Search

Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.

SiDWF1 encodes a gibberellin receptor GID1B-like protein controlling the internode length and plant height in sesame. Sesame is a high-height crop. Here we systematically analyzed the morphological and genetic characters of the sesame dwarf mutant dw607 (dwf1 type). The plant height and the internode length of dw607 significantly declined, while the thousand seed weight (TSW) significantly increased (P

There are about 20,000 sesame germplasm accessions in the world. South Korea, India, China, and some African countries are the main countries reserving sesame germplasm. However, sesame is the sole cultivated Sesamum species for seed production. The relatively narrow genetic base limits the progress of the world's sesame breeding. Deficiency of the elite accessions also hinders the variety improvement. In the past decades, mutagenesis techniques have been applied for creation of new sesame germplasm and for breeding varieties. In this section, we summarize the main progress in mutation induction methods and mutant creation in sesame. Some key mutants with determinacy, dwarf, and other elite traits are enumerated in detail. The importance of mutagenesis approach in sesame is also discussed.

Sesame is distributed widely in the tropical and subtropical regions of the world. The cultivation history of sesame dates back to over 5000 years ago. In this section, the botanical features and growth characteristics of sesame including root, stem, leaf, flower, capsule, and seed are discussed. The overview summarizes the species-specific morphological characteristics of sesame and provides the fundamentals for sesame genetics and genomics research. In addition, the wild species are also described.

The chromosome morphology, chromosome structure, karyotype, and the chromosome set relationship in Sesamum are presented in this chapter. Besides, the modified chromosome preparation and application of BAC-FISH techniques are briefly introduced at the same time. The 13 chromosomes of S. indicum have been identified and marked using 27 BACs. A high-density cytogenetic map for sesame is constructed with 210 BACs using successive double-colored BAC-FISH. A tetraploid species S. radiatum was initially determined using the cytogenetic data. The main progress in cytogenetical research in Sesamum species provides the theoretical basis for further genomic research in Sesmaum.

Improving levels of yield potential, seed quality, resistance to biotic and abiotic stresses, and the adaptation to cultivation mechanization are still the main breeding objectives in sesame in the past decades. To understand the species-specific genetic characteristics of sesame, we review the progress of classical genetics of the key traits including the phenology characters related to the growth and development, yield-related traits, seed quality traits, stress tolerance, and other important morphological and agronomic traits in sesame in this chapter. Especially, plenty of classical genetic studies of the quantitative traits in different genotypes and environments presented by worldwide sesame scientists are reviewed. The results of the classical genetic analysis provide the theoretical basis for elite alleles collection and molecular marker-assisted selection (MAS) in sesame breeding.

S. indicum is the sole cultivated species in the genus Sesamum. The relatively low genetic diversity in the cultivated species limits the development of new varieties through breeding. In this chapter, the main breeding methods in sesame including space mutation, heterosis application, hybridization, system breeding, and interspecific hybridization are introduced. Main achievements of the new varieties breeding in China, USA, and African countries are shown in this chapter. The main breeding objectives of the world sesame are discussed accordingly.

Sesame is an ancient oilseed crop. In this chapter, we introduce the status of sesame production and the world trade, cultivation styles, and seed nutrition. With the increase of harvested area and the yield level, the world sesame production is accelerating. The increasing demand in the market is stimulating the development of the sesame industry. In sesame seeds, high unsaturated fatty acids, proteins, minerals, and antioxidants result in the high value of sesame products. The nutritional and pharmaceutical advantages of sesame in food industry and medicine industries are concisely recognized and valued.

With the development of sesame industry in the world, the requirement for increasing the breeding efficiency and realizing various breeding objectives with the aid of modern molecular breeding techniques has become more and more urgent. In order to realize molecular breeding and concisely aggregate the elite genes into new varieties in sesame, deciphering a great amount of genes or molecular markers and elucidating the sesame genome characters are the key issues. Based on the above requisites, Henan Sesame Research Center, Henan Academy of Agricultural Sciences, China organized the Sesame Genome Working Group (SGWG) in 2009 and initiated the Sesame Genome Project (SGP) in 2010. The organizational background of SGWG and the targets of the SGP are also introduced in this chapter.

The Sesame Genome Working Group sequenced the genomes of the six wild Sesamum species, i.e., S. alatum (2n = 26, var. 3651), S. latifollum (2n = 32, var. KEN1), S. angolense (2n = 32, var. K16), S. calycinum (2n = 32, var. KEN8), S. angustifolium (2n = 32, var. G01), and S. radiatum (2n = 64, var. G02), which cover all three types of the basic chromosome number of the genus Sesamum. We describe the complicated sequencing and assembly strategies for the wild species and the first interspecific single nucleotide polymorphism (SNP) genetic map for Sesamum. The chromosome-scaled genome assemblies of the six wild Sesamum species are deliberated in this chapter.

Next-generation sequencing (NGS) technology has reinforced the development of the molecular genetic research in sesame in the recent two decades. In the early stage, most sesame scientists endeavored to develop more specific DNA markers with high polymorphism and to construct the molecular genetic maps for sesame with the aid of the limited expressed sequence tag (EST) and transcriptome information. In the recent decade, a lot of sesame genome information stimulated rapid progresses in the molecular genetics analysis of important agronomic traits in sesame. In this chapter, we overview the main achievements of the high-resolution molecular genetic map construction, quantitative trait loci (QTLs) mapping related to the key traits, map location of molecular markers, and identification of the key functional genes in sesame. Especially, several successful examples for gene location and detection of molecular markers associated with yield, seed quality, disease resistance, and other key agronomic traits in sesame are enumerated. The prospects and strategies for establishing the molecular breeding techniques in sesame are also discussed.

Plant tissue culture and genetic transformation are powerful biotechniques for plant genetic improvement. For sesame, in vitro callus induction and differentiation with high efficiency are very difficult because of the specific characters of the species, and employing genetic transformation is too difficult. In the past forty years, many scientists tried a huge number of experiments in order to establish efficient callus induction and plantlet regeneration system in sesame. In this section, we present the history and the main progresses of sesame tissue culture and gene transformation research. Several successful examples for plant regeneration and gene transformation in sesame are listed. In addition, the main factors influencing the efficiency of tissue culture, plantlet regeneration, and gene transformation are discussed. The application prospect of tissue culture and gene transformation in sesame genetics and breeding research is also introduced.

In plants, chloroplast genomes are a group of non-nuclear genomes and exhibit different genome structure and evolutionary characters from the nuclear genomes. In order to investigate the species-specific evolutionary characters, the complete chloroplast (cp) genome (GenBank no. JN637766) of S. indicum cv. Ansanggae (black-seeded) and the cp genome (GenBank no. KC569603) of S. indicum cv. Yuzhi 11 (white seeded) have been sequenced. Comparison of the cp genomes between sesame and other plants and the application of the cp genome information in genome evolution analysis are elucidated in this chapter.

Repetitive DNA sequences are the homologous DNA fragments with multiple copies and are the main components in higher plant genomes. Reliable chromosome-scaled genome assembly provided abundant genome information regarding genome structure research in sesame. In this chapter, we present the genome structure character and distribution of interspersed repeat sequences and the tandem repeats in the assembled genome of sesame var. Yuzhi 11 (version 3.0). For S. indicum, the content of interspersed repeat sequences is 46.11%. Of the five groups of interspersed repetitive sequences, i.e., SINEs, LINEs, long terminal repeat (LTR) element, DNA element, and unknown dispersed repeat elements, LTR group is the biggest known repeat type and occupies 11.41% of the assembled genome (335 Mb). Ty1-Copia is the major superfamily in LTR-RTs. In sesame genome, distribution of the tandem repeats, such as rDNA, telomere, and centromere repeats, reflects the character of species. Cytogenetic analyses and genome structure showed that the individual 26 chromosomes in S. indicum have telomeric repeats at the terminal position. The telomeres of sesame are conserved, and the repeat sequences are same with the common repeat unit of TTTAGGG. A total of 1235 telomeric repeat of (TTTAGGG)3 were found in the assembled genome. Meanwhile, about three thousand 45S and 5S rDNA repeats are detected in the assemble genome, which accord with the rDNA content range in other plants. Distribution characters and copy number of telomeres and rDNAs reflect the relative completeness of the assembled sesame genome. In addition, distribution of simple sequence repeats (SSRs) in sesame genome also has been precisely analyzed. A 153 bp centromeric repeat sequence is identified in sesame genome for the first time, which supplies more information for exploring the genome evolution of Sesamum.

The invention of Sanger sequencing initiated the genome era. The development and application of next-generation sequencing (NGS) technologies facilitated genome sequencing in organisms. Here we introduce the main technologies including Sanger sequencing, Roche-454 massive parallel pyrosequencing, Solexa/Illumina sequencing, ABI SOLiD platform, PacBio SMRT platform, HiC sequencing, Oxford nanopore sequencing, and Bionano sequencing platform, as mostly are applied in the Sesame Genome Project (SGP). The characteristics of each technology are briefly discussed. For the SGP, the hybrid sequencing strategies involving the first generation, NGS, and the third generation sequencing technologies are applied to assemble the fine genome map with high accuracy and completeness. Combined with the genome size estimation and genome characters of sesame, the efficient sequencing strategies are elucidated in this section.

The achievement of the Sesame Genome Project supplies the necessary information for sesame genome assisted selection breeding. The information of the structural genomics and functional genomics research in sesame provides the foundation of genome architecture analysis. Cloning of many genes and gene families makes the possibility of aggregating a number of elite traits in new varieties. In order to enhance the variety improvement, the specific genome assisted selection breeding technology for sesame is designed and discussed in this chapter. The potential of the genome assisted selection and gene design breeding in sesame is forecasted accordingly.

In genomes, genes are the most important components because of the function in controlling various biological traits and regulating the complex biological processes in plants. Reliable chromosome-scaled genome assembly supplies the abundant and precise genome information for gene and gene family research in sesame. In this chapter, we deliberate on the main techniques used for genome annotation and gene prediction in sesame (var. Yuzhi 11). Distribution of all genes and gene families in sesame genome is described. Meanwhile, the main research achievements in some key gene families related to key biological processes, such as fatty acid biosynthesis and metabolism and responses to environmental conditions in sesame, are discussed in the section.

Genome assembly strategy is a crucial step for reconstructing high-quality genomes in any genome project. With the continuous innovation of new sequencing platforms, various methods of genome assembly have been developed and applied in genome assembly. In order to construct a fine genome map for sesame, the Sesame Genome Working Group (SGWG) group analyzed and optimized the assembly strategy for sesame according to the various sequencing data and genome characteristics. The comprehensive genome assembly strategy for sesame comprised the next generation sequencing (NGS), the third assembly platforms, and Hi-C assembly strategy with supplementation of high-dense single nucleotide polymorphism (SNP) genetic map and bacterial artificial chromosome—fluorescent in situ hybridization (BAC-FISH) cytogenetic map. Comparison results of the specific and high-efficient assembly techniques in sesame were discussed in this chapter. The final assembled genome of sesame (cv. Yuzhi 11) comprises of 335 megabase (Mb) sequences with high completeness. About 313 Mb sequences are assembled into the 13 chromosome molecules. High accuracy and integrity of the assembled genome indicates the suitable genome assembly for sesame. The results provide an extraordinary example of the application of high-quality genome assembly techniques in higher plants with large genomes.

Background Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. Results For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. Conclusions SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame. Electronic supplementary material The online version of this article (10.1186/s12870-018-1503-2) contains supplementary material, which is available to authorized users.

Sesame (Sesamum indicum L.; Pedaliaceae) is a commercially valuable oilseed crop with high oil content. Its small genome size favours the genomic analysis of key biological processes, such as oil synthesis and metabolism. However, the 13 chromosome pairs of sesame have not been characterised because of technological limitations and their small size. We constructed a BAC library comprising 57,600 BAC clones for sesame. The estimated genome coverage of the sesame BAC library was 13.8×. The successive double colour fluorescence in situ hybridisation (FISH) with bacterial artificial chromosomes (BACs) for sesame was established in this study. Subsequently, the 13 sesame chromosome pairs were individually differentiated using 17 specific BACs for the first time. The schematic of the sesame chromosome set was drawn according to the chromosome relative length and relative position of the BAC signal. The cytogenetic characteristics of sesame chromosomes were also explored. The results provide the technical background required for further cytogenetic map construction, genome assembly and localisation of the DNA sequence in sesame.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.

Sesame is an important oilseed crop with high oil content and oil quality. Abundant unsaturated fatty acids, proteins, and antioxidants in sesame seeds attract the worldwide consumption of sesame products. Sesame is highly tolerant of drought and poor soil condition, even though it is readily affected by diseases and waterlogging stress, thereby leading to reduced seed yield and quality. For sesame, increasing the high and stable yield is requisite and urgent. Meanwhile, it is necessary to increase the mechanization level of its harvest for the world’s sesame production. Sesame, S. indicum, is the sole cultivated species in Sesamum genus. The relatively low genetic diversity limits sesame breeding for new and substantial improved varieties. In this section, we present a review of the key agronomic traits and the breeding methods currently used in the species. We also pinpoint the achievement of the Sesame Genome Project (SGP) and the potential for the genomics-assisted breeding in sesame.

Sesame Fusarium wilt (FW) is a worldwide and hardly controlled fungus disease in sesame. Till now, the molecular resistance mechanism of sesame to FW remains unknown. The two resistant and susceptible sesame varieties, that is ‘Yuzhi 11’ and Rongxian black sesame (RXBS), were inoculated with Fusarium oxysporum f. sp. sesami (Fos) pathogens for 0, 6, 24 or 24 and 48h, respectively. Then, transcriptome samples were sequenced and surveyed systematically using RNA-seq technology. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that ‘phenylpropanoid biosynthesis’ pathway may play more important role in sesame resistance after Fos inoculation. Furthermore, qRT-PCR results demonstrated that the phenylpropanoid pathway with an emphasis on the synthesis of lignin contributes to the sesame disease resistance. Moreover, activity of phenylalanine ammonia lyase (PAL) and peroxidase (POD) proved the differences of gene expression patterns in the two sesame phenotypes. Overall, we speculated that the difference of FW symptoms between the resistant and susceptible plants might depend on whether the plants could activate the pathway timely and efficiently or not. The findings would help to clarify the molecular mechanism of sesame resistance to FW.

Cultivated sesame (Sesamum indicum L.) is an important oil crop because of its high oil content and quality. In order to discover the single nucleotide polymorphisms (SNPs) and insertion/deletions (InDels) in RNA-Seq, we collected a total of 33.47 Gbp of data from three sesame transcriptome datasets. A reference transcriptome covering 267,508 unigenes was constructed. Among the 37,646 transcripts with complete open reading frames, a total of 7,450 SNPs and 362 InDels were found with frequencies of one SNP per 6.66 kb and one InDel per 137 kb, respectively. Most of the SNPs were transition-type with the nucleotide transitions C–T or A–G. A total of 21 InDel types with lengths ranging from 1 to 38 bp were identified, and the short InDels (1–2 bp) were most abundant at a ratio of over 80 %. Furthermore, 4,959 (66.56 %) SNPs were detected in protein-coding regions: 2,899 (58.46 %) were synonymous and 2,060 (41.54 %) were nonsynonymous. All SNPs and InDels detected in this study were bi-allelic. Of the randomly selected 40 SNPs and 40 InDels, 92.5 % of the SNPs and 95.0 % of the InDels exhibited polymorphism according to the PCR-based and Sanger-sequenced results. Furthermore, the efficiencies of the newly developed polymorphic SNP and InDel markers were evaluated among 36 commercial sesame cultivars. More than 90.0 % of the markers displayed the expected polymorphic amplifications. The polymorphism information content values ranged from 0.05 to 0.58 with an average of 0.38. Moreover, all genotypes of the 36 commercial cultivars tested were definitively distinguished by 21 SNPs and 16 InDels. These newly identified molecular markers may provide a foundation for cultivar identification, genetic diversity analysis, qualitative and quantitative trait mapping and marker-assisted selection breeding in sesame.

Sesame (Sesamum indicum L.) is an important oilseed crop and has an indeterminate growth habit. Here we resequenced the genomes of the parents and 120 progeny of an F2 population derived from crossing Yuzhi 11 (indeterminate, Dt) and Yuzhi DS899 (determinate, dt1) and constructed an ultra-dense SNP map for sesame comprised of 3,041 bins including 30,193 SNPs in 13 linkage groups (LGs) with an average marker density of 0.10 cM. Results indicated that the same recessive gene controls the determinacy trait in dt1 and a second determinate line, dt2 (08TP092). The QDt1 locus for the determinacy trait was located in the 18.0 cM–19.2 cM interval of LG8. The target SNP, SiDt27-1 and the determinacy gene, DS899s00170.023 (named here as SiDt), were identified in Scaffold 00170 of the Yuzhi 11 reference genome, based on genetic mapping and genomic association analysis. Unlike the G397A SNP change in the dt1 genotype, the SiDt allele in dt2 line was lost from the genome. This example of map-based gene cloning in sesame provides proof-of-concept of the utility of ultra-dense SNP maps for accurate genome research in sesame.

Sesame (Sesamum indicum L.) is an ancient and important oilseed crop. However, few sesame reference genes have been selected for quantitative real-time PCR until now. Screening and validating reference genes is a requisite for gene expression normalization in sesame functional genomics research. In this study, ten candidate reference genes, i.e., SiACT, SiUBQ6, SiTUB, Si18S rRNA, SiEF1α, SiCYP, SiHistone, SiDNAJ, SiAPT and SiGAPDH, were chosen and examined systematically in 32 sesame samples. Three qRT-PCR analysis methods, i.e., geNorm, NormFinder and BestKeeper, were evaluated systematically. Results indicated that all ten candidate reference genes could be used as reference genes in sesame. SiUBQ6 and SiAPT were the optimal reference genes for sesame plant development; SiTUB was suitable for sesame vegetative tissue development, SiDNAJ for pathogen treatment, SiHistone for abiotic stress, SiUBQ6 for bud development and SiACT for seed germination. As for hormone treatment and seed development, SiHistone, SiCYP, SiDNAJ or SiUBQ6, as well as SiACT, SiDNAJ, SiTUB or SiAPT, could be used as reference gene, respectively. To illustrate the suitability of these reference genes, we analyzed the expression variation of three functional sesame genes of SiSS, SiLEA and SiGH in different organs using the optimal qRT-PCR system for the first time. The stability levels of optimal and worst reference genes screened for seed development, anther sterility and plant development were validated in the qRT-PCR normalization. Our results provided a reference gene application guideline for sesame gene expression characterization using qRT-PCR system. Electronic supplementary material The online version of this article (doi:10.1007/s00425-012-1805-9) contains supplementary material, which is available to authorized users.

In this paper, electromagnetic scattering from one dimensional dielectric sea surface is investigated, for both TE and TM polarizations, employing the second-order small slope approximation (SSA-II). The second order terms of the small slope approximation method have been numerically implemented in order to obtain accurate results for a large range of slope. The sea surfaces are modeled as realizations of a Gaussian random process with the Pierson-Moskowitz spectrum, while the tapered incident wave is chosen to reduce the truncation error. The numerical results obtained by SSA-II are presented by comparison with benchmark numerical method.

Sesame (Sesamum indicum L.) is one of the oldest oilseed crops. In order to investigate the evolutionary characters according to the Sesame Genome Project, apart from sequencing its nuclear genome, we sequenced the complete chloroplast genome of S. indicum cv. Yuzhi 11 (white seeded) using Illumina and 454 sequencing. Comparisons of chloroplast genomes between S. indicum and the 18 other higher plants were then analyzed. The chloroplast genome of cv. Yuzhi 11 contains 153,338 bp and a total of 114 unique genes (KC569603). The number of chloroplast genes in sesame is the same as that in Nicotiana tabacum, Vitis vinifera and Platanus occidentalis. The variation in the length of the large single-copy (LSC) regions and inverted repeats (IR) in sesame compared to 18 other higher plant species was the main contributor to size variation in the cp genome in these species. The 77 functional chloroplast genes, except for ycf1 and ycf2, were highly conserved. The deletion of the cp ycf1 gene sequence in cp genomes may be due either to its transfer to the nuclear genome, as has occurred in sesame, or direct deletion, as has occurred in Panax ginseng and Cucumis sativus. The sesame ycf2 gene is only 5,721 bp in length and has lost about 1,179 bp. Nucleotides 1–585 of ycf2 when queried in BLAST had hits in the sesame draft genome. Five repeats (R10, R12, R13, R14 and R17) were unique to the sesame chloroplast genome. We also found that IR contraction/expansion in the cp genome alters its rate of evolution. Chloroplast genes and repeats display the signature of convergent evolution in sesame and other species. These findings provide a foundation for further investigation of cp genome evolution in Sesamum and other higher plants.

The Sesame Genome Working Group (SGWG) has been formed to sequence and assemble the sesame (Sesamum indicum L.) genome. The status of this project and our planned analyses are described.

Background Sesame (Sesamum indicum L.) is one of the most important oil crops; however, a lack of useful molecular markers hinders current genetic research. We performed transcriptome sequencing of samples from different sesame growth and developmental stages, and mining of genic-SSR markers to identify valuable markers for sesame molecular genetics research. Results In this study, 75 bp and 100 bp paired-end RNA-seq was used to sequence 24 cDNA libraries, and 42,566 uni-transcripts were assembled from more than 260 million filtered reads. The total length of uni-transcript sequences was 47.99 Mb, and 7,324 SSRs (SSRs ≥15 bp) and 4,440 SSRs (SSRs ≥18 bp) were identified. On average, there was one genic-SSR per 6.55 kb (SSRs ≥15 bp) or 10.81 kb (SSRs ≥18 bp). Among perfect SSRs (≥18 bp), di-nucleotide motifs (48.01%) were the most abundant, followed by tri- (20.96%), hexa- (25.37%), penta- (2.97%), tetra- (2.12%), and mono-nucleotides (0.57%). The top four motif repeats were (AG/CT)n [1,268 (34.51%)], (CA/TG)n [281 (7.65%)], (AT/AT)n [215 (5.85%)], and (GAA/TTC)n [131 (3.57%)]. A total of 2,164 SSR primer pairs were identified in the 4,440 SSR-containing sequences (≥18 bp), and 300 SSR primer pairs were randomly chosen for validation. These SSR markers were amplified and validated in 25 sesame accessions (24 cultivated accessions, one wild species). 276 (92.0%) primer pairs yielded PCR amplification products in 24 cultivars. Thirty two primer pairs (11.59%) exhibited polymorphisms. Moreover, 203 primer pairs (67.67%) yielded PCR amplicons in the wild accession and 167 (60.51%) were polymorphic between species. A UPGMA dendrogram based on genetic similarity coefficients showed that the correlation between genotype and geographical source was low and that the genetic basis of sesame in China is narrow, as previously reported. The 32 polymorphic primer pairs were validated using an F2 mapping population; 18 primer pairs exhibited polymorphisms between the parents, and 14 genic-SSRs could be integrated into 9 main linkage groups. Conclusions 2,164 genic-SSR markers have been developed in sesame using transcriptome sequencing. 276 of 300 validated primer pairs successfully yielded PCR amplicons in 24 cultivated sesame accessions. These markers increase current SSR marker resources and will greatly benefit genetic diversity, qualitative and quantitative trait mapping and marker-assisted selection studies in sesame.