Search

Stress urinary incontinence (SUI) impacts ~1/3 of women over age 50. Negative publicity around PP meshes used in pelvic prolapse repair drives the need for identifying alternative biomaterials for SUI repair. Our study evaluated in vivo response to collagen sling implanted in an ovine model. Electrocompacted collagen threads were filament wound as slings and crosslinked in genipin. Collagen slings were implanted suburethrally mimicking the transvaginal tape technique. Main study groups were: Collagen sling (n = 3, 6 months) and PP sling (n = 3, 6 months). Collagen sling was also tested at 3-weeks (n = 1) to observe early-stage tissue response and 1-year (n = 2) to assess biomaterial longevity in a preliminary capacity. Collagen slings healed to a fibrous ligament texture at 6 months and maintained such texture to 1 year. Histological scoring indicated biocompatible responses to collagen slings with no adverse events. All study groups exhibited complete tissue ingrowth and interstitial de novo collagen deposition at all time points. Collagen threads induced orderly de novo collagen deposition that was aligned along long axes of threads. Tissue infiltrated collagen slings that were explanted at 6 and 12 months presented similar structural strength with native tissues such as vagina and fascia, and PP (Lynx) slings (p .05). With the limitation of low number of animals per time point in hindsight, this preliminary study justifies evaluation of collagen slings in a larger sample size of animals, particularly to assess persistence of ligamentous tissue response over longer durations than 1-year.

BACKGROUND: Many variables may affect the cost of open radical cystectomy (RC) care, including surgical approach, diversion type, patient comorbidities, and postoperative complications. OBJECTIVE: To determine factors associated with changes in cost of care following open radical cystectomy (ORC) for bladder cancer using the National Inpatient Sample (NIS). METHODS: Patients in the NIS with a diagnosis of bladder cancer who underwent ORC with ileal conduit from 2012–2017 using ICD-9-CM and ICD-10-CM codes were identified. Baseline demographics including age, race, region, postoperative complications, and length of stay were obtained. Univariable and multivariable logistic regression were used to identify factors associated with cost variation including demographics, clinical characteristics, surgical factors, and discharge quarter (Q1-Q4). RESULTS: 5,189 patients were included in the analysis, with 4,379 at urban teaching hospitals. On multivariable regression analysis, female sex [$1,734 ($1,024–2,444) p

While microbiome and host regulation contribute independently to many disease states, it is unclear how circumcision in pediatric population influences subsequent changes in penile microbiome.Our study aims to analyze jointly paired taxonomic profiles and assess pathways implicated in inflammation, barrier protection, and energy metabolism.We analyzed 11 paired samples, periurethral collection, before and after circumcision, to generate microbiome and mycobiome profiling. Sample preparation of 16S ribosomal RNA and internal transcribed spacer sequencing was adapted from the methods developed by the National Institutes of Health Human Microbiome Project.We obtained the predictive functional attributes of the microbial communities between samples using Silva-Tax4Fun and the Greengenes-Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) approach. The predictive functioning of the microbial communities was determined by linearly combining the normalized taxonomic abundances into the precomputed association matrix of Kyoto Encyclopedia of Genes and Genomes orthology reference profiles.Several notable microbiome and mycobiome compositional differences were observed between pre- and postcircumcision patients. Pairwise comparisons across taxa revealed a significant decrease (p 0.05, false discovery rate corrected) of microbiome organisms (Clostridiales, Bacteroidales, and Campylobacterales) and mycobiome (Saccharomycetales and Pleosporales) following circumcision. A total of 14 pathways were found to differ in abundance between the pre- and postcircumcision groups (p 0.005, false discovery rate0.1 and linear discriminant analysis score3; five enriched and nine depleted). The pathways reduced after circumcision were mostly involved with amino acid and glucose metabolism, while pathways prior to circumcision were enriched in genetic information processing and transcription processes. As expected, enrichment in methyl-accepting chemotaxis protein, an integral membrane protein involved in directed motility of microbes to chemical cues and environment, occurred prior to circumcision, while the filamentous hemagglutinin pathway (a strong immunogenic protein) was depleted after circumcision CONCLUSIONS: Our results offer greater insight into the host-microbiota relationship of penile circumcision and may serve to lay the groundwork for future studies focused on drivers of inflammation, infection, and oncogenesis.Our study showed a significant reduction in bacteria and fungi after circumcision, particularly anaerobic bacteria, which are known to be potential inducers of inflammation and cancer. This is the first study of its kind showing the changes in microbiome after circumcision, and some of the changes that occur in healthy infants after circumcision that may explain the differences in cancer and inflammatory disorders in adulthood.

