Search

International audience; In recent decades, a legion of monopartite begomoviruses transmitted by the whitefly Bemisia tabaci has emerged as serious threats to vegetable crops in Africa. Recent studies in Burkina Faso (West Africa) reported the predominance of pepper yellow vein Mali virus (PepYVMLV) and its frequent association with a previously unknown DNA-B component. To understand the role of this DNA-B component in the emergence of PepYVMLV, we assessed biological traits related to virulence, virus accumulation, location in the tissue and transmission. We demonstrate that the DNA-B component is not required for systemic movement and symptom development of PepYVMLV (non-strict association), but that its association produces more severe symptoms including growth arrest and plant death. The increased virulence is associated with a higher viral DNA accumulation in plant tissues, an increase in the number of contaminated nuclei of the phloem parenchyma and in the transmission rate by B. tabaci. Our results suggest that the association of a DNA-B component with the otherwise monopartite PepYVMLV is a key factor of its emergence.

Identification of best performing fertilizer practices among a set of contrasting practices with field trials is challenging as crop losses are costly for farmers. To identify best management practices, an ''intuitive strategy'' would be to set multi-year field trials with equal proportion of each practice to test. Our objective was to provide an identification strategy using a bandit algorithm that was better at minimizing farmers' losses occurring during the identification, compared with the ''intuitive strategy''. We used a modification of the Decision Support Systems for Agro-Technological Transfer (DSSAT) crop model to mimic field trial responses, with a case-study in Southern Mali. We compared fertilizer practices using a risk-aware measure, the Conditional Value-at-Risk (CVaR), and a novel agronomic metric, the Yield Excess (YE). YE accounts for both grain yield and agronomic nitrogen use efficiency. The bandit-algorithm performed better than the intuitive strategy: it increased, in most cases, farmers' protection against worst outcomes. This study is a methodological step which opens up new horizons for risk-aware ensemble identification of the performance of contrasting crop management practices in real conditions.

International audience; Rice yellow mottle virus (RYMV) has persisted as a major biotic constraint to rice production in Africa. However, no data on RYMV epidemics were available in Ghana, although it is an intensive rice-producing country. Surveys were performed from 2010 to 2020 in eleven rice-growing regions of Ghana. Symptom observations and serological detections confirmed that RYMV is circulating in most of these regions. Coat protein gene and complete genome sequencings revealed that RYMV in Ghana almost exclusively belongs to the strain S2, one of the strains covering the largest area in West Africa. We also detected the presence of the S1ca strain which is being reported for the first time outside its area of origin. These results suggested a complex This preprint research paper has not been peer reviewed.

Culturing bacteria from plant material is well known to be conducive to strong bias compared to the actual diversity in the original samples. This bias is related to the bacterial cultivability, chemical composition of the media and culture conditions. Recovery bias is often observed but has never been quantified on different media using an amplicon barcoding approach whereby plant microbiota DNA extractions are compared to DNA extracted from serial dilutions of the same plant tissues grown on bacterial culture media. In this study, we: i) quantified the bacterial culturing diversity bias using 16S amplicon barcode sequencing by comparing a culture-dependent approach (CDA) focused on rice roots on four commonly used bacterial media (10% and 50% TSA, plant-based medium with rice flour, nitrogen free medium NGN and NFb) versus a culture-independent approach (CIA) assessed with DNA extracted directly from root and rhizosphere samples; ii) assessed enriched and missing taxa detected on the different media; iii) used biostatistics functional predictions to highlight metabolic profiles that could potentially be enriched in the CDA and CIA. A comparative analysis of the two approaches revealed that among the 22 phyla present in microbiota of the studied rice root samples, only five were present in the CDA (Proteobacteria, Firmicutes, Bacteroidetes, Actinobacteria, Verrucomicrobia). The Proteobacteria phylum was the most abundant in all CDA samples, showing high gamma-Proteobacteria enrichment. The diversity of the combined culture media represented about a third of the total microbiota diversity, and its genus diversity and frequency was documented. The functional prediction tool (PICRUSt2) detected nitrogenase enzyme enrichment in bacterial taxa sampled from nitrogen-free media, thus validating its predictive capacity. Further functional predictions also showed that the CDA mostly missed anaerobic, methylotrophic, methanotrophic and photosynthetic bacteria compared to the CIA, thereby generating valuable insight that could enable the design of ad-hoc culture media and conditions to increase the rice-associated microbiota cultivability.

International audience; This chapter talks about : Milk production and marketing: current trends in three contrasting regions & Evidence of agroecology in milk production and marketing systems

International audience; Faced with the multiple challenges of natural resource management, Assisted Natural Regeneration (ANR) is one of the strategies recommended especially in Africa for farmers. The present research therefore aims to study the characteristics of farms in relation to the strategy of application of Assisted Natural Regeneration (ANR) in agroecosystems in the southern Sudanian agro-climatic zone of Burkina Faso. The study took place on the outskirts of the Classified Forest and Partial Reserve of faun of Comoé Léraba located in the southwestern part of Burkina Faso. The methodological approach consisted of collecting socioeconomic data from 102 farms through a survey. The analysis of the results reveals that producers interested in ANR can be divided into three (03) distinct classes. It highlights the socioeconomic differences as well as the divergences in the conduct of the work of the ANR.; Face aux multiples défis de la gestion des ressources naturelles, la Régénération Naturelle Assistée (RNA) est l’une des stratégies préconisée surtout en Afrique pour les exploitants agricoles. La présente recherche vise alors à étudier les caractéristiques des exploitations agricoles en rapport avec la stratégie d’application de la Régénération Naturelle Assistée (RNA) dans les agro écosystèmes en zone agro-climatique sud soudanienne du Burkina Faso. L’étude s’est déroulée dans la périphérie de la Forêt Classée et Réserve Partielle de la Faune de la Comoé Léraba située dans la partie Sud-Ouest du Burkina Faso. La démarche méthodologique a consisté à collecter des données socioéconomiques auprès de 102 exploitations à travers une enquête. L’analyse des résultats révèle que les producteurs intéressés par la RNA peuvent être répartis en trois (03) classes distinctes. Il met en exergue les différences socio-économiques ainsi que les divergences dans la conduite des travaux de la RNA.

International audience; In recent years, Brown spot disease of rice (BSR) has been observed on leaves and seeds of rice in all rice-growing areas of Burkina Faso. Bipolaris oryzae and Exserohilum rostratum are the main fungal species isolated from BSR infected tissues and they are frequently observed in the same field. However, we are lacking information on the genetic diversity and population structure of these fungi in Burkina Faso. The mode of reproduction is also unknown. The genetic diversity of isolates of B. oryzae (n=61) and E. rostratum (n=151), collected from major ricegrowing areas of Burkina Faso, was estimated using genotyping-by-sequencing (GBS). The mean values for nucleotide diversity (p) were 1.9 x10-4 for B. oryzae and 4.8 x10-4 for E. rostratum. There is no genetic differentiation between the geographical populations of each species. The analysis of molecular variance revealed that 89% and 94% of the genetic variances were within the populations of B. oryzae and E. rostratum, respectively. For each species, four genetic clusters were identified by two clustering methods (DAPC and sNMF). The distribution of these genetic groups was independent of the geographical origin of the isolates. Evidence of recombination was detected in the populations of B. oryzae and E. rostratum. For B. oryzae balanced mating type ratios were supporting sexual reproduction. For E. rostratum overrepresentation of MAT1-2 isolates (79%) suggested a predominant asexual reproduction. This study provides important information on the biology and genetics of the two major fungi causing brown spot disease of rice in Burkina Faso.

International audience; Faced with the degradation of natural resources linked mainly to the phenomenon of climate variability in Africa, the Assisted Natural Regeneration (ANR) strategy is more and more recommended to certain farmers in West Africa. This article therefore aims to assess the impact of Assisted Natural Regeneration on flora in agro-ecosystems in the southern Sudanian agro-climatic zone of Burkina Faso. The research took place on the outskirts of the Classified Forest and Partial Wildlife Reserve of Comoé Léraba located in the southwestern part of Burkina Faso. The field work on the identification of the floristic composition and the structure in the fields under ANR shows that the composition of the flora in the parcel of land under ANR contains 93.5% of the total of the species listed. This reveals the will of the producers to diversify the species in the fields under ANR. This study allowed the determination of the phytoecological characteristics of agricultural areas under ANR and encourages the popularization of ANR in the southern Sudanian zone, as a strategy for anticipating the degradation of natural resources which compromises agroforestry production.; Face à la dégradation des ressources naturelles liée surtout au phénomène de la variabilité climatique en Afrique, la stratégie de Régénération Naturelle Assistée (RNA) est de plus en plus recommandée à certains exploitants agricoles d’Afrique de l’Ouest. Le présent article vise alors à évaluer l’impact de la Régénération Naturelle Assistée sur la flore dans les agro écosystèmes en zone agro-climatique sud soudanienne du Burkina Faso. La recherche s’est déroulée dans la périphérie de la Forêt Classée et Réserve Partielle de la Faune de la Comoé Léraba située dans la partie Sud-Ouest du Burkina Faso. Le travail de terrain sur l’identification de la composition floristique et la structure de la végétation dans les champs sous RNA montre que la composition de la flore dans les parcelles sous RNA renferme 93,5% du total des espèces recensées. Cela révèle la volonté des producteurs de diversifier les espèces dans les champs sous RNA. Cette étude a permis la détermination des caractéristiques phytoécologiques des espaces agricoles sous RNA et permet d’encourager la vulgarisation de la RNA dans la zone sud soudanienne, en tant que stratégie d’anticipation et d’atténuation à la dégradation des ressources naturelles qui compromet les productions agroforestières.

International audience; West African dairy farmers are faced with constraints in feeding their cows during the dry season when rangelands are not rich enough in soft grass. This leads to a drop in the supply of local milk. To address this problem, farmers purchase expensive feedstuffs that they use sporadically. Some seem to cope by combining grazing, fodder and cattle feed. However, these strategies remain poorly known. This study aimed at characterizing dry season feeding practices of dairy cows in extensive farms in the South Sudanian zone of Burkina Faso in order to identify and promote innovative and economically viable feeding strategies. A household survey was conducted among 134 farmers supplying dairy processors in the cities of Banfora and Bobo-Dioulasso, in western Burkina Faso. The interviews aimed at characterizing the feeding practices of dairy cows during the dry season. The study presents a typology of dairy cows feeding systems, highlighting a technically and economically promising feeding system, however practiced only by few farmers. In this system, the dairy cows receive good quality fodder in sufficient quantity (3360 ± 1424 kg dry matter/cow/year) and moderate quantities of feed concentrates (253 ± 244 kg gross weight/cow/year) during the dry season, in addition to a reasonable duration of grazing (9 h/d). This practice maintains milk production and provides a steady income to the farmer. It appears therefore appropriate to support the co-design of feeding systems integrating forage crops, grazing and moderate use of concentrate feed. The improvement of dairy cow diet appears to be mainly motivated by the organization of the collection and the incentives offered to farmers. In order to amplify the dynamics of agro-ecological intensification of milk production, and in particular this type of dairy cows feeding system, upstream operators of the local dairy value chain could develop an economic model that creates more incentives for the farmers.; Les éleveurs laitiers ouest-africains connaissent des contraintes d’alimentation des vaches en saison sèche conduisant à une chute de l’offre de lait local. Pour y faire face, ils achètent cher et utilisent sporadiquement des aliments concentrés. Certains semblent s’en sortir en combinant le pâturage, les fourrages et l’aliment concentré. Cependant, ces stratégies restent méconnues et leur efficacité peu optimisée. La présente étude vise à caractériser les pratiques d’alimentation des vaches traites en saison sèche chez les éleveurs laitiers extensifs en zone sud-soudanienne du Burkina Faso pour repérer et promouvoir des stratégies d’alimentation innovantes économiquement viables. Une enquête ménage a été conduite auprès de 134 éleveurs qui approvisionnent les laiteries des villes de Banfora et Bobo-Dioulasso, à l’ouest du pays. La typologie des systèmes d’alimentation proposée a mis en évidence un système prometteur, techniquement innovant et économiquement plus performant, qui n’est cependant pratiqué que par une minorité d’éleveurs. Dans ce système, les vaches traites nourries au pâturage (9 h/j) reçoivent en saison sèche, en complément, des apports de fourrage de bonne qualité et en quantité suffisante (3360 ± 1424 kg de matière sèche/vache/an) et des quantités modérées de concentrés alimentaires (253 ± 244 kg matière brute/vache/an). Cette pratique permet de maintenir la production laitière et d’assurer des revenus réguliers à l’éleveur. Il apparaît donc opportun de soutenir la co-conception de systèmes d’alimentation des vaches intégrant les cultures fourragères et une utilisation modérée des concentrés. L’effort d’amélioration du système d’alimentation des vaches par les éleveurs semble avoir comme motivation l’existence du dispositif de collecte de lait facilitant l’écoulement et les incitations pour la production. En vue d’amplifier les dynamiques d’intensification agroécologique de la production laitière en cours, les opérateurs de l’amont de la filière lait local pourraient donc développer un modèle économique qui crée davantage d’incitation pour les éleveurs.

To investigate the spread of Rice yellow mottle virus (RYMV) along the Niger River, regular sampling of virus isolates was conducted along 500 km of the Niger Valley in the Republic of Niger and was complemented by additional sampling in neighbouring countries in West Africa and Central Africa. The spread of RYMV into and within the Republic of Niger was inferred as a continuous process using a Bayesian statistical framework applied previously to reconstruct its dispersal history in West Africa, East Africa, and Madagascar. The spatial resolution along this section of the Niger River was the highest implemented for RYMV and possibly for any plant virus. We benefited from the results of early field surveys of the disease for the validation of the phylogeographic reconstruction and from the well-documented history of rice cultivation changes along the Niger River for their interpretation. As a prerequisite, the temporal signal of the RYMV data sets was revisited in the light of recent methodological advances. The role of the hydrographic network of the Niger Basin in RYMV spread was examined, and the link between virus population dynamics and the extent of irrigated rice was assessed. RYMV was introduced along the Niger River in the Republic of Niger in the early 1980s from areas to the southwest of the country where rice was increasingly grown. Viral spread was triggered by a major irrigation scheme made of a set of rice perimeters along the river valley. The subsequent spatial and temporal host continuity and the inoculum build-up allowed for a rapid spread of RYMV along the Niger River, upstream and downstream, over hundreds of kilometres, and led to the development of severe epidemics. There was no evidence of long-distance dissemination of the virus through natural water. Floating rice in the main meanders of the Middle Niger did not contribute to virus dispersal from West Africa to Central Africa. RYMV along the Niger River is an insightful example of how agricultural intensification favours pathogen emergence and spread., SCOPUS: ar.j, info:eu-repo/semantics/published

Significance The absence of zoonotic MERS-CoV in Africa in spite of an abundance of MERS-CoV–infected dromedaries has remained an enigma. We demonstrate that geographically and genetically distinct viruses from Africa have low replication competence in the human lung, providing a possible explanation for the absence of severe MERS disease in Africa. The findings suggest that MERS-CoV now entrenched in the Arabian Peninsula has acquired increased pathogenic potential for humans. We demonstrate that the spike protein contributes to this phenotypic difference. If pathogenic clade B viruses from the Arabian Peninsula are introduced into Africa, they are likely to become dominant, as they have in the Arabian Peninsula, and to be associated with adverse health impacts in Africa and increased pandemic threat., Coronaviruses are pathogens of pandemic potential. Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of zoonotic infection. More than 70% of MERS-CoV–infected dromedaries are found in East, North, and West Africa, but zoonotic MERS disease is only reported from the Arabian Peninsula. We compared viral replication competence of clade A and B viruses from the Arabian Peninsula with genetically diverse clade C viruses found in East (Egypt, Kenya, and Ethiopia), North (Morocco), and West (Nigeria and Burkina Faso) Africa. Viruses from Africa had lower replication competence in ex vivo cultures of the human lung and in lungs of experimentally infected human-DPP4 (hDPP4) knockin mice. We used lentivirus pseudotypes expressing MERS-CoV spike from Saudi Arabian clade A prototype strain (EMC) or African clade C1.1 viruses and demonstrated that clade C1.1 spike was associated with reduced virus entry into the respiratory epithelial cell line Calu-3. Isogenic EMC viruses with spike protein from EMC or clade C1.1 generated by reverse genetics showed that the clade C1.1 spike was associated with reduced virus replication competence in Calu-3 cells in vitro, in ex vivo human bronchus, and in lungs of hDPP4 knockin mice in vivo. These findings may explain why zoonotic MERS disease has not been reported from Africa so far, despite exposure to and infection with MERS-CoV.

International audience; Abstract The increase in demand for dairy products in Burkina Faso is encouraging livestock producers to develop milk production. Three types of dairy systems (pastoralists, agropastoralists and market-oriented dairy farms) have been characterised based on a sample of 60 producers operating in the West and centre of the country. Pastoralists’ dairy operations consist mainly of zebus, rely on pasture for feed, store little fodder, and recover little manure. Milk yields are low (1.4 l/tropical livestock unit (TLU)/day) and milk sales are limited, but mostly benefit women. Agropastoralists’ dairy operations consist mainly of zebus, store more fodder for feed, use more concentrate and recover manure better. Milk yields are higher (3.1 l/TLU/day) and milk sales are threefold those of pastoralists, but less of the money generated by milk sales goes to women. Market-oriented dairy farmers’ operations are mainly made up of crossbreds, reared indoors and fed on fodder and feeds, store much more fodder and recover manure even better. They generate the highest milk yields (7.3 l/TLU/day), and milk sales are 2.5-fold those of agropastoralists. However, money earned from milk sales mainly benefits men. The study shows that the improvement in dairy systems’ technical and economic performance, which mostly rests on genetics and cow feed, but also on better recycling of agricultural by-products, is driven by a low-cost intensification and market opportunity (raising processors demand).

At least three species of Pantoea are responsible for bacterial blight disease and grain discoloration of rice in Sub-Saharan Africa. Thus, measures need to be taken to limit the pathogens' dispersion and robust diagnostic tools are required for rapid and cheap diagnosis in the field as well as for routine seed certification or control. Therefore, several diagnostic tools such as simplex and multiplex PCR schemes and a semi-selective medium have been developed and are being used. However, the use of these tools is time-consuming, expensive and therefore limited to laboratories that can afford the chemicals. We have therefore developed two isothermal loop amplification (LAMP) protocols, one of which detects all Pantoea species in the genus and another one that is specific for P. ananatis.•The novel LAMP assays allow rapid and sensitive detection of these bacteria.•They will help plant protection services in routine field and laboratory tests especially for monitoring the phytosanitary status of rice seeds., Graphical abstract Image, graphical abstract

International audience; A widely held assumption is that intensifying agroforestry will lead to sustainable increases in production, societal resilience and food security, urgently needed in the current context of changes in markets, climate and demography. Current thinking assumes that to achieve sustainable innovation a participatory approach with public, civil and private stakeholders is necessary, combined with a systemic, trans-disciplinary approach, rather than a technical approach. This study presents a case of applying the Theory of Change (ToC) concept to test this assumption. The ToC was designed to articulate the process of scaling of action-research findings, and to adapt the research to the context of complex agroforestry systems at plot, household, farm, village and landscape levels. This allowed to develop an intervention logic that unpacks what sustainability means for farmers and other local stakeholders in four West African agroforestry systems. The conceptual approach created an awareness of potential impacts of scaling initiatives based on a ToC with pathways to impact combined with monitoring the effects of the research & development project on a variety of ecological, agronomic and economic performance indicators. A number of constraints and paradoxes that are linked to current research and development short term funding are also discussed.

International audience; Rice blast, caused by the filamentous ascomycete Pyricularia oryzae, is one of the most devastating diseases of rice. Four genetic clusters were previously identified, and three have a large geographic distribution. Asia is the center of diversity and the origin of most migrations to other continents, and sexual reproduction persisted only in the South China-Laos-North Thailand region, which was identified as the putative center of origin of all P. oryzae populations on rice. Despite the importance of rice blast disease, little is known about the diversity and the population structure of the pathogen in Africa (including Madagascar). The present study was intended to describe the structure of African populations of P. oryzae and identify the relationship between African and worldwide genetic clusters. A set of 2,057 strains (937 African and 1,120 Madagascan strains) were genotyped with 12 simple sequence repeat markers to assess the diversity and the population structure of P. oryzae. Four genetic clusters were identified in Africa and Madagascar. All four clusters previously identified are present in Africa. Populations from West Africa, East Africa, and Madagascar are highly differentiated. The geographic structure is consistent with limited dispersion and with some migration events between neighboring countries. The two mating types are present in Africa with a dominance of Mat1.2, but no female-fertile strain was detected, supporting the absence of sexual reproduction on this continent. This study showed an unsuspected high level of genetic diversity of P. oryzae in Africa and suggested several independent introductions.

The genetic diversity of cultivated rice in farmers' fields remains understudied in West Africa despite the importance of rice for food security in this region. In this study, we genotyped rice samples from Burkina Faso using the C6AIR SNP (Single Nucleotide Polymorphism) array (IRRI), including 27 registered cultivars and 50 rice samples collected in rice fields from three geographical zones in western Burkina Faso. Most of the registered cultivars clustered with the indica genetic group, except seven assigned to japonica and one admix. All but one of the rice samples from farmers' fields belonged to the indica group. The other field sample, which unexpectedly clustered with the Aus genetic group, originated from a rainfed lowland site known to differ in terms of agronomic practices, and which revealed to be highly differentiated from the five other sites. Apart from this peculiar site, the rice grown in irrigated areas did not differ from rice sampled in rainfed lowlands. Finally, obtained genetic data confirmed the high frequency of one cultivar, in congruence with farmers' interviews. We argue on the importance to document and preserve the high agro-biodiversity observed in rice from Burkina Faso as a prerequisite to face the current challenges of growing rice demand and global change.

International audience; This paper provides an early assessment of the effects of the COVID-19 outbreak and of subsequent response measures on milk production, collection, processing, marketing and consumption in Africa. We focus on the period surrounding the first wave of the outbreak (from February to June 2020), during which the number of cases surged and many steps were taken to curb the epidemic. The paper is based on reports from four countries covered by the Africa-Milk Research Project: Burkina Faso, Kenya, Madagascar and Senegal. Data was collected primarily from nine dairy processors located in those countries. Major conclusions of the study are: (1) Dairy farmers were negatively affected by COVID-19 measures when the health crisis coincided with the peak of the milk production season, and when governments did not take steps to support milk production. (2) Small and informal milk collectors were also affected by traffic restrictions as they could not obtain traffic permits. (3) Milk powder importation remained unaffected during the outbreak. (4) Dairy processors (particularly small ones) faced many challenges restricting their operation. Travel restrictions led to temporary interruptions of milk supply, and because of employee protection and safety measures, processing costs increased. (5) Many small retailers were affected by bans on public transport and reduced their purchases of artisanal dairy products; meanwhile, spoilage of dairy products increased during long curfews coupled with poor storage conditions. Supermarkets were able to increase their market share during the pandemic thanks to their connections with industrial dairy processors and wholesalers. (6) A majority of consumers decreased their consumption of dairy products due to a decrease of purchasing power. In some cases, an increase in consumption occurred (due to Ramadan month and dry season high temperatures) and consumption shifted towards long-life dairy products. (7) Overall, the consequences of the health crisis affected more small and informal dairy supply chains than the larger ones, which are more formal, better organised and finally more resilient to face this kind of global crisis.

Agriculture in West Africa is constrained by several yield-limiting factors, such as poor soil fertility, erratic rainfall distributions and low input systems. Projected changes in climate, thus, pose a threat since crop production is mainly rain-fed. The impact of climate change and its variation on the productivity of cereals in smallholder settings under future production systems in Navrongo, Ghana and Nioro du Rip, Senegal was assessed in this study. Data on management practices obtained from household surveys and projected agricultural development pathways (through stakeholder engagements), soil data, weather data (historical: 1980–2009 and five General Circulation Models, mid-century time slice 2040–2069 for two Representative Concentration Pathways, 4.5 and 8.5) were used for the impact assessment, employing a crop simulation model. Ensemble maize yield changes under the sustainable agricultural development pathway (SDP) were −13 and −16%, while under the unsustainable development pathway (USDP), yield changes were −19 and −20% in Navrongo and Nioro du Rip, respectively. The impact on sorghum and millet were lower than that on maize. Variations in climate change impact among smallholders were high with relative standard deviations (RSD) of between 14% and 60% across the cereals with variability being higher under the USDP, except for millet. Agricultural production systems with higher intensification but with less emphasis on soil conservation (USDP) will be more negatively impacted by climate change compared to relatively sustainable ones (SDP).

Aim:\ud \ud Tree crowns determine light interception, carbon and water exchange. Thus, understanding the factors causing tree crown allometry to vary at the tree and stand level matters greatly for the development of future vegetation modelling and for the calibration of remote sensing products. Nevertheless, we know little about large‐scale variation and determinants in tropical tree crown allometry. In this study, we explored the continental variation in scaling exponents of site‐specific crown allometry and assessed their relationships with environmental and stand‐level variables in the tropics.\ud \ud Location:\ud \ud Global tropics.\ud \ud Time period:\ud \ud Early 21st century.\ud \ud Major taxa :\ud \ud Woody plants.\ud \ud Methods:\ud \ud Using a dataset of 87,737 trees distributed among 245 forest and savanna sites across the tropics, we fitted site‐specific allometric relationships between crown dimensions (crown depth, diameter and volume) and stem diameter using power‐law models. Stand‐level and environmental drivers of crown allometric relationships were assessed at pantropical and continental scales.\ud \ud Results:\ud \ud The scaling exponents of allometric relationships between stem diameter and crown dimensions were higher in savannas than in forests. We identified that continental crown models were better than pantropical crown models and that continental differences in crown allometric relationships were driven by both stand‐level (wood density) and environmental (precipitation, cation exchange capacity and soil texture) variables for both tropical biomes. For a given diameter, forest trees from Asia and savanna trees from Australia had smaller crown dimensions than trees in Africa and America, with crown volumes for some Asian forest trees being smaller than those of trees in African forests.\ud \ud Main conclusions:\ud \ud Our results provide new insight into geographical variability, with large continental differences in tropical tree crown allometry that were driven by stand‐level and environmental variables. They have implications for the assessment of ecosystem function and for the monitoring of woody biomass by remote sensing techniques in the global tropics.

International audience; Liver disease is highly prevalent in Africa, especially in the western African country Burkina Faso, due to the presence of multiple biological and chemical aggressors of the liver. Furthermore, diagnosis and appropriate care for liver disease are uneven and usually insufficient. This drives local communities to turn to folk medicine based on medicinal plants from healers. Small scale, ethnopharmacological studies on reputed hepatoprotective plants have been carried out in defined regions worldwide, but so far, no study has been carried out on a countrywide scale. Therefore, we have explored traditional healers’ practices in all thirteen regions of Burkina Faso. We interviewed 575 healers and we compiled a database with 2,006 plant entries. Here, we report results on liver nosology, liver pathologies, medicinal plants used for liver disease, and traditional practices through the lens of Burkinabe healers. Our goal was to give a full inventory of medicinal plants used to treat liver disease and to determine if there was consensus on the use of specific plants for specific symptoms. Analysis of the medicinal plants in use across the whole country provides local communities with a wider evidence base to determine which plants may be more effective in treating liver disease and could provide the scientific community, with a shortlist of plants suitable for chemical and pharmacological investigation to validate the plants’ therapeutic role.

International audience; Crop diseases are responsible for considerable yield losses worldwide and particularly in sub-Saharan Africa. To implement efficient disease control measures, detection of the pathogens and understanding pathogen spatio-temporal dynamics is crucial and requires the use of molecular detection tools, especially to distinguish different pathogens causing more or less similar symptoms. We report here the design a new molecular diagnostic tool able to simultaneously detect five bacterial taxa causing important diseases on rice in Africa: (1) Pseudomonas fuscovaginae, (2) Xanthomonas oryzae, (3) Burkholderia glumae and Burkholderia gladioli, (4) Sphingomonas and (5) Pantoea species. This new detection tool consists of a multiplex PCR, which is cost effective and easily applicable. Validation of the method is presented through its application on a global collection of bacterial strains. Moreover, sensitivity assessment for the detection of all five bacteria is reported to be at 0.5 ng DNA by μl. As a proof of concept, we applied the new molecular detection method to a set of 256 rice leaves collected from 16 fields in two irrigated areas in western Burkina Faso. Our results show high levels of Sphingomonas spp. (up to 100% of tested samples in one field), with significant variation in the incidence between the two sampled sites. Xanthomonas oryzae incidence levels were mostly congruent with bacterial leaf streak (BLS) and bacterial leaf blight (BLB) symptom observations in the field. Low levels of Pantoea spp. were found while none of the 256 analysed samples was positive for Burkholderia or Pseudomonas fuscovaginae. Finally, many samples (up to 37.5% in one studied field) were positive for more than one bacterium (co-infection). Documenting co-infection levels are important because of their drastic consequences on epidemiology, evolution of pathogen populations and yield losses. The newly designed multiplex PCR for multiple bacterial pathogens of rice is a significant improvement for disease monitoring in the field, thus contributing to efficient disease control and food safety.

International audience; CONTEXT: Typologies are widely used to tailor management practices to structural farm households, and to identify recommendation domains. However, it has often been shown that the recommendations are not followed by farmers, especially in the agricultural context of sub-Saharan Africa. OBJECTIVE: We aimed to identify links between a typology based on the structure of farm households and a typology based on farmers' management practices adopted by farmers in the Sudano-Sahelian zone of Burkina Faso. METHODS: We co-developed socio-economic and technical survey with agronomists and socio-economists and collected data on 291 smallholder farming households. We used principal component analysis, followed by hierarchical clustering to build two typologies: a farm household typology and a farm management typology and analyzed the link between the two. RESULTS AND CONCLUSIONS: Our typologies distinguished 4 types of farm households and 3 types of farm management. Although we expected to find a dominant farm management type for each type of farm household, we show that the use of the typology is not sufficient to disentangle the intra-diversity of farm household types, as, except for large-scale cotton producers, of whom 94% fall in the mineral input user category, all the farmers do not use the same set of management practices. For instance, 29.5% of medium-scale cotton-based farm types do not match the “mineral input users” type, but are characterized by their use of mulch and cereal-legume crop rotation. Based on our empirical data, we show that promoting a basket of options (a set of management practices) based on a typology of farm household structure may not always be appropriate. Moving from theory (i.e. use of typology to define ‘best fit’) to practice (i.e. collecting data on actual agricultural practices), we show that using a combined typology approach will reveal matches and mismatches when practices are tailored to a given farm type. SIGNIFICANCE: In addition to using a farm household typology to tailor practices, we also define a limited set of locally relevant variables that are representative of the diversity of farmers' practices.

To study the genetic diversity and structure of the forest species Pterocarpus erinaceus Poir., seventeen polymorphic nuclear microsatellite markers were isolated and characterized, using next-generation sequencing. Three hundred and sixty-five (365) individuals were analyzed within fifteen (15) West African populations. The number of alleles for these loci varied from 4 to 30, and the heterozygosity varied from 0.23 to 0.82. The seventeen (17) primers designed here will allow characterizing the genetic diversity of this threaten species on its natural stands and to better understand the population differentiation mechanisms shaping it.

International audience; An ex post analysis of the impact of research projects related to Participatory Breeding (PB) of sorghum in Burkina Faso was carried out in 2015 and 2016 using the "Impress" method developed by CIRAD. The sorghum PB approach emerged in Burkina Faso in the late 1990s as a response to the very low adoption of improved varieties released by the conventional breeding program. This approach represents a paradigm shift from a research approach focused solely on the development of "high-yielding varieties", irrespective of the social context in which these varieties are to be used, towards the development of varieties, seed and their dissemination within a multi-stakeholder framework. The present study aims to assess the impact of the sorghum PB program and the activities related to seed production and dissemination carried out in Burkina Faso over a period of 20 years. Detailed mappings of the timeline and the actors that have been involved in the innovation process, as well as the impact pathway, have been established. The causal relationships between outputs, outcomes and impacts have been developed on the basis of 67 impact descriptors provided by research partners and beneficiaries during participatory workshops. Around thirty measurable impact indicators were assessed by means of individual or focusgroup interviews and by means of secondary data sources. The three major outputs of the study were: the new improved varieties (IV) resulting from the PB actions; the mini-pack seed strategy; and the new skills acquired by the farmer organizations regarding sorghum improvement and certified seed production. The appropriation of these outputs by the farmer organizations not only brought structure to the experimentation networks, but also ensured the promotion and dissemination of the new varieties, and the establishment of a decentralised certified seed production scheme. One major positive impact was the significant increase in the use of sorghum IVs not only in the villages covered by the program but also in neighbouring areas. The expansion and performance of these new IVs has helped reduce the hunger gap while increasing the revenues of farmers involved in seed production. Furthermore, the research projects helped bring structure to the national seed sector as well as to the certified seed market, where the farmer seed production Unions consolidated by the PB projects now play an important role in the orientation of national legislation. The experimental method of impact assessment used in this analysis explores and makes visible the complex multidimensional and multi-stakeholder processes that have helped shape technological innovation and its impact on development. Such impact assessments can also elucidate the role of research in reinforcing the individual and collective capacities needed for innovating and testing out new technologies, that is, new varieties and seed production practices according to local constraints and/or opportunities.

The SISE-Eaux database of water intended for human consumption, archived by the French Regional Health Agency (ARS) since 1990, is a rich source of information. However, more or less regular monitoring over almost 30 years and the multiplication of parameters lead to a sparse matrix (observations &times, parameters) and a large dimension of the hyperspace of data. These characteristics make it difficult to exploit this database for a synthetic mapping of water quality, and to identify of the processes responsible for its diversity in a complex geological context and anthropized environment. A 10-year period (2006&ndash, 2016) was selected from the Provence-Alpes- C&ocirc, te d&rsquo, Azur region database (PACA, southeastern France). We extracted 5,295 water samples, each with 15 parameters. A treatment by principal component analysis (PCA) followed with orthomax rotation allows for identifying and ranking six principal components (PCs) totaling 75% of the initial information. The association of the parameters with the principal components, and the regional distribution of the PCs make it possible to identify water-rock interactions, bacteriological contamination, redox processes and arsenic occurrence as the main sources of variability. However, the results also highlight a decrease of useful information, a constraint linked to the vast size and diversity of the study area. The development of a relevant tool for the protecting and managing of water resources will require identifying of subsets based on functional landscape units or the grouping of groundwater bodies.

Pterocarpus erinaceus (Poir) is currently the most exploited and threatened spontaneous tree species in the Guinean-Sudanian and Sudano-Sahelian zones in West Africa. This work analyzed the density and color parameters of P. erinaceus wood in the phytogeographic zones (Sudanian, Guinean and Sahelian) in three countries in West Africa (Togo, Burkina Faso and Niger). The results obtained by studying 451 specimens taken from 95 trees showed significant differences in basic density and color parameter values (P 3), darker (L* = 48.3 ± 0.6) and redder (a* = 8.2 ± 2) than those in the Guinean zone (basic density = 684 ± 53 kg · m−3; L* = 59.7 ± 0.5; a* = 6 ± 0.2) and the Sudanian zone (basic density = 725 ± 70 kg · m−3; L* = 53.7 ± 0.40; a* = 7.30 ± 0.2). At intra-tree scale, the results did not show a significant variation of basic density according to the number of rings counted from the pith (P > 0.05). This indicated that the age of the trees has little influence on the basic density of P. erinaceus wood.

International audience; Cet article compare la situation et les enjeux concernant la distribution du foncier agricole et l'accès aux postulants à l'agriculture dans 3 pays aux situations très contrastées : Brésil, Burkina Faso et France. Au-delà des différences, des points communs sont dégagés, qui représentent autant de défis pour la transition écologique.

The trees in agroforestry plots create spatial heterogeneity of high interest for adaptation, mitigation, and the provision of ecosystem services. But to what distance, exactly, from the tree? We tested a novel approach, based upon geostatistics and Unmanned Aerial Vehicle (UAV) sensing, to infer the distance at which a single agroforestry tree affects the surrounding under-crop, to map yield, litter (i.e. stover) and compute crop-partial Land Equivalent Ratio (LERcp) at the whole-plot level. In an agro-silvo-pastoral parkland of semi-arid western Africa dominated by the multi-purpose tree Faidherbia albida, we harvested the pearl-millet under-crop at the whole-plot scale (ca. 1 ha) and also in subplot transects, at three distances from the trunks. We observed that the yield was three times higher below the tree crown (135.6 g m(-2)) than at a distance of five tree-crown radii from the trunk (47.7 g m(-2)). Through geostatistical analysis of multi-spectral, centimetric-resolution images obtained from an UAV overflight of the entire plot, we determined that the 'Range' parameter of the semi-variogram (assumed to be the distance of influence of the trees on the Normalized difference vegetation index (NDVI)) was 17 m. We correlated the yield (r(2) = 0.41; RRMSE = 48 %) and litter production (r(2) = 0.46; RRMSE = 35 %) in subplots with NDVI, and generated yield and litter maps at the whole-plot scale. The measured whole-plot yield (0.73 t ha(-1)) differed from the one estimated via the UAV mapping by only 20 %, thereby validating the overall approach. The litter was estimated similarly at 1.05 tC ha(-1) yr(-1) and mapped. Using a geostatistical proxy for the sole crop, LERcp was estimated 1.16, despite the low tree density. This new method to handle heterogeneity in agroforestry systems is a first application. We also propose strategies for extension to the landscape level.

Made available in DSpace on 2020-12-10T19:43:34Z (GMT). No. of bitstreams: 0 Previous issue date: 2019-12-01 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Tripartite Research Project (Africa - Brazil-France), Fight against desertification in Africa by INRA/IRD-AIRD Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Gastrointestinal nematodes are a main problem for ruminant production, reducing animal performance and increasing environmental impact per unit of animal product generated. Tannin supplementation may lead to positive results regarding aspects such as parasitic infections and methane (CH4) emissions. Therefore, the objective of this experiment was to evaluate the effects of the condensed tannins (CT) extract made of powdered Acacia mearnsii bark (PAB) on nutrition, parasitic status and CH4 emissions in sheep artificially infected with Trichostrongylus colubriformis and Haemonchus contortus. Twenty 10-month old Santa Ines lambs (24.7 +/- 3.14 kg of initial body weight) were used in a 50-day trial. Animals were divided in four treatment groups according to parasitic infection and PAB supplementation: two control groups without infections, one without PAB (C-) (n = 4) and one with PAB (C+) (n = 4); two infected groups, one without PAB (I-) (n = 6) and another receiving PAR (I+) (n = 6). Initially, animals were kept in individual pens where they were fed ad libitum chopped tifton 85 hay (Cynodon spp.) and 210 g/animal/day of concentrate. On the first day of experiment, animals of I- and I+ groups were artificially infected with infective larvae (L3) of T. colubriformis and H. contortus. Lambs were weighed fortnightly to calculate average daily body weight gain (ADG). Blood and faeces samples were also collected in the same moment of weighing for the evaluation of blood parameters and faecal egg count (FEC) respectively. After 40 days of experiment, measurements of CH4 emissions in small chamber system started and following that, apparent total tract digestibility (ATTD) assay was carried out in metabolic cages. In the end of experimental period (50 days), lambs were slaughtered and samples of abomasum and small intestine content were collected for worm count, identification, and eggs/female count. No significant (p > 0.05) treatment effects were verified for ADG, ATTD and worm count. Blood parameters were affected in both infected groups (p < 0.05) from the 28th experimental day onwards, when these animals started to show reduced red blood cells, haemoglobin and packed cell volume when compared to C- and C+. Decreased FEC was verified in I+ when compared to I- and also, H. contortus eggs/female worm for I+ was lower than for I- (p < 0.05). Both infected groups showed higher CH4 emissions than the control groups (p < 0.05). Results highlighted the anthelmintic potential of PAR and indicated methanogenic effect of parasitic nematode infections. Univ Sao Paulo, Ctr Energia Nucl Agr, Av Centenario 303, BR-13400970 Piracicaba, SP, Brazil SAA SP, Inst Zootecnia, APTA, Nova Odessa, SP, Brazil Lab Biol & Sante Anim DPA INERA, Ouagadougou, Burkina Faso Univ Clermont Auvergne, INRA, UMR Herbivores, VetAgro Sup, F-63122 St Genes Champanelle, France INRA, UMR IHAP 1225, 23 Chemin Capelles, F-31000 Toulouse, France Univ Estadual Paulista, Inst Biociencias, Dept Parasitol, Botucatu, SP, Brazil Univ Fed Maranhao, Ctr Ciencias Agr & Ambientais, Sao Luis, Maranhao, Brazil Univ Florida, Dept Anim Sci, Gainesville, FL 32611 USA Univ Estadual Paulista, Inst Biociencias, Dept Parasitol, Botucatu, SP, Brazil CNPq: 457559/2012-8 FAPESP: 2013/02814-5 FAPESP: 2018/06191-6

Dans la continuité d'une réflexion sur résilience et sécurité alimentaire menée conjointement depuis 2014 (Vonthron et al., 2016 ; Fallot et al., 2019), nous proposons de présenter et discuter les résultats d'un travail de caractérisation des trajectoires de 30 ménages agricoles, et d'analyse des circonstances dans lesquelles leur diversité alimentaire a évolué, dans la province du Tuy au Burkina Faso. Au Burkina Faso comme au Mali, on a pu observer que le développement agricole – caractérisé par l'augmentation des rendements et des revenus – ne donnait pas toujours lieu à une diminution de la malnutrition (Dury & Bocoum, 2012). L'évolution défavorable de la diversité alimentaire des ménages agricoles est en cause. Cette diversité est mesurée par les nutritionnistes en termes de groupes d'aliments consommés par les membres des ménages (Lourme-Ruiz et al., 2016). Le "paradoxe de Sikasso" qui caractérise les situations où la production agricole augmente alors que les populations sont malnutries, amène la recherche pour le développement à étudier les différents facteurs de la diversité alimentaire et à préciser les modalités et la portée de chacune des actions couramment préconisées en matière de sécurité alimentaire et nutritionnelle (projet RELAX, relax.cirad.fr): diversification de la production agricole (Ouédraogo & Sorgho Millogo, 2007 ; Vall et al., 2006); approvisionnement dans la Nature non cultivée (Koffi et al., 2017) ; développement de l'accès aux marchés ; gestion de la soudure et stockage dans les greniers individuels et collectifs (Le Cotty et al., 2019); évolution des recettes et des pratiques alimentaires; rapprochement des politiques agricoles et nutritionnelles (Alpha & Fouilleux, 2018). Des diagnostics, explications et pistes d'amélioration pour la diversité alimentaire sont ainsi fournies par les analyses de différentes disciplines. Caractériser le développement à partir de ces travaux suppose alors d'intégrer les éléments de compréhension des processus en jeu (organisation de la famille dans son exploitation agricole, renouvellement des ressources naturelles, ajustements sur les marchés…), et de tenir compte des circonstances dans lesquelles ils opèrent, ou pas. Pour ce faire et dans une démarche d'évaluation de la résilience des socio-écosystèmes (SES, par exemple un ménage et son exploitation), l'Alliance pour la résilience (Resilience Alliance, 2010) a développé des outils d'analyse des trajectoires d'un SES en fonction des liens entre événements concernant ce SES à différentes échelles (l'exploitation, le village, la région) et entre phénomènes de différentes natures. Le " profil historique " invite à penser les humains dans leur écosystème à propos d'une problématique (ici de sécurité alimentaire), à situer des événements plus ou moins soudains (évènement climatique, réforme foncière, épizootie…) sur des dynamiques plus longues (choix d'usage des sols, répartition des tâches dans le ménage…) et à identifier alors les trajectoires qui résultent de l'interaction de plusieurs processus qui ont des temporalités différentes. Dans le cadre du projet RELAX (2017-2019) et du stage de master de Anta Sanon (2018), les profils historiques de 30 ménages dans 2 villages (Makognadougou et Gombélédougou) ont été élaborés à partir de séries d'entretiens dans ces ménages et d'une revue approfondie de la littérature et des données disponibles sur leur environnement, activités et modes de vie. Les évènements qui ont marqué la trajectoire de chaque ménage depuis sa constitution (année du mariage du chef de famille et de sa 1ère épouse) ont été recensés, ainsi que les changements à l'échelle de la région des Hauts-Bassins et du village. Cette caractérisation est d'abord qualitative, questionnant les dynamiques en interactions susceptibles d'avoir fait évoluer la façon dont le ménage assure son alimentation. L'analyse a permis d'expliciter les circonstances dans lesquelles la diversité alimentaire d'un ménage a été maintenue, dégradée ou améliorée. La systématisation sur 30 ménages de différentes ethnies, âges et dotations en ressources, montre que les facteurs d'évolution de la diversité alimentaire ont changé dans le temps. On observe un rôle croissant des activités extra-agricoles et du recours au marché dans l'amélioration et le maintien de la diversité alimentaire lors de la dégradation des conditions environnementales et climatiques. Et ce sont les changements dans la composition de la famille et les pertes d'animaux qui contribuent le plus souvent à une réduction de la diversité alimentaire. Ces résultats seront discutés pour d'une part contribuer au débat sur les conditions d'un développement agricole favorable à la sécurité alimentaire et nutritionnelle et d'autre part comparer différentes approches et méthodes pour caractériser une trajectoire de développement, notamment avec l'économie du développement (Barrett & Constas, 2014 ), les diagnostics agraires (Baccar et al., 2017 ; Bainville, 2017), la modélisation spatiale (Jahel et al., 2017) et bien sûr la résilience des socio-écosystèmes (Enfors, 2013 ; Lade et al., 2017).

International audience; Hepatitis E virus infection is a significant public health problem in many parts of the world including Africa. We tested serum samples from 900 patients in Burkina Faso presenting with febrile icterus. They all tested negative for yellow fever, but those from 23/900 (2.6%) patients contained markers of acute HEV infection (anti-HEV IgM and HEV RNA positive). Genotyping indicated that 14 of the strains were HEV genotype 2b. There was an overall HEV IgG seroprevalence of 18.2% (164/900). In a bivariate analysis, the factors linked to HEV exposure were climate and patient age. Older patients and those living in arid regions were more likely to have HEV infection. HEV genotype 2b circulating only in humans can be involved in some acute febrile icterus cases in Burkina Faso. Better access to safe water, sanitation, and improved personal hygiene should improve control of HEV infection in this country.

National audience; The adaptation of semi-arid crops to climate changes is theoretically possible through agroforestry, provided that the trees exert little competition, or even increase the multifunctional LER (LER_M). We monitored microclimate, net primary productivity (NPP), CO2 and H2O fluxes in a semiarid agro-sylvo-pastoral system (Niakhar, Senegal), dominated by the multipurpose Faidherbia albida (FA) tree. Undercrops were mainly millet and peanut, under annual rotation. We scanned a 1.24 ha millet under FA plot with UAV photogrammetry in RGB, thermal infrared and multispectral bands. At harvest, we collected 12 subplots of 15 millet holes each, distributed either below the crown of FA, or at 2.5 x crown radius, or at 5 x crown radius. We separated all organs. The whole millet root system (0-200 cm) was sampled also in 2 m trenches, totalizing 4 millet holes, where all roots were sorted by layer. The whole plot harvest will allow extrapolating yield from subplots, through UAV images. Millet yield per unit ground area was about 3 times higher below FA, with still a positive influence at 2.5 x crown radius and less impacts of pests close to FA. In the trenches, we noted higher soil humidity and SOC close to the FA trunks. This observatory is open for collaboration.

International audience; The adaptation of semi-arid crops to climate changes is theoretically possible through agroforestry, provided that the trees exert little competition, or even increase the multifunctional LER (LER_M). We monitored microclimate, net primary productivity (NPP), CO2 and H2O fluxes in a semiarid agro-sylvo-pastoral system (Niakhar, Senegal), dominated by the multipurpose Faidherbia albida (FA) tree. Undercrops were mainly millet and peanut, under annual rotation. We scanned a 1.24 ha millet under FA plot with UAV photogrammetry in RGB, thermal infrared and multispectral bands. At harvest, we collected 12 subplots of 15 millet holes each, distributed either below the crown of FA, or at 2.5 x crown radius, or at 5 x crown radius. We separated all organs. The whole millet root system (0-200 cm) was sampled also in 2 m trenches, totalizing 4 millet holes, where all roots were sorted by layer. The whole plot harvest will allow extrapolating yield from subplots, through UAV images. Millet yield per unit ground area was about 3 times higher below FA, with still a positive influence at 2.5 x crown radius and less impacts of pests close to FA. In the trenches, we noted higher soil humidity and SOC close to the FA trunks. This observatory is open for collaboration.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

The productivity of smallholder farming systems is held back by poor soil fertility, low input levels and erratic rainfall distribution in the sorghum-based cropping systems of the Sudano-Sahelian zone of West Africa. We assessed the sensitivity of current agricultural practices to climate change and to improved management practices: (i) increased fertilizer application combined with increased plant populations and (ii) use of improved sorghum varieties. We applied the Decision Support Systems for Agro-Technological Transfer (DSSAT) Cropping Systems Model, and the Agricultural Production Systems sIMulator (APSIM), for a multiple-farm assessment (i.e. diverse types of management and soils) in Koutiala (Mali) and Navrongo (Ghana), which are representative sites for West African sorghum production systems. Baseline climate data from observed weather (1980–2009) and future climates from five Global Circulation Models (GCMs: 2040–2069) in two Representative Concentration Pathways (RCP 4.5 and 8.5) were used as inputs for crop models. In Navrongo, under current management, sorghum yields either decreased or increased compared to the baseline, depending on the crop models and the GCMs; changes in management options induced a yield increase of up to 256%. The addition of genetic improvement resulted in further yield increases (24%). In Koutiala, sorghum yield changes for future climates ranged from −38 to +8% assuming current management. Shifting to an improved cultivar had a marginal effect on grain yields, while increased fertilizer rates resulted in grain yield increases ranging of 20% and 153% for DSSAT and APSIM, respectively, assuming the current climate. We conclude that in the Sudano-Sahelian zone of West Africa sorghum, as it is cultivated today, appears moderately vulnerable to climate change, while doubling fertilizer inputs with an adjusted planting density, in the current climate, would more than double yields. However, by exploring farm diversity we established that, under certain conditions, the effect of the future climate might be as important as the effect of management changes in the current climate, hinting at the importance of locally-relevant management practices.

Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of this zoonotic infection. Although MERS-CoV infection is ubiquitous in dromedaries across Africa and the Arabian Peninsula, the continuous appearance of zoonotic MERS cases in humans is confined to the Arabian Peninsula. MERS-CoV from Africa has hitherto been poorly studied. Here, we report the genetic and phenotypic characterization of MERS-CoV from dromedaries in African countries. Phylogenetically, viruses from dromedaries in Africa formed a monophyletic clade, which we have provisionally designated as virus clade C. Molecular dating analyses of MERSCoV, including clade C viruses, suggests that the ancestral MERSCoV in dromedaries could have spread to the two continents within a short timeframe. Camel MERS-CoVs fromwest and north African countries form a subclade (C1) that shares genetic signatures of a major deletion in the accessory gene ORF4b. Compared with human and camel MERS-CoV from Saudi Arabia, virus isolates from Burkina Faso (BF785) and Nigeria (Nig1657) had lower virus replication competence in Calu-3 cells and in ex vivo cultures of human bronchus and lung, and BF785 replicated to lower titer in lungs of human DPP4-transduced mice. However, it is still inconclusive whether ORF4b deletions may lead to the reduced replication competence of BF785 and Nig1657. Genetic and phenotypic differences in West African viruses may be relevant to the zoonotic potential of MERS-CoV.

Our objective was to evaluate the effects of Acacia mearnsii bark extract (PAB) on methane (CH4) production in sheep infected with Trichostrongylus colubriformis and Haemonchus contortus. Twenty 10 month-old Santa Inês lambs were used in a 50-day trial. Four treatment groups were formed: two control groups uninfected, one without PAB (C-) (n=4) and one with PAB (C+) (n=4); and two infected groups, one without PAB (I-) (n=6) and another receiving PAB (I+) (n= 6). Animals were kept in individual pens for 40 days, and received ad libitum chopped tifton 85 hay (Cynodon spp.) and 210 g/animal/day of concentrate (PAB supplementation: 15 g/animal/day – in concentrate). Animals were reared indoors to avoid helminthic infections (faecal egg count (FEC) was monthly controlled). At day 0, infected groups were artificially infected with L3 larvae of T. colubriformis (7500)and H. contortus (5000). After 28 days post- infection, establishment of infections was confirmed by FEC: I-: 1150 + 530.1 and I+: 567 + 544.6 eggs/gram of feces. After 40 days of trial (during which other parameters were evaluated - data not shown), CH4 emissions in chambers were measured and variance analysis (proc GLM, SAS®) showed no PAB effects on methanogenesis (p > 0.05), however, both infected groups had higher CH4 emissions than the control groups: C-: 16.7 + 10.91; C+:23.7 + 12.88; I-: 43.1 + 6.37; I+: 40.6 + 6.02 (g CH4/kg dry matter intake) (p < 0.05). The methanogenic effect of parasitc infections should be explored in studies addressing sustainability of animal production.

Mostly found in Africa and its surrounding islands, African streak viruses (AfSV) represent the largest group of known mastreviruses. Of the thirteen AfSV species that are known to infect either cultivated or wild Poaceae plant species, six have been identified on Reunion Island. To better characterize AfSV diversity on this island, we undertook a survey of a small agroecosystem using a new metagenomics-based approach involving rolling circle amplification with random PCR amplification tagging (RCA-RA-PCR), high-throughput sequencing (Illumina HiSeq) and the mastrevirus reads classification using phylogenetic placement. Mastreviruses that likely belong to three new species were discovered and full genome sequences of these were determined by Sanger sequencing. The geminivirus-focused metagenomics approach we applied in this study was useful in both the detection of known and novel mastreviruses. The results confirm that Reunion Island is indeed a hotspot of AfSV diversity and that many of the mastrevirus species have likely been introduced multiple times. Applying a similar approach in other natural and agricultural environments should yield sufficient detail on the composition and diversity of geminivirus communities to precipitate major advances in our understanding of the ecology and the evolutionary history of this important group of viruses.

Soil nutrient deficiency and rainfall variability impair the production of sorghum (Sorghum bicolor (L). Moench) in Sudano-Sahelian zone. The aim is to study the environmental factors that can determine the effect of fertilizer application on sorghum grain yield and to formulate tailored fertilization strategies according to sorghum varieties (hybrid and open pollinated improved varieties) and environmental context. Field experiments were conducted during the 2015 and 2016 growing seasons in Nioro du Rip and in Sinthiou Mal&egrave, me (Senegal). In a randomized complete block design arranged in a split-plot with four replications, three factors were tested: sorghum genotype (G: Fadda, Faourou, Soumalemba and Soumba with different cycle lengths), environment (E: irrigation and rainfed, different soil types and fertility levels), and fertilization management (M: five different combinations of application dose and application time) including T1 = no fertilizer applied, T2 (recommended practice, 100%) = 150 kg/ha of NPK (15-15-15) at emergence + 50 Kg/ha of urea (46%) at tillering + 50 kg/ha of urea at stem extension, T3 = 50% T2, T4 (100% delay) = 150 kg/ha of NPK +50 kg/ha of urea at stem extension +50 kg/ha of urea at heading, T5 = 50% T4. Results showed that: (i) in most environments, stressed plants under late application treatments (T4 and T5) recovered biomass once the fertilizer was applied (ii), grain yield with T5 was higher than with T4 under well-watered conditions (sufficient and well distributed rainfall and eventual complementary irrigations), (iii) Fadda, a hybrid, responded differently to fertilization than the other varieties only for biomass production, (iv) late fertilizer application treatment (T4) gave higher grain yield than the recommended practice (T2) in the environment with low yield potential, and (v) long cycle duration genotypes benefited better from late fertilization compared to short cycle duration genotypes. This study showed that under Sudano-Sahelian conditions late fertilization of sorghum can be beneficial to grain yield if the rainy season has a slow start, depending on sorghum genotypes (i.e., cycle length), and on the initial N content of the soil.

International audience; Solanaceous crops fields are severely affected by the emerging virus Pepper yellow vein Mali virus (PepYVMLV) in West Africa. It belongs to the genus Begomovirus (family Geminiviridae) and is transmitted by Bemisia tabaci. African begomoviruses described on crops are mainly monopartite (DNA-A component), except cassava-infecting bipartite begomoviruses (DNA-A and DNA-B components). Up to now, the PepYVMLV was described as a monopartite Begomovirus. In order to better understand the epidemiology of this virus in West Africa, particularly in Burkina Faso, two surveys were undertaken in the whole country and 1,614 solanaceous plants were collected to be checked for the presence of the virus. The deep characterization allowed to discover the presence of a typical DNA-B associated with the pepper yellow vein disease. This DNA-B is different from those of currently described cassava mosaic Geminiviruses. The discovery of the association of a newly described DNA-B component with the PepYVMLV also leads to the study of the epidemiological parameters of this co-infection. Although this association is relaxed, we demonstrated that disease virulence, viral accumulation and transmission by Bemisia tabaci were increased in co-infection with the DNA-B component. All these factors are probably related to the success of this association in the field. Because of the extreme severity of the resulting disease, the dispersal of this new DNA-B component at a larger scale would represent a major threat to tomato and pepper cultivation in Burkina Faso, Africa and the world in general.

Introducing sorghum (Sorghum bicolor L. Moench) genotypes into new environments is necessary for expanding the production of food and fuel, but these efforts are complicated by significant genotype &times, environment interactions that can reduce their effectiveness. This study set out to thoroughly analyze genotype &times, environment interactions and assess trade-offs between the agronomic performance and the stability of grain and biomass yields of ten contrasting genotypes under Sudano-Sahelian conditions. Experiments were carried out in a randomized complete block design with four replicates. They were conducted from 2013 to 2016 in Bambey, Sinthiou Malem and Nioro du Rip in Senegal. The joint analysis of variance revealed a highly significant effect (p &lt, 0.0001) of genotypes (G), environments (E) and G &times, E interaction. Most genotypes showed specific adaptations. The best grain yields were obtained by the Nieleni and Fadda hybrids, while the improved varieties IS15401 and SK5912 were best for biomass production. An Additive Main effect and Multiplicative Interaction (AMMI) analysis showed that good grain yields were associated with environments having good soil fertility and good rainfall, while biomass yields were more influenced by the sowing date and rainfall. Similarly, we were able to confirm for our 10 sorghum genotypes that yield stability was generally associated with low performance, except for the Nieleni and Fadda hybrids, which performed well for grain and biomass production regardless of the environment. The Senegalese control genotype, 621B, showed particular susceptibility to growing conditions (soil), but remained very productive (more than 3 tons per hectare) under good agro-pedological conditions. These results lead us to recommend the Fadda and Nieleni hybrids for the entire study region, while 621B can also be recommended, but only for highly specific environments with good soils.

The vulnerability of some maize genotypes (Zea mays L.) grown in the southwestern savannah of the Democratic Republic of Congo to water stress was evaluated. The analysis of the data was based on the climatic conditions and on the technical itineraries likely to affect, to improve and to stabilize the agronomic performances of the maize varieties. Interest has been focused on the influence of deficit water conditions on the stability or variability of the agronomic performance of genotypes.Multi-annual, field and semi-controlled trials were conducted for three years (2012 to 2014) at the Mvuazi Research Station and surrounding area where maize (Zea mays L.) is one of the emerging crops.Climatic variations that occur during a growing season greatly influence the phenotypic expression of different parts of the maize plant. Cultivars rich in amino acids are more vulnerable to the adverse effects of vicious droughts on grain yield.Fifteen varieties of corn were tested in the field. The data analysis results showed three groups of distinct phenotypes. The first group is characterized by a sterile plant level 6 t / ha and a flowering interval 4 days with a yield 6 t/ha et un intervalle de floraison 4 jours avec un rendement

International audience; Rice yellow mottle virus (RYMV), a mechanically transmitted virus that causes serious damage to cultivated rice plants, is endemic to Africa. Varietal selection for resistance is considered to be the most effective and sustainable management strategy. Standardized resistance evaluation procedures are required for the identification and characterization of resistance sources. This paper describes a protocol for mechanical inoculation of rice seedlings with RYMV and two methods of resistance evaluation - one based on a symptom severity index and the other on virus detection through double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA).

Rice yellow mottle virus (RYMV) exemplifies the key role in plant virus emergence of the early steps of crop extension and intensification in traditional agriculture. In East Africa, RYMV emerged in the 19(th) century after rice intensification along the Indian Ocean coast