor V mutation in our population.

The prevalence and awareness of postmenopausal osteoporosis was assessed among 569 postmenopausal women randomly selected from the population. Osteoporosis was assessed based on bone mineral density (BMD) values at three indicative sites. The results indicate a significant prevalence of the disease among this fraction of the population with a poor knowledge of its risk factors. Postmenopausal osteoporosis is a major health problem at the individual and population levels. Assessment of its prevalence and awareness of risk factors provide the basis for health plans to control the disease. No previous studies have been done in our population. A cross-sectional study including 569 postmenopausal women showed a significant prevalence of osteoporosis with a poor awareness of risk factors. Included in the study were 569 randomly selected postmenopausal women (≥49 years of age). BMD was measured in 505 subjects at the lumbar spine, femoral neck and total hip using dual energy x-ray absorptiometry. Awareness was evaluated using a special questionnaire. Osteoporosis affected the lumbar spine, femoral neck and total hip in 24%, 14% and 29.7% of subjects, respectively. There was a significant negative correlation (p

beta-Thalassemia (thal) is an autosomal recessive disorder that results in hypochromic hemolytic anemia in affected patients. In the West Bank area of Palestine, the prevalence of beta-thal trait is approximately 3.5% among the population, with an estimated 120,000 carriers. Seventeen beta-globin gene mutations could be identified in 148 patients using polymerase chain reaction (PCR), amplification refractory mutation system (ARMS)-PCR and direct sequencing. The predominant mutations included: IVS-I-6 (T --> C) (28.7%), IVS-I-110 (G --> A) (17.6%), codon 37 (G --> A) (10.4%), IVS-I-1 (G --> A) (9%), codons 106/107 (+ G) (6.8%) and codon 39 (C --> T) (4.6%). Other less frequent and rare mutations included: IVS-II-1 (G --> A), codon 5 (-CT), IVS-II-848 (C --> A), -30 (T --> A), codons 8/9 (+ G), IVS-I-5 (G --> C), -28 (A --> C), IVS-II-745 (C --> G), codon 6(-A), codon 27 (G --> T) and codon 30 (AGG --> ACG). Most patients (62.2%) were homozygous for one type of mutation, while the rest (27.3%) were compound heterozygotes. Some patients were heterozygous for beta-thal and sickle cell anemia traits. No mutations could be detected in both alleles of eight patients, while in seven patients only one mutant allele could be detected. Further investigations are needed to resolve the corresponding genotypes of these patients. This study represents a comprehensive investigation of the type, frequency, and distribution of thalassemia mutations among the Palestinian population in the West Bank region of Palestine. A degree of similarity and significant variations was evident in the type and frequency of mutations when the present mutations profile was compared with similar ones among various Arab and non Arab populations. The association between the identified mutations and the corresponding genotypes of our patients with specific polymorphism frameworks in the beta-globin gene was performed and the results revealed linkage disequilibrium.

Factor X deficiency is a rare autosomal disease with an estimated prevalence 1: 1,000,000. It is characterized by a reduction in factor X, an essential component of the prothrombinase complex responsible for converting prothrombin to thrombin. The aim of the study was to identify the molecular defects in the factor X gene in Palestinian factor X deficient patients. Nine unrelated Palestinian patients were identified by thrombin time [PT], activated partial thromboplastin time [APTT] and plasma factor X levels. All exons including exon/ intron border and promoter regions were PCR amplified, purified, sequenced and compared to the normal factor X gene. A novel splicing junction mutation IVS1+1G?T was identified in two patients resulting in a major distortion of the protein structure and function. A second novel missense mutation Asp413Asn G>T that apparently distorts the protein structure and affects its catalytic activity was identified in the family of one patient. Six patients proved to be homozygous of the previously identified c358 delG deletion mutation leading to a severely truncated protein that seems specific to our population. A putatively mild heterozygous mutation Ser105thr G>C was detected in two patients who suffer from the severe c358 delG deletion mutation.

The ability of vitamin D receptor-retinoid X receptor (VDR-RXR) heterodimers to induce a DNA bend upon binding to various vitamin D response elements (VDRE) has been investigated by circular permutation and phasing analysis. Recombinant rat VDR expressed in the baculovirus system and purified recombinant human RXR beta have been used. The VDREs were from 1,25-dihydroxyvitamin D3 (1,25-[OH]2D3) enhanced genes (rat osteocalcin, rOC; mouse osteopontin, mOP, and rat 1,25-dihydroxyvitamin D3-24-hydroxylase, r24-OHase), and a 1,25-(OH)2D3 repressed gene (human parathyroid hormone, hPTH). As shown by circular permutation analysis, VDR-RXR induced a distortion in DNA fragments containing various VDREs. Calculated distortion angles were similar in magnitude (57 degrees, 56 degrees, 61 degrees, and 59 degrees, respectively for rOC, mOP, r24-Ohase, and hPTH). The distortions took place with or without a 1,25-(OH)2D3 ligand. The centers of the apparent bend were found in the vicinity of the midpoint of all VDREs, except for rOC VDRE which was found 4 bp upstream. Phasing analysis was performed with DNA fragments containing mOP VDRE and revealed that VDR-RXR heterodimers induced a directed bend of 26 degrees, not influenced by the presence of hormone. In this study we report that similar to other members of the steroid and thyroid nuclear receptor superfamily, VDR-RXR heterodimers induce DNA bending.

A putative transcription factor binds a site adjacent to the negative vitamin D responsive element (VDRE) in the promoter region of the human parathyroid hormone gene. Deletion and mutation analysis reveal the binding site for this factor overlaps with the proximal repeat element of the VDRE. It includes additional nucleotides at the 3′ end of the VDRE. This site has the sequence TTTGAACCTATAGTTGAGAT and a core sequence TGAACCTAT needed for binding of the factor. Experiments with specific anti-vitamin D receptor (VDR) antibodies demonstrate that VDR is not found in the factor/DNA complex. However, removing the VDR from the nuclear extract by immunoprecipitation eliminated the binding complex, and the addition of recombinant VDR to the depleted extract did not restore the factor's ability to bind to the DNA, suggesting that the factor and VDR are closely associated. Transfection experiments with various reporter constructs indicate that the factor is required for the high transcriptional activity of the human PTH gene. This high activity is significantly suppressed by 1,25-dihydroxyvitamin D3. This factor seems to be expressed in several cell types including rat osteoblasts and pituitary. Additionally, some human cancer cell lines express a high level of this factor.

The purpose of the study is to compare the potential of HbA1c to diagnose diabetes among Palestinian Arabs compared to fasting plasma glucose (FPG). A cross-sectional sample of 1370 Palestinian men (468) and women (902) without known diabetes and above the age of 30 years were recruited. Whole blood was used to estimate HbA(1c) and plasma for FPG and total lipid profile. Fasting plasma glucose was used as a reference to diagnose diabetes (≥ 126 mg/dL) and prediabetes (100-125 mg/dL). The area under the receiver operating characteristic curve (AUC) for HbA(1c) was 81.9% to diagnose diabetes and 63.9% for prediabetes. The agreement between HbA(1c) and diabetes as diagnosed by FPG was moderate (ĸ = 0.498) and low with prediabetes (ĸ = 0.142). The optimal cut-off value for HbA1c to diagnose diabetes was ≥ 6.3% (45 mmol/mol). The sensitivity, specificity and the discriminant ability were 65.6% (53.1-76.3%), 94.5% (93.1-95.6%), 80.0% (72.8-87.3%), respectively. However, using cut-off value of ≥ 6.5% (48 mmol/mol) improved specificity. At this cut-off value, the sensitivity, specificity and the discriminant ability were 57.4% (44.9-69.0%), 97.1% (96.0-97.9%) and 77.3% (71.0-83.5%). For diagnosing prediabetes with HbA1c between 5.7-6.4% (39-46 mmol/mol), the sensitivity, specificity and the discriminant ability were 62.7% (57.1-67.9%), 56.3% (53.1-59.4%) and 59.5% (56.3-62.5%), respectively. HbA(1c) at cut-off value of ≥ 6.5% (48 mmol/mol) by itself diagnosed 5.3% and 48.3% as having diabetes and prediabetes compared to 4.5% and 24.2% using FPG, respectively. Mean HbA(1c) and FPG increase significantly with increasing body mass index. In conclusion, the ROC curves showed HbA1c could be used for diagnosing diabetes when compared to FPG but not for prediabetes in Palestinians Arabs even though only about 50% of the diabetic subjects were identified by the both HbA1c and FPG.

The binding of the 1,25-dihydroxyvitamin D3receptor to the vitamin D response elements (VDREs) in the rat osteocalcin (OSC–DRE), mouse osteopontin (MOP–DRE), rat calbindin D-9k (CaBP–DRE), and human parathyroid hormone genes (PTH–DRE) was studied. Binding of VDR to the three positive VDREs is cooperative. The degree of cooperativity is highest with the calbindin VDRE compared with either the OSC–DRE or the MOP–DRE. This cooperativity is largely absent in the case of the negative element, the PTH–DRE. The VDR binds in order of decreasing affinity to PTH–DRE > OSC–DRE = MOP–DRE > CaBP–DRE. Thus, the greatest affinity is associated with the lowest degree of cooperativity. Further study has revealed that the PTH–VDRE actually consists of two repeat elements like all other VDREs and is not a single six-base sequence. A nuclear factor has also been found that binds downstream from the GGTTCA element in the PTH promoter. The binding site of this factor overlaps the PTH–DRE nucleotide sequence.

Background Osteoporosis is a common skeletal disorder characterized by low bone mass and microarchetectual deterioration of bone tissue with increased susceptibility to fractures. Osteoporosis is considered a multifactorial polygenic disease. The prevalence of postmenopausal osteoporosis in Palestine, based on of BMD at femoral neck, total hip and spine was 24%, 14% and 29.7% respectively. Previous studies on the effect of genetic polymorphisms on bone mineral density (BMD) showed significant correlation between various haplotypes and mutations in the VDR and MTHFR and low bone mineral density [BMD] among Palestinian postmenopausal subjects. Estrogens are known to play an important role in regulating bone homeostasis. Estrogen act through binding to Estrogen Receptor α (ERα) which is a member of the nuclear receptor superfamily of ligand activated transcription factors. Vitamin K hydrochinon is an important cofactor for gamma carboxylation of osteocalcin, a major bone matrix protein . The reduction of vitamin K to vitamin K hydrochinon depends on the vitamin K epoxide reductase complex subunit 1 (VKORC1). Aim In the present study, correlation between specific XbaI and PvuII polymorphisms in the ERα gene and selected polymorphisms in the VKORC1 gene with low BMD and fractures risk were investigated in 345 postmenopausal Palestinian women including 165 osteoporotic, 93 osteopenic and 86 normal subjects using allele-specific polymerase chain reaction (PCR) and RFLP-PCR technology. Results The data showed significance association between the XX haplotype of the XbaI in ERα gene and lower BMD at the hip (P=0.012). Similarly the PP haplotype of PvuII ER α gene was significantly associated with lower hip BMD ( P=0.03). In addition, the 9041G allele [GG and GA] was significantly more frequent in patients with low BMD (P = 0.012). In our cohort, a genetic variation in the 3'-region of the VKORC1 gene (9041 AG and GG) was significantly associated with low BMD. The data also revealed the +2255 TT haplotype which is linked to lower activity of the enzyme was associated with low BMD while the presence of the C allele [CC or CT], linked to higher activity at this locus, was associated with normal BMD levels [P=0.02]. Conclusions These findings indicate that specific polymorphisms in the ERα gene and VKORC1 gene are correlated with variation in BMD levels among our subjects. These results along with previous data with the VDR and MTHFR genes provide evidence for the strong correlation between genetics and osteoporosis in our population may be significant for treatment decisions and screening of osteoporotic patients. The involvement of other genes variation like the osteoprotegrin and TNF superfamily member genes are underway. The overall data will eventialy be employed for direct correlation and evaluation between the genetic background of patients and the efficacy of selected specific drugs used to treat osteoporosis.

3-Desoxy-20-oxo-19-nor-pregnacaliferol (6a) and its 2-oxo analog 6c were prepared from 22-acetoxy-Grundmann's ketone 1 and the corresponding (cyclohexylidene)ethyl phosphine oxides 2a, b and their binding to the progesterone receptor examined.

20-Oxopregnacaliferols and 19-nor-20-oxopregnacalciferol were prepared from calciferol 22-aldehydes by an oxygenation procedure.

The 1,25-dihydroxyvitamin D3 receptor becomes phosphorylated upon treatment with 1,25-dihydroxyvitamin D3. We have investigated the role of phosphorylation in the transcriptional activity induced by 1,25-dihydroxyvitamin D3 through its receptor. An active 1,25-dihydroxyvitamin D3-dependent transcription system was reconstituted in CV-1 cells by co-transfection of plasmids containing the rat 1,25-(OH)2D3 receptor DNA and a functional vitamin D response element (DRE) in a reporter gene construct. Treatment of these transiently transfected CV-1 cells with modulators of protein kinase A (8-Br-cAMP, PKIA and H-9) and phosphatases (Okadaic acid) resulted in mimicking or abolishing the transcriptional activity of 1,25-dihydroxyvitamin D3 in a receptor-dependent fashion. These modulators directly altered 1,25-dihydroxyvitamin D3 receptor phosphorylation. Therefore, the present results strongly suggest that phosphorylation plays a central role in the transcriptional activity of the 1,25-dihydroxyvitamin D3 receptor.

20-Oxopregnacaliferols and 19-nor-20-oxopregnacalciferol were prepared from calciferol 22-aldehydes by an oxygenation procedure.

The rat calbindin D-9k gene is transcriptionally regulated by 1,25-dihydroxyvitamin D3 in the intestine. We have examined the 5'-flanking region of this gene and identified a 1,25-dihydroxyvitamin D3-responsive element (DRE) between nucleotides -489 and -445. This element confers 1,25-dihydroxyvitamin D3 responsiveness through its native promoter and the heterologous thymidine kinase promoter, and it contains the sequence GGGTGTCGGAAGCCC, which is homologous to the other previously identified DREs. Incubation of this element with the 1,25-dihydroxyvitamin D3 receptor produced a specific protein-DNA complex, which shifted to a higher molecular weight form upon the addition of a monoclonal antibody specific to the 1,25-dihydroxyvitamin D3 receptor. Therefore, the 5'-flanking region of the rat calbindin D-9k gene contains a DRE that mediates the enhanced expression of this gene by 1,25-dihydroxyvitamin D3 in the intestine.

The rat calbindin (molecular mass 9 kDa) gene sequence revealed the presence of an imperfect palindromic estrogen-responsive-like element (ERE) located at position +51 from the transcriptional initiation site. This element has the sequence AGGTCAGGGTGATCT which differs by one nucleotide from the vitellogenin ERE palindromic sequence AGGTCACTGTGACCT. The activity of this element to induce transcription in response to estrogen and the ability to bind estrogen receptor was investigated. This sequence confers estrogen-dependent transcriptional activity when cloned upstream from the tkp-CAT construct in pBLCAT2 plasmid and transfected into T47D cells, similar to the vitellogenin gene ERE activity but to a lesser extent. This element binds to the estrogen receptor in vitro as assessed by gel retardation assay similar to the vitellogenin gene ERE. No such binding was detected when a mutant sequence AGATCACTGTGATCT was used. The specificity of the complex was confirmed using polyclonal antibodies, ER712 raised against the estrogen receptor. Furthermore, competition assays showed that both sequences were able to compete for binding to the estrogen receptor. The in vivo transcriptional regulation of the calbindin D-9K gene by estrogen was also investigated in the rat. Female animals maintained on a vitamin D-sufficient or a vitamin D-deficient diet were ovariectomized, housed for 3 weeks, and then injected with 17 beta-estradiol (0.5 micrograms/kg body weight/day). Slot blot analysis of total RNA showed a marked increased in calbindin D-9K mRNA levels in the uterus but not in the intestine by 26 and 50 h post-injection. These results demonstrate that the calbindin D-9K gene is transcriptionally regulated by estrogen in the uterus mediated by an estrogen-responsive element identified in the gene.

To investigate the spectrum of mutations and genotypes in the pyrin gene in familial Mediterranean fever (FMF) patients.Blood samples of 511 suspected FMF patients, received from the Molecular Genetics Laboratory, Makassed Islamic Charitable Hospital, Mount Olives, Jerusalem during the period from June 1999 to August 2004, were investigated by genotyping 24 different MEFV mutations.Our work revealed the presence of 14 different mutations from the identified 24 mutations in the gene which are assembled in 6 homozygous, 9 heterozygous and 16 compound heterozygous genotypes. The homozygous genotypes represent the predominant format among our patients representing approximately 38% of the revealed genotypes. Interestingly, in 94 (31.4%) of the tested subjects, only one mutation in the pyrin gene could be identified while the other mutant allele remains unidentified. Moreover, the genotype of 3 (1%) patients revealed the presence of triplet mutations in the pyrin gene.The results of our study clearly suggest that the origin of FMF among the Palestinian population is mostly homozygous. The identification of a significant number of patients with one known mutation indicates potentially the presence of new mutations in the gene which will be investigated in the future.

beta-Thalassemia (thal) is an autosomal recessive disorder that results in hypochromic hemolytic anemia in affected patients. In the West Bank area of Palestine, the prevalence of beta-thal trait is approximately 3.5% among the population, with an estimated 120,000 carriers. Seventeen beta-globin gene mutations could be identified in 148 patients using polymerase chain reaction (PCR), amplification refractory mutation system (ARMS)-PCR and direct sequencing. The predominant mutations included: IVS-I-6 (T --C) (28.7%), IVS-I-110 (G --A) (17.6%), codon 37 (G --A) (10.4%), IVS-I-1 (G --A) (9%), codons 106/107 (+ G) (6.8%) and codon 39 (C --T) (4.6%). Other less frequent and rare mutations included: IVS-II-1 (G --A), codon 5 (-CT), IVS-II-848 (C --A), -30 (T --A), codons 8/9 (+ G), IVS-I-5 (G --C), -28 (A --C), IVS-II-745 (C --G), codon 6(-A), codon 27 (G --T) and codon 30 (AGG --ACG). Most patients (62.2%) were homozygous for one type of mutation, while the rest (27.3%) were compound heterozygotes. Some patients were heterozygous for beta-thal and sickle cell anemia traits. No mutations could be detected in both alleles of eight patients, while in seven patients only one mutant allele could be detected. Further investigations are needed to resolve the corresponding genotypes of these patients. This study represents a comprehensive investigation of the type, frequency, and distribution of thalassemia mutations among the Palestinian population in the West Bank region of Palestine. A degree of similarity and significant variations was evident in the type and frequency of mutations when the present mutations profile was compared with similar ones among various Arab and non Arab populations. The association between the identified mutations and the corresponding genotypes of our patients with specific polymorphism frameworks in the beta-globin gene was performed and the results revealed linkage disequilibrium.

The calcidiol (25-hydroxyvitamin D3) 24-hydroxylase is one of the key enzymes in the metabolism of vitamin D. This enzyme acts on both calcidiol and calcitriol (1,25-dihydroxyvitamin D3) to initiate degradation of these potent vitamin D metabolites and is tightly regulated. Calcitriol itself induces this enzyme and acts at the transcriptional level. Transcriptional regulation of genes by calcitriol has been shown to occur via the vitamin D-receptor binding to a vitamin D-response element located upstream of the transcription start site. We now report a vitamin D-response element located between nt -262 and nt -238 of the rat calcidiol 24-hydroxylase gene. This sequence binds the calcitriol receptor and confers vitamin D-dependent transactivation of transcription to its own, as well as heterologous, promoter.

The epidemic nature of diabetes mellitus in different regions is reviewed. The Middle East and North Africa region has the highest prevalence of diabetes in adults (10.9%) whereas, the Western Pacific region has the highest number of adults diagnosed with diabetes and has countries with the highest prevalence of diabetes (37.5%). Different classes of diabetes mellitus, type 1, type 2, gestational diabetes and other types of diabetes mellitus are compared in terms of diagnostic criteria, etiology and genetics. The molecular genetics of diabetes received extensive attention in recent years by many prominent investigators and research groups in the biomedical field. A large array of mutations and single nucleotide polymorphisms in genes that play a role in the various steps and pathways involved in glucose metabolism and the development, control and function of pancreatic cells at various levels are reviewed. The major advances in the molecular understanding of diabetes in relation to the different types of diabetes in comparison to the previous understanding in this field are briefly reviewed here. Despite the accumulation of extensive data at the molecular and cellular levels, the mechanism of diabetes development and complications are still not fully understood. Definitely, more extensive research is needed in this field that will eventually reflect on the ultimate objective to improve diagnoses, therapy and minimize the chance of chronic complications development.

Following the cloning and deletion analysis of the vitamin D receptor, most recent advances have been in the isolation and characterization of the DNA response elements found in the promoter region of target genes of vitamin D. Vitamin D, like the thyroid and retinoid hormones, binds to repeat sequences, but the repeats are separated by three nonspecified bases. The action of the VDR requires the presence of the RXR proteins and evidently other proteins that are involved in regulating transcriptions. A possible role of phosphorylation of the ligand binding domain of the VDR in transcription has also appeared. Very likely, the molecular events involved in vitamin D stimulation or suppression of a target gene will include its interaction with a number of transcription factors, both in the regulation of transcription and in the actual machinery involved in the transcription process through polymerase II. Although likely, it is not entirely clear whether the genomic action of vitamin D can account for all of its biological activities. Nongenomic actions of the vitamin D hormone have been reported, but convincing evidence that this is of biological importance in vivo is lacking. Advances in our understanding of the vitamin D mechanism of action can clearly be expected from physical studies of cloned and expressed vitamin D receptor and its subdomains, elucidation of the transcription factors in vitamin D-modulated transcription of target genes, elucidation of the role of phosphorylation in the transcription process, and the identification of important genes that are regulated in the specific target tissues responsive to vitamin D. This will definitely remain as a very active field of investigation well into the future.

The effects of two vitamin D analogs, 1,25-dihydroxyvitamin D-2 and 24-epi-1,25-dihydroxyvitamin D-2, were examined on osteocalcin gene expression in the rat osteosarcoma cell line ROS 17/2.8. our results indicate that these analogs are more transcriptionally active than 1,25-dihydroxyvitamin D-3, particularly the 24-epimer. Assessment of reporter gene chloramphenicol acetyltransferase (CAT) activity, using the vitamin D responsive element (VDRE) derived from the human osteocalcin gene promoter, revealed that both analogs stimulated CAT activity 5- to 10-fold. 1,25-Dihydroxyvitamin D-2 was slightly more active than 1,25-dihydroxyvitamin D-3, while the 24-epimer was twice as effective. 1,25-Dihydroxyvitamin D-3 also stimulated osteocalcin mRNA accumulation by 2-fold over vehicle-treated cells, 1,25-dihydroxyvitamin D-2 by 2.5-fold, and 24-epi-1,25-dihydroxyvitamin D-2 by 4-fold. Electrophoretic mobility shift assays using the osteocalcin vitamin D responsive element revealed no increase in DNA binding with either analog when compared to 1,25-(OH)2D3. Examination of CAT activity using the rat 24-hydroxylase VDRE indicated no significant difference in transcription with these compounds, suggesting that the vitamin D-2 analogs preferentially activate osteocalcin gene expression.

The interaction between the two vitamin D response elements (DRE) located at -154 to -134 base pairs (bp) and -262 to -238 bp from the transcription initiation site has been studied using reporter gene assays and binding assays by electrophoretic gel shift measurements. 3 half-sites separated by 3 bp were found necessary for transactivation by the -154 to -125 DRE, while 2 half-sites separated by 3 bp were needed for the DRE at -262 to -238 to function. However, the two DREs together provided maximal activity. The 93-bp fragment separating the two DREs was not required and could be deleted. The most effective binding by receptor was found with the two complete DREs (dissociation constant (Kd) = 13.7 pM), although each DRE bound to the receptor and nuclear accessory factor with about 5 nM Kd. The two DREs (a total of 5 half-sites) apparently account for most if not all of the transactivation of the rat 24-hydroxylase by 1,25-dihydroxyvitamin D3. This system represents the most powerful of the DREs reported to date.

There is no doubt that vitamin D which is normally formed in skin or obtained in the diet must be altered before it can carry out its functions (DeLuca 1974, 1988). First, 25-hydroxylation is carried out in the microsomes and mitochondria of liver to produce the circulating form of vitamin D 25-hydroxyvitamin D3 (25-OH-D3). Secondly, 1α-hydroxylation produces the final hormonal or active form 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3). In normal humans and animals, this occurs exclusively in the proximal convoluted tubule cells of the kidney, with the notable exception of the placenta (DeLuca 1974, 1988). There is abundant evidence to support the idea that 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3) is the metabolically active form of vitamin D (DeLuca 1974, 1988). It is believed to carry out both the classical functions of the vitamin and some of the more recently found functions in differentiation and development and in suppression of the parathyroid glands (Darwish and DeLuca 1993; DeLuca 1988, 1992). Furthermore, new and unknown functions of vitamin D will likely be discovered, as, for example, in the female reproductive system (Halloran and DeLuca 1980; Kwiecinski et al. 1989), in the islet cells of the pancreas (Chertow et al. 1983), and in the keratinocytes of skin (Smith et al. 1986). This list will probably become longer and will include abnormal sites such as in malignant tissue that contains significant amounts of vitamin D receptor (VDR) (Eisman 1984).

A lingering question regarding the regulation of target gene expression by 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] has been the delineation of vitamin D receptor (VDR)-DNA binding and transactivation. This report confirms that initial VDR-DNA interaction occurs in a ligand-independent fashion. An electrophoretic mobility-shift analysis demonstrated that VDR, derived from extracts of the small intestines of vitamin D-deficient rats, is capable of binding a vitamin D response element (DRE). Additional mobility-shift studies using either porcine-derived VDR or recombinant rat VDR from insect cells revealed DRE-binding capability in the absence of 1,25-(OH)2D3. The reactions were performed in various salt environments, with the maximum of porcine VDR-DRE and rat VDR-DRE binding detected at 100 mM and 150 mM KCl, respectively. The addition of 1,25-(OH)2D3 to an identical set of reaction mixtures resulted in increased DRE binding with greater affinities exhibited by both VDR types. These two phenomena were confirmed upon examination of an elution profile of VDR bound to DRE-linked Sepharose. When a linear KCl gradient was used for elution without the addition of 1,25-(OH)2D3, the peak of VDR was 205 mM KCl; the presence of exogenous hormone shifted the maximum VDR elution to a position corresponding to 265 mM KCl. Based on these data and previous reports on VDR-mediated transactivation, we propose a model for 1,25-(OH)2D3-influenced target gene expression.

A possible role of calcium in vivo on intestinal calbindin-D 9-kDa mRNA levels has been studied in rats. In vitamin D-deficient rats, a marked increase in dietary calcium has a small but significant effect on calbindin-D 9-kDa mRNA levels, despite a dramatic increase in serum calcium concentration that clearly resulted from increased intestinal absorption of calcium. On the other hand, vitamin D under all circumstances increased calbindin-D 9-kDa mRNA levels, with the greatest levels found in animals on a low calcium diet where little or no calcium is available for absorption. These results strongly support the idea that 1,25-dihydroxyvitamin D is directly responsible for the induction of calbindin-D 9-kDa. [P.S.E.B.M. 1992, Vol 199]

The kinetics of 64Cu(II) uptake, efflux and net accumulation were examined with hepatocytes isolated from hemizygous and heterozygous brindled mice to determine the basis for the low hepatic copper levels in these mice. Initial rate data (0.5 min) for 64Cu(II) uptake showed no significant differences between the normal and mutant hepatocytes for the Km and Vmax parameters for copper uptake. The rate and total efflux of 64Cu from preloaded cells were also normal for both the hemizygous and heterozygous brindled hepatocytes. Normal and mutant hepatocytes exhibited an overshoot in net 64Cu(II) uptake when cells were incubated continuously with 64Cu(II) for 6 h. Maximal intracellular levels were attained at 1.5 to 2.5 h before a lower steady state was achieved by approximately 3 h. The mutant hepatocytes were also normal with respect to the time-delayed efflux process responsible for the overshoot in terms of 64Cu lost/min/mg of protein. However, both the hemizygous and heterozygous hepatocytes showed approximately 25% less than normal maximal copper accumulation. This accounted for the approximately 25% lower copper levels at steady state and also equaled the Cu deficiency in the resting whole livers. The impaired Cu accumulation characteristic is not a general property of Cu-deficient hepatocytes because nutritionally Cu-deficient hepatocytes exhibited higher than normal net 64Cu accumulation. The effect was Cu-specific since 65Zn(II) accumulation was normal with the mutant hepatocytes. The results are consistent with expression of the primary defect at the cellular level in the liver in the mouse mutants, and by inference, Menkes disease.

The kinetics of copper efflux from rat hepatocytes were determined to further characterize the hepatic Cu(II) transport system. Efflux was biphasic. Net efflux was rapid for 1-5 min, and 35-45% of preloaded copper was lost by 40 min. Efflux was negligible after 40 min. The retained percentage was independent of the preloading concentration, but the total amount of intracellular copper that was available for efflux gradually decreased as the duration of the preloading period increased. Unlabeled extracellular Cu(II) displaced 64Cu from intracellular pools, but exchange with intracellular Cu was not required for uptake. Zinc also displaced copper but less effectively than copper. This implies some specificity in intracellular binding components. No transstimulation of uptake or efflux was detected. Copper efflux was strictly passive. Extracellular Cu(II) decreased the rate of efflux and preloading inhibited Cu(II) uptake. Metabolic inhibitors had no effect on the rate or total amount of 64Cu efflux, and significant efflux occurred at 4 degrees C. Moreover, when a steady state was attained at the end of a preloading period, the effective intracellular concentration of free copper approximated the Cu(II) concentration in the extracellular medium. By use of this estimate for the intracellular concentration of free copper, efflux kinetic parameters were obtained from initial (1-min) rate data (Km = 5.5 +/- 0.8 microM; Vmax = 1.1 +/- 0.1 nmol X min-1 X mg prot-1). These parameters are similar to those obtained for Cu(II) uptake, and the saturation kinetics observed are consistent with specific facilitated efflux by this copper transport system.(ABSTRACT TRUNCATED AT 250 WORDS)

The effects of plasma Cu(II) ligands on the kinetics of Cu(II) transport by rat liver parenchymal cells were determined to examine how Cu(II) is mobilized from plasma and transported into liver cells. Albumin markedly inhibited Cu(II) uptake at Cu(II)-to-albumin molar ratios of 3:1 or less. Kinetic analyses showed that albumin inhibits Cu(II) uptake by reducing the concentration of free Cu(II) in solution. Under conditions of excess albumin to Cu(II), histidine facilitated albumin-inhibited uptake of Cu(II). Threonine, glutamine, and most other amino acids were without effect. Moreover, the facilitation effect of a low-molecular-weight plasma fraction (less than or equal to 5,000) was largely accounted for by its histidine concentration. The tripeptide Gly-His-Lys also inhibited Cu(II) uptake into hepatocytes by the same mechanism as albumin. The inhibitory effects of albumin and Gly-His-Lys were additive with or without histidine. The active species in the Cu(II), albumin, and histamine mixtures was shown to be the His2Cu(II) complex. Vmax for this complex was identical to the Vmax for free Cu(II), but the Km was slightly higher [15 microM vs. 11 microM for free Cu(II)]. Concurrent determinations of [3H]-histidine and 64Cu(II) uptake showed that histidine was not transported with Cu(II) from His X Cu(II) or His2Cu(II) complexes. The data are consistent with histidine mobilizing Cu(II) from albumin by competing for Cu(II), interaction of the His2Cu(II) complex with the putative hepatic copper transport protein, and transport of copper as free ionic copper.

The vitamin D-dependent intestinal calcium binding protein (ICaBP, 9 kDa) is under transcriptional regulation by 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3], the hormonal active form of the vitamin. To study the mechanism of gene regulation by 1,25-(OH)2D3, we isolated the rat ICaBP gene by using a cDNA probe. Its nucleotide sequence revealed 3 exons separated by 2 introns within approximately 3 kilobases. The first exon represents only noncoding sequences, while the second and third encode the two calcium binding domains of the protein. The gene contains a 15-base-pair imperfect palindrome in the first intron that shows high homology to the estrogen-responsive element. This sequence may represent the vitamin D-responsive element involved in the regulation of the ICaBP gene. The second intron shows an 84-base-pair-long simple nucleotide repeat that implicates Z-DNA formation. Genomic Southern analysis shows that the rat gene is represented as a single copy.

A cDNA encoding the vitamin D-dependent rat intestinal calcium-binding protein has been isolated by screening a rat intestinal cDNA library. The cDNA is 406 nucleotides long and appears to contain all the sequences of the mRNA. The cDNA includes the entire protein coding region. It consists of 237 nucleotides coding for 79 amino acids, including the starting methionine, flanked by 62 and 107 noncoding nucleotides at the 5' and 3' ends, respectively. Using the cloned cDNA, we have isolated a genomic clone from a rat liver genomic library. Restriction mapping and Southern analysis using synthetic oligonucleotides localized the gene to a 4.0-kilobase-pair HindIII fragment.

Uptake and efflux of 64Cu were examined to determine whether hepatic parenchymal cells exhibit the kinetic criteria of a specific transport system for copper and related trace metals. Saturation kinetics were clearly indicated by both v versus [Cu] and 1/v versus 1/[Cu] plots (Km = 11 +/- 0.6 microM and Vmax = 2.7 nmol Cu X min-1 X mg prot-1). Identical results were obtained by cold-copper analyses, and contributions from simple diffusion or nonspecific binding were not detected. Virtually all of the accumulated 64Cu was intracellular by 0.5 min (the initial velocity period), with approximately 40% in the cytosolic fraction. Several related trace metals inhibited 64Cu uptake, but Ni(II) at a 10:1 molar excess did not. Zn(II) acted as a simple competitive inhibitor of 64Cu uptake (Ki = 16 microM). Efflux from preloaded cells was biphasic, with an initial rapid phase of approximately 5 min. Approximately 35% of preloaded 64Cu was transported out of the cells by 40 min, and little efflux occurred thereafter. Thus, hepatocytes exhibit saturation kinetics, competition by related substrates, and countertransport criteria of specific facilitated transport. A wide variety of metabolic inhibitors have no effect on 64Cu uptake under the same conditions that inhibit the active transport of bile acids. Specific inhibitor tests for electrogenic coupling were also negative. Because the identical kinetic parameters were obtained for free 64Cu and the 1:1 64Cu-histidine complex, it is inferred that copper is probably transported as the free ion. Cells incubated with greater than or equal to 10 microM 64Cu showed a net loss of copper after 40- to 60-min incubation, which may involve specific hepatic mechanisms in copper homeostasis.