The benefit of cytoreductive nephrectomy (CN) in metastatic renal cell carcinoma (mRCC) was first called into question in the tyrosine kinase inhibitors (TKIs) era. It remains undefined in the context of the recent development and approval of immune checkpoint inhibitors (ICIs) and level one evidence supporting the rapid adoption of dual ICI and combination ICI + TKI therapeutic approaches for mRCC. Our objective is to synthesize the available contemporary data regarding the safety, feasibility, and oncologic outcomes with CN for mRCC in the age of immunotherapy as well as to highlight trials in progress that will address this key knowledge gap.Data from the SURTIME and CARMENA trials provided insight to guide patient selection for CN in patients with mRCC receiving TKI-based treatment strategies. At present, there is a body of retrospective data supporting the safety and oncologic efficacy of CN in carefully selected patients with mRCC in both the upfront and delayed setting. The results of ongoing trials evaluating the safety and feasibility for CN as well as optimal patient selection and sequencing strategies are eagerly awaited.Although the optimal selection criteria and timing for CN remains to be established for patients with mRCC in the immunotherapy era, the available body of evidence underscores the importance of careful patient selection. Ongoing prospective studies, such as Cyto-KIK , PROBE , and NORDIC-SUN , will better define the role of CN in the rapidly evolving treatment landscape for mRCC.

Background The application of next generation sequencing techniques has enabled characterization of urinary tract microbiome. Although many studies have demonstrated associations between the human microbiome and bladder cancer, they have not always reported consistent results, thereby necessitating cross-study comparisons. Thus, the fundamental questions remain how we can utilize this knowledge. The aim of our study was to examine for disease-associated changes in urine microbiome communities globally utilizing machine learning algorithm. The results were further validated using our own prospectively collected urine of bladder cancer patients. Results Our study included 129 bladder cancer urine samples, and 60 healthy controls across four different countries. At a meta-analysis false discovery rate (FDR) of 0.01, we identified a total of 97/548 genera to be differentially abundant in the BCa microbiome compared to healthy patients. Overall, while the differences in diversity metrics were clustered around the country of origin (Kruskal Wallis, P

Introduction: While the prognostic value of immune system biomarkers has been well explored, role of cancer associated macrophages in bladder cancer(BC) is unclear due to lack of consistent results, coupled with tissue nonspecific transcriptomic signature. Methodology: Data acquisition from 3,936 patients of The Cancer Genome Atlas (TCGA) in addition to Gene Expression Omninus (GEO) data sets GSE13507, GSE16945, GSE48277, GSE32894, GSE149582, as well as European Genotype Phenotype EGAS000001004507 was obtained. Tumor associated macrophages M1 and M2 were defined utilizing 188 and 159 gene expression profiles via xCell computational algorithm. To obtain bladder tissue residence macrophage signatures, scRNA seq was performed on tissue collected from surgical resection of 5 HG bladder cancer patients and 2 healthy controls. CellRanger software package with default parameters was utilized giving a total of 8,068 cells. FindAllMarkers was utilized for integration of DEG genes (cancer vs control) among the cluster and identification of BC macrophage specific markers. Endpoint of OS were measured in months from the time of cystectomy to follow up. Results: Surprisingly, presence of M1 infiltration was found to be associated with improved OS in two out of eight cohorts only (GSE32894, GSE70691, p Conclusion: Our study represents the largest TAMs evaluation of BC across 8 cohorts with additional scRNA seq exploration of tissue specific signatures, demonstrating no association with OS in bladder cancer. Citation Format: Laura Bukavina, Spencer Bell, Daniel Geynisman, Ilaha Isali, Daniel Ranti, John Sfakianos, Henkel Valentine, Adam Calaway, Alexander Kutikov, Andres Correa, Robert Uzzo, Lee Ponsky, Philip Abbosh. Macrophage transcriptomic signature validation in scRNA seq and overall survival differences in urothelial carcinoma. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5141.

Background: Successful management of massive rotator cuff (RC) tendon tears represents a treatment challenge because of the limited intrinsic healing capacity of native tendons and the risk of repair failure. Biologic augmentation of massive RC tears utilizing scaffolds—capable of regenerating bulk tendon tissue to achieve a mechanically functional repair—represents an area of increasing clinical interest. Purpose: To investigate the histological and biomechanical outcomes after the use of a novel biologic scaffold fabricated from woven electrochemically aligned collagen (ELAC) threads as a suture-holding, fully load-bearing, defect-bridging scaffold with or without mesenchymal stem cells (MSCs) compared with direct repair in the treatment of critically sized RC defects using a rabbit model. Study Design: Controlled laboratory study. Methods: A total of 34 New Zealand White rabbits underwent iatrogenic creation of a critically sized defect (6 mm) in the infraspinatus tendon of 1 shoulder, with the contralateral shoulder utilized as an intact control. Specimens were divided into 4 groups: (1) gap—negative control without repair; (2) direct repair of the infraspinatus tendon—operative control; (3) tendon repair using ELAC; and (4) tendon repair using ELAC + MSCs. Repair outcomes were assessed at 6 months using micro–computed tomography, biomechanical testing, histology, and immunohistochemistry. Results: Specimens treated with ELAC demonstrated significantly less tendon retraction when compared with the direct repair group specimens ( P = .014). ELAC + MSCs possessed comparable biomechanical strength (178 ± 50 N) to intact control shoulders (199 ± 35 N) ( P = .554). Histological analyses demonstrated abundant, well-aligned de novo collagen around ELAC threads in both the ELAC and the ELAC + MSC shoulders, with ELAC + MSC specimens demonstrating increased ELAC resorption (7% vs 37%, respectively; P = .002). The presence of extracellular matrix components, collagen type I, and tenomodulin, indicating tendon-like tissue formation, was appreciated in both the ELAC and the ELAC + MSC groups. Conclusion: The application of MSCs to ELAC scaffolds improved biomechanical and histological outcomes when compared with direct repair for the treatment of critically sized defects of the RC in a rabbit model. Clinical Relevance: This study demonstrates the feasibility of repairing segmental tendon defects with a load-bearing, collagen biotextile in an animal model, showing the potential applicability of RC repair supplementation using allogeneic stem cells.

Purpose of review To review current evidence on gene expression in women with urinary incontinence and pelvic organ prolapse (POP). Recent findings Our literature review revealed numerous genes that are associated with urinary incontinence and POP. For overactive bladder and urge urinary incontinence, four genes were highlighted: adrenergic receptor β3, Rho guanine nucleotide exchange factor 10, Rho-associated coiled-coil containing protein kinase 2, and potassium two pore domain channel subfamily K member-1. For Stress Urinary incontinence (SUI), 13 genes were included: skin-derived antileukoproteinase, collagen type XVII alpha 1 chain, plakophilin 1, keratin 16, decorin, biglycan, protein bicaudal D homolog 2, growth factor receptor-bound protein 2, signal transducer and activator of transcription 3, apolipoprotein E, Golgi SNAP receptor complex member 1, fibromodulin, and glucocerebrosidase. For POP seven genes were identified: homeobox A13, matrix metallopeptidase 9, estrogen receptor 2, collagen type XIV alpha 1 chain, collagen type V alpha 1 chain, collagen type IV alpha 2 chain, and catenin beta 1. Summary The current review highlights many genes which are potential biomarkers and targets for drug development.

Genetic factors are implicated in the development of ureteropelvic junction obstruction (UPJO). The aims of this study were: 1) condense and examine the existing data in studies containing information regarding differential gene expression in tissues from patients with UPJO and 2) investigate associations between genetic markers and their related pathways.A systematic review of studies published between January 2000 and September 2021 was conducted using the following databases: Ovid/Medline, PubMed, Wiley Cochrane Central Register of Controlled Trials, Web of Science, and Scopus. Of 249 studies, 10 were included in the final analysis. The search was performed using the terms "ureteropelvic junction obstruction", "genetic", "gene", and "gene expression". Literature pertaining to differential gene expression in UPJO patients as compared to healthy controls was identified. Studies containing gene expression and quantification of molecular data carried out directly on stenotic tissue samples were selected for analysis. Gene network connections and functional analyses were then determined using MetaScape software.From the ten studies identified for analysis, fifteen genes were noted as differentially expressed. In UPJO patients, nine genes were upregulated (ET1, ACTA2, MCP-1, TGFB1, NFKB1, IL-6, HIF1A, S100A1, SYP) and six were downregulated (ADM, NOS2, EGF, PDGFRA, UCHL1, NGFR). These genes were principally involved in HIF-1 signaling pathway, blood vessel development, positive regulation of signaling receptor activity, and Ras signaling pathway.A potential link exists between genes related to hypoxia, excessive fibrous tissue formation, and inflammation in the development of UPJO, and these connections merit more detailed, tissue level investigations in UPJO patients. The outcomes of this systematic review may lay the groundwork for the development of future targeted therapies and novel biomarker detection for treatments, early detection, and possible prediction and prevention of development of UPJO.

The contribution of genetic factors to the presence of an overactive bladder is recognized. This study aimed to (1) assemble and synthesize available data from studies assessing differential gene expression in patients with overactive bladder vs controls without overactive bladder and (2) determine possible correlations and functional pathways between genes.We searched PubMed, Ovid or Medline, and Wiley Cochrane Central Register of Controlled Trials databases between January 1, 2000, and December 15, 2021.Studies were included if gene expression was detected and quantified using molecular approaches performed on human bladder tissue specimens directly and excluded if the gene expression analysis was carried out from blood and urine specimens alone.A systematic review was completed to identify publications that reported differently expressed gene candidates among patients with overactive bladder vs healthy individuals. Gene networking connections and pathway analysis were performed employing Metascape software, where inputs were identified from our systematic review of differentially expressed genes in overactive bladder.A total of 9 studies were included in the final analysis and 11 genes were identified as being up-regulated (purinergic receptor P2X 2 [P2RX2], smoothelin [SMTN], growth-associated protein 43 [GAP43], transient receptor potential cation channel subfamily M member 8 [TRPM8], cadherin 11 [CDH1], gap junction protein gamma 1 [GJC1], cholinergic receptor muscarinic 2 [CHRM2], cholinergic receptor muscarinic 3 [CHRM3], and transient receptor potential cation channel subfamily V member 4 [TRPV4]) or down-regulated (purinergic receptor P2X 2 [P2RX3] and purinergic receptor P2X 5 [P2RX5]) in patients with overactive bladder. Gene network analysis showed that genes are involved in chemical synaptic transmission, smooth muscle contraction, blood circulation, and response to temperature stimulus. Network analysis demonstrated a significant genetic interaction between TRPV4, TRPM8, P2RX3, and PR2X2 genes.Outcomes of this systematic review highlighted potential biomarkers for treatment efficacy and have laid the groundwork for developing future gene therapies for overactive bladder in clinical settings.

Introduction: The sheep was evaluated as a potential model for preclinical evaluation of urethral slings in vivo based on: (1) anatomical measurements of the sheep vagina and (2) histological tissue integration and host response to polypropylene (PP) slings. Methods: Eight female, multiparous sheep were utilized. Three of 8 animals underwent surgery mimicking human tension-free vaginal tape protocols for midurethral slings and were euthanized at 6 months. The following measurements were obtained: vaginal length, maximum vaginal width with retraction, symphysis pubis length, and distance from the pubic bone to incision. Explanted sling samples from sheep and human were stained with hematoxylin and eosin for host reaction assessment. Results: Geometric measurements were similar between humans and sheep. Sheep vaginal anatomy allowed sling placement similar to procedures in human surgeries, and all sheep recovered without problems. Comparative histology between the sheep and human indicated similar host reaction and collagen deposition around implants, confirming suitability of the sheep model for biomaterial response assessment. Conclusion: Sheep vaginal length is comparable to humans. Tissue integration and host response to PP slings showed chronic inflammation with rich collagen deposition around the material in both sheep and human specimens, highlighting the sheep as a potential animal model for preclinical testing of midurethral slings.

Growth signals, which typically originate from the surrounding microenvironment, are important for cells. However, when stimulation by growth factors becomes excessive and exceeds their threshold limit, deleterious effects may ensue. In patients with cancer, maintenance of tumors depends, at least in part, on growth factor stimulation, which can also facilitate cancer progression into advanced stages. This is particularly important when the tumor grows beyond its tissue boundaries or when it invades and colonizes other tissues. These aforementioned malignant events are known to be partly supported by elevated cytokine levels. Among the currently known growth signals, insulin-like growth factor (IGF)-1 and IL-6 have been previously studied for their roles in prostate cancer. Both IGF-1 and IL-6 have been reported to activate the RAPTOR independent companion of MTOR complex 2 (Rictor)/AKT/protein kinase C α (PKCα) signaling pathway as one of their downstream mechanisms. At present, research efforts are mainly focused on the exploration of agents that alter growth factor (such as IGF-1) and cytokine (such as IL-6) signaling for their potential application as therapeutic agents, as both of these have been reported to modulate disease outcome. In the present study, IGF-1 and IL-6 served distinct roles in the androgen responsive LNCaP cell line and in the androgen refractory PC-3 cell line in a dose- and time-dependent manner. Increased phosphorylation of Rictor at the Thr-1135 residue, AKT at the Ser-473 residue and PKCα at the Ser-657 residue were observed after treatment with IGF-1 and IL-6. Subsequently, it was found that diosmetin, a natural plant aglycone, had the potential to modulate the downstream signaling cascade of Rictor/AKT/PKCα to inhibit the progression of prostate cancer. Treatment of LNCaP and PC-3 cells with diosmetin inhibited the phosphorylation of Rictor (Thr-1135), AKT (Ser-473) and PKCα (Ser-657) in a dose-dependent manner. Furthermore, the Bax/Bcl-2 expression ratio was increased in response to diosmetin treatment, which would result in increased apoptosis. Based on these observations, diosmetin may represent a novel therapeutic target for prostate cancer.

A clear and well-documented gender bias exists in the evaluation of sexual outcomes for women undergoing urologic surgery. Due to the anatomic template of anterior exenteration, women are commonly left with side effects that include sexual dysfunction and the perpetuated effects of surgical menopause.To present evaluation and treatment recommendations for female sexual dysfunction treatment and evaluation, in addition to surgical templates during radical cystectomy (RC).This article reviews current literature regarding sexual function and RC with urinary diversion in female bladder cancer patients. Furthermore, this review will provide a review of techniques for organ and neurovascular preservation, along with novel vaginal reconstruction templates. Our review will further focus on emerging technology, including minimally invasive surgery and organ and nerve preservation, directed at preservation of female sexual function.Clinically, studies have demonstrated that females who have undergone genitalia-sparing and neurovascular preservation during RC regained sexual activity earlier than patients undergoing traditional RC. If organ and nerve preservation is not feasible due to involvement of trigone or bladder neck, vaginal reconstruction can mitigate the sexual dysfunction that results from a loss of the anterior vagina during a standard RC.Female sexual dysfunction is associated with high levels of patient distress and is best comanaged with a multidisciplinary treatment approach, including preoperative counseling, intraoperative nerve, and organ preservation, and postoperative interventions to mitigate sexual side effects. Davis L, Isali I, Prunty M, et al. Female Sexual Function Following Radical Cystectomy in Bladder Cancer. Sex Med Rev 2022;10:231-239.

M2 macrophages are associated with deposition of interstitial collagen and other extracellular matrix proteins during the course wound healing and also inflammatory response to biomaterials. Developing advanced biomaterials to promote the M2 subtype may be an effective way to improve tissue reinforcement surgery outcomes. In this study, the effect of genipin, a naturally derived crosslinking agent, on M0 → M2-polarization was investigated. Genipin was introduced either indirectly by seeding cells on aligned collagen biotextiles that are crosslinked by the agent or in soluble form by direct addition to the culture medium. Cellular elongation effects on macrophage polarization induced by the collagen biotextile were also investigated as a potential inducer of macrophage polarization. M0 and M2 macrophages demonstrated significant elongation on the surface of aligned collagen threads, while cells of the M1 subtype-maintained a round phenotype. M0 → M2 polarization, as reflected by arginase and Ym-1 production, was observed on collagen threads only when the threads were crosslinked by genipin, implicating genipin as a more potent inducer of the regenerative phenotype compared to cytoskeletal elongation. The addition of genipin to the culture medium directly also drove the emergence of pro-regenerative phenotype as measured by the markers (arginase and Ym-1) and through the activation of the pSTAT6-PPAR-gamma pathway. This study indicates that genipin-crosslinked collagen biotextiles can be used as a delivery platform to promote regenerative response after biomaterial implantation. Statement of significance The immune response is one of the key determinants of tissue repair and regeneration rate, and outcome. The M2 macrophage subtype is known to resolve the inflammatory response and support tissue repair by producing pro-regenerative factors. Therefore, a biomaterial that promotes M2 sub-type can be a viable strategy to enhance tissue regeneration. In this study, we investigated genipin-crosslinked electrochemically aligned collagen biotextiles for their capacity to induce pro-regenerative polarization of M0 macrophages. The results demonstrated that genipin, rather than matrix-induced cellular elongation, was responsible for M0 → M2 polarization in the absence of other bioinductive factors and maintaining the M2 polarized status of macrophages. Furthermore, we identified that genipin polarizes the M2 macrophage phenotype via activation of the pSTAT6-PPAR-gamma pathway.

A contribution of genetic factors to the development of stress urinary incontinence (SUI) is broadly acknowledged. This study aimed to: (1) provide insight into the genetic pathogenesis of SUI by gathering and synthesizing the available data from studies evaluating differential gene expression in SUI patients and (2) identify possible novel therapeutic targets and leads. A systematic literature search was conducted through September 2017 for the concepts of genetics and SUI. Gene networking connections and gene-set functional analyses of the identified genes as differentially expressed in SUI were performed using GeneMANIA software. Of 3019 studies, 4 were included in the final analysis. A total of 13 genes were identified as being differentially expressed in SUI patients. Eleven genes were overexpressed: skin-derived antileukoproteinase (SKALP/elafin), collagen type XVII alpha 1 chain (COL17A1), plakophilin 1 (PKP1), keratin 16 (KRT16), decorin (DCN), biglycan (BGN), protein bicaudal D homolog 2 (BICD2), growth factor receptor-bound protein 2 (GRB2), signal transducer and activator of transcription 3 (STAT3), apolipoprotein E (APOE), and Golgi SNAP receptor complex member 1 (GOSR1), while two genes were underexpressed: fibromodulin (FMOD) and glucocerebrosidase (GBA). GeneMANIA revealed that these genes are involved in intermediate filament cytoskeleton and extracellular matrix organization. Many genes are involved in the pathogenesis of SUI. Furthermore, whole-genome studies are warranted to identify these genetic connections. This study lays the groundwork for future research and the development of novel therapies and SUI biomarkers in clinical practice.

SDF-1 chemokine enhances tissue regeneration through stem cell chemotaxis, neovascularization and neuronal regeneration. We hypothesized that non-viral delivery of human plasmids that express SDF-1 (pSDF-1) may represent a novel regenerative therapy for stress urinary incontinence (SUI). Seventy-six female rats underwent vaginal distention (VD). They were then divided into four groups according to treatment: pSDF-1 (n = 42), sham (n = 30), PBS (n = 1) and luciferase-tagged pSDF-1 (n = 3). Immediately after VD, the pSDF-1 group underwent immediate periurethral injection of pSDF-1, and the sham group received a vehicle injection followed by leak point pressure (LPP) measurement at the 4th, 7th and 14th days. Urogenital tissues were collected for histology. H&E and trichrome slides were analyzed for vascularity and collagen/muscle components of the sphincter. For the luciferase-tagged pSDF-1 group, bioluminescence scans (BLIs) were obtained on the 3rd, 7th and 14th days following injections. Statistical analysis was conducted using ANOVA with post hoc LSD tests. The Mann-Whitney U test was employed to make pair-wise comparisons between the treated and sham groups. We used IBM SPSS, version 22, for statistical analyses. BLI showed high expression of luciferase-tagged pSDF-1 in the pelvic area over time. VD resulted in a decline of LPP at the 4th day in both groups. The pSDF1-treated group demonstrated accelerated recovery that was significantly higher than that of the sham-treated group at the 7th day (22.64 cmH2O versus 13.99 cmH2O, p < 0.001). Functional improvement persisted until the 14th day (30.51 cmH2O versus 24.11 cmH2O, p = 0.067). Vascularity density in the pSDF-1-treated group was higher than in the sham group at the 7th and 14th days (p

To characterize the epidemiological profile of metastatic bladder cancer (BC) and assess mortality rate with respect to race and gender across the three most common histologies of bladder cancer-Transitional Cell Carcinoma, Adenocarcinoma, and SCC (Squamous Cell Carcinoma).The Surveillance, Epidemiology, and End Results Program database (2000-2017) was queried for all metastatic bladder cancer patients at presentation. Our primary exposure consists of four race/gender combinations. One-way ANOVA and Chi-square tests compared categorical and continuous variables across the exposure variable, respectively. Univariable and multivariable Cox proportional hazards regression analyses were used to examine the association between race/gender combinations and the overall and cancer specific survival adjusting for the other variables.A total of 312,846 bladder cancer patients, 6337 with distant metastases and 11,446 with regional metastases were evaluated. Black female cancer specific survival in metastatic disease was disproportionally lower compared to all race/gender for Transitional Cell Carcinoma 4.3% (95% CI: 1.6-8.9), SCC 2.6% (95% CI: 0.2-11.8), and Adenocarcinoma 6.4% (0.4%-25%). In regional metastastatic disease, worse cancer specific mortality was associated with identifying as a Black Female (aHR 1.17, P = .023), SCC (aHR 1.8, P.001), increasing age (aHR 1.3, P.001), and poorly differentiated grade (aHR 2.01, P.001).Black females experience excess mortality in overall and cancer oncologic outcomes in metastatic BC. Our findings contribute to the body of research warranting examination of the impact of social determinants of health and provider decisions on BC survivorship and contribute to physician decision making in the treatment and surveillance of bladder cancer.

Background: The role of microbiome in genitourinary cancer is an emerging field, with evidence implicating the important role of microbiome as causative factors or cofactors in tumorigenesis and drug metabolism. Our study aims to characterize healthy and bladder cancer enterotypes in the gut and identify functional alterations through the use of metagenomics data. Methods: After prospective collection of 29 rectal swab samples of bladder cancer (BCa) patients undergoing cystectomy, and 32 healthy volunteers, we perform 16S rRNA amplicon sequencing on 61 samples (29 with bladder cancer, 32 without cancer). Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) was applied to infer functional categories associated with taxonomic composition. The p values were adjusted using the false discovery rate. The a- and b-diversity analyses were performed using QIIME. The Mann- Whitney U test was employed to evaluate the statistical significance of b-diversity distances within and between groups of interest. Results: Across all the bladder cancer stool samples, estimation of relative abundance revealed of the five most dominant bacterial populations was Bacteroidales ( 46.21%), Clostridiales ( 32.29%), Burkholderiales (9.07%), Erysipelotrichales (3.20%) and Lactobacillales ( 2.20%). In contrast, healthy controls exhibited an increased relative abundance of Enterobacteriales ( 10.75% vs 0.52%) and Pseudomonadales (8.33% vs 0.18%) as compared to tumor samples. The microbial diversity differences between Bca and normal samples showed no differences across alpha diversity metrics (Shannon diversity p > 0.05) as compared to normal tissue. However, there was significant difference in clustering of organisms as determined by principal coordinate analysis ( PCoA) ordination of unweighted UniFrac Distances, (p = 0.002). Furthermore, upon stratification of patients on smoking status (all healthy = nonsmokers), clustering persisted, albeit non smokers with bladder cancer displayed an intermediate across PCoA. Bca samples exhibited higher LDA score Campylobacterales (log change 8.0, p < 0.001, padj < 0.001), Fusobacteriales (log change 6.11, p < 0.001/padj< 0.01), Epysipelotrichales (log 2.55, p < 0.001/padj < 0.001), Actinomycetales (log change 1.86, p = 0.001/padj< 0.001), Verrucomicrobiales (log change 1.78, p = 0.017/padj= 0.031) and Enterobacteriales (log change -1.54,p = 0.017/padj= 0.132). Conclusions: Our study provides preliminary evidence that the GI microbiota is different in bladder cancer patients. Collectively, our study highlights distinct microbial overexpression of Campylobacter and Fusobacterium in Bca cohort not previously reported, both implicated in tumorigenesis, and could serve as a target that could be modulated to enhance treatment response. Citation Format: Laura Bukavina, Rashida Ginwala, Adam C. Calaway, Ilaha Isali, Megan Prunty, Mohit Sindhani, Lee Ponsky, Sarah Markt, Phillip Abbosh. Characterization and functional analysis of microbiome in bladder cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3057.

BACKGROUND: Determining meta-analysis of transcriptional profiling of muscle-invasive bladder cancer (MIBC) through Gene Expression Omnibus (GEO) datasets has not been investigated. This study aims to define gene expression profiles in MIBC and to identify potential candidate genes and pathways. OBJECTIVES: To review and evaluate gene expression studies in MIBC through publicly available RNA sequencing (RNA-Seq) and microarray data in order to identify potential prognostic and therapeutic targets for MIBC. METHODS: A systematic literature search of the Ovid MEDLINE, PubMed, and Wiley Cochrane Central Register of Controlled Trials databases was performed using the terms “gene,” “gene expression,” and “bladder cancer” January 1, 1990 through March 2021 focused on populations with MIBC. RESULTS: In the final analysis, GEO datasets were included. Fixed effect model was employed in the meta-analysis. Gene networking connections and gene-set functional analyses of the identified genes as differentially expressed in MIBC were performed using ImaGEO and GeneMANIA software. A heatmap for the upregulated and downregulated genes was generated along with the correlated pathways. CONCLUSION: A total of 9 genes were reported in this analysis. Six genes were reported as upregulated (ProTα, SPINT1, UBE2E1, RAB25, KPNB1, HDAC1) and 3 genes as downregulated (NUP188, IPO13, NUP124). Genes were found to be involved in “ubiquitin mediated proteolysis,” “protein processing in endoplasmic reticulum,” “transcriptional misregulation in cancer,” and “RNA transport” pathways.

Growth factors play active role in cells proliferation, embryonic development regulation and cellular differentiation. Altered level growth factors promote malignant transformation of normal cells. There has been significant progress made in form of drugs, inhibitors and monoclonal antibodies against altered growth factor to treat the malignant form of cancer. Moreover, these altered growth factors in prostate cancer increases steroidal hormone levels, which promotes progression. Though this review we are highlighting the majorly involved growth factors in prostate carcinogenesis, this will enable to better design the therapeutic strategies to inhibit prostate cancer progression.

INTRODUCTION AND OBJECTIVE:The immunological response of the body to implanted biomaterials remains a significant issue. Several important urogynecological applications (Stress Urinary Incontinence...

542 Background: Bacterial dysbiosis accompanies carcinogenesis in malignancies such as colon, breast and pancreatic cancer. However, the role of fungal mycobiome has not been evaluated in bladder cancer. With the sexual dimorphism that exists within bladder cancer (Bca) prevalence and survival, our study aims to characterize fungal mycobiome composition in Bca. Methods: This is a single site, non-randomized, prospective study of patients with the diagnosis of muscle invasive bladder cancer (MIBC) undergoing cystectomy from September 2020 to May 2021. Stool samples were collected during surgery using aseptic technique. We utilized the ITS1 region from DNA sample extracts, which was amplified in triplicate using primers with high specificity for ascomycete fungi (fluorescently-labeled forward primer ITS1F (CTTGGTCATTTAGAGGAAGTAA) and unlabeled reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). Fungal PCR products were separated on the SCE 9610 capillary DNA sequencer (Spectrumedix LLC, State College, PA) using GenoSpectrum software to convert fluorescent output into electropherograms. Hierarchical clustering by Bray-Curtis distance was performed using hclust2. Mean normalized abundance for each amplicon was calculated from the three PCR replicates of each sample, excluding means below 1%. Results: A total of 29 patients (17 males and 12 females) were enrolled. The median (IQR) age was 74 yo (63-77), males, and 68.5 yo (58-78), females. Per figure 1, Saccharomycecales dominated the fungal community at order level with mean relative abundance of 36.35% females, and 21.20%, males. (Figure 1D) Tremellales was the second most notable order, composing 8.22% and 5.13% of male and female samples. There were no differences seen in alpha and beta diversity (Figure 1C) (Figure 1A, C), notable differences were seen across orders. The greatest difference between sexes in LDA( M:F) were noted in Saccharomycecales (log change -4.686, p=0.001/ padj= 0.01), Tremellales (log change 5.119, p=0.001/padj= 0.01), and Sporidiobolales (log change 4.839, p=0.001 padj= 0.03). (Figure 1B). Female bladder cancer patients demonstrating an increase abundance of Saccharomycecale. When assessing differences in fungal composition in patients with history of neoadjuvant therapy( NAC) (receipt vs none), patients with history of NAC exhibited a 3.48 increase in Saccharomycecale (padj= 0.015 ), 4.81 increase Tremalles (padj= 0.009) and 4.37 increase Pleosporales(padj= 0.009) . Conclusions: Mycobiome is an integral part of gut microbiota, with fungal elements relatively poorly studied. Nevertheless, the association between fungal dysbiosis and carcinogenesis across multiple cancers exists. Our study is the first to characterize fungal profile in bladder cancer patients, stratified by sex and receipt of NAC, with results highlighting key fungal players: Saccharomycecale, Tremallales, Pleosoporales.

541 Background: The role of microbiome in genitourinary cancer is an emerging field, with evidence implicating the important role of microbiome as causative factors or cofactors in tumorigenesis and drug metabolism. Our study aims to characterize healthy and bladder cancer enterotypes in the gut and identify functional alterations through the use of metagenomics data. Methods: After prospective collection of 29 rectal swab samples of bladder cancer (BCa) patients undergoing cystectomy, and 32 healthy volunteers, we perform 16S rRNA amplicon sequencing on 61 samples (29 with bladder cancer, 32 without cancer). Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) was applied to infer functional categories associated with taxonomic composition. The p values were adjusted using the false discovery rate. The a- and b-diversity analyses were performed using QIIME. The Mann-Whitney U test was employed to evaluate the statistical significance of b-diversity distances within and between groups of interest. Results: Across all the bladder cancer stool samples, estimation of relative abundance revealed of the five most dominant bacterial populations was Bacteroidales ( 46.21%), Clostridiales ( 32.29%), Burkholderiales (9.07%), Erysipelotrichales (3.20%) and Lactobacillales ( 2.20%). In contrast, healthy controls exhibited an increased relative abundance of Enterobacteriales ( 10.75% vs 0.52%) and Pseudomonadales (8.33% vs 0.18%) as compared to tumor samples. The microbial diversity differences between Bca and normal samples showed no differences across alpha diversity metrics (Shannon diversity p>0.05) as compared to normal tissue. However, there was significant difference in clustering of organisms as determined by principal coordinate analysis ( PCoA) ordination of unweighted UniFrac Distances, (p=0.002). Furthermore, upon stratification of patients on smoking status (all healthy=nonsmokers), clustering persisted, albeit non smokers with bladder cancer displayed an intermediate across PCoA. Bca samples exhibited higher LDA score Campylobacterales (log change 8.0, padj adjadj adjadj=0.031) and Enterobacteriales (log change -1.54,p=0.017/ padj= 0.132). Conclusions: In conclusion, our study provides preliminary evidence that the GI microbiota is different in bladder cancer patients. Collectively, our study highlights distinct microbial overexpression of Campylobacter and Fusobacterium in Bca cohort not previously reported, both implicated in tumorigenesis, and could serve as a target that could be modulated to enhance treatment response.

Diosmetin, a plant flavonoid, has been shown to exert promising effects on prostate cancer cells as an anti‑proliferative and anticancer agent. In this study, using western blot analysis for protein expression and flow cytometry for cell cycle analysis, we determined that the treatment of the LNCaP and PC‑3 prostate cancer cells with diosmetin resulted in a marked decrease in cyclin D1, Cdk2 and Cdk4 expression levels (these proteins remain active in the G0‑G1 phases of the cell cycle). These changes were accompanied by a decrease in c-Myc and Bcl-2 expression, and by an increase in Bax, p27Kip1 and FOXO3a protein expression, which suggests the potential modulatory effects of diosmetin on protein transcription. The treatment of prostate cancer cells with diosmetin set in motion an apoptotic machinery by inhibiting X-linked inhibitor of apoptosis (XIAP) and increasing cleaved PARP and cleaved caspase-3 expression levels. On the whole, the findings of this study provide an in-depth analysis of the molecular mechanisms responsible for the regulatory effects of diosmetin on key molecules that perturb the cell cycle to inhibit cell growth, and suggest that diosmetin may prove to be an effective anticancer agent for use in the treatment of prostate cancer in the future.

Mammalian target of rapamycin (mTOR) integrates nutrient and mitogen signals to regulate cell growth (increased cell mass and cell size) and cell division. mTOR protein kinase have two different complexes; complex-I contains major component raptor, whereas complex II (insensitive to rapamycin), has major component rictor. Rictor plays a critical role in AKT (Ser-473 phosphorylation), which facilitates phosphorylation of AKT on Thr-308 by PDK1 for full activation. When we genetically disrupted Rictor, it decreased AKT phosphorylation (Ser-473) and impaired PKCα (Ser-657) expressions. Growth factors viz., IGF-1 and IL-6 are the major player in prostate cancers, these increases Rictor expression. We need to have an agent that can modulate kinase activity of AKT and PKCα to inhibit prostate cancer cell growth. Diosmetin (5, 7-Trihydroxy-4′-methoxyflavone) could be such an agent. Diosmetin, a natural flavone present in plant legumes, has anti-mutagenic and anti-allergic properties. Diosmetin inhibited IGF-1 and IL-6 induced rictor expression in LNCaP and PC-3 prostate cancer cells. Diosmetin dose response treatment to these cells inhibited cell growth and induced apoptosis with no significant growth inhibition in normal prostate epithelial cells (RWPE1). Diosmetin treatment to prostate cancer cells modulated cell survival machinery by down regulating key molecules viz., c-Myc, Survivin and XIAP (X-Linked Inhibitor of Apoptosis). Similarly diosmetin (20 and 50μg/animal/day) feeding to nude mice models, which were orthotopically implanted with luciferase tag PC-3 cells in ventral prostate represented significant decrease in tumor volume than control mice. Diosmetin fed tumor bearing mice reduced phosphorylation of Rictor, (Thr-1135), AKT (Ser-473) and PKCα (Ser-657) expressions to inhibit tumor growth significantly. Moreover, luciferase activity of implanted tumor decreased after diosmetin dose response feeding than control mice. Additionally bone radiographic images suggested that diosmetin treatment inhibited homing of PC-3 cells in the bone. These effects were associated with decrease in cyclin D1 expression and their activating partner, cyclin-dependent kinase (cdk) 2 and 4 with concomitant upregulation of p27/KIP1. Further diosmetin treatment induced apoptosis which was evident by increased expression of cleaved caspase-3. We are documenting these evidences for the first time in animal model system that diosmetin acts against potential molecular targets to alter cellular events to elicit anticancer effects in prostate cancer. Citation Format: Rebecca Pakradooni, Ahmad Khalifa, Ilaha Isali, Sanjeev Shukla. Prostate carcinogenesis inhibition through AKT-PKCα signaling pathway by diosmetin [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 252.

The role of Y chromosome in prostate cancer progression and incidence is not well known. Among the 46 chromosomes, Y chromosome determines the male gender. The Y chromosome is smaller than the X chromosome and contains only 458 genes compared to over 2000 genes found in the X chromosome. The Y chromosome is prone to high mutation rates, created exclusively in sperm cells due to the highly oxidative environment of the testis. Y chromosome harbors epigenetic information, which affects the expression of genes associated with the incidence and progression of prostate cancer. In this review, we focus on Y chromosome related genetic abnormalities, likely to be involved in the development and progression of prostate cancer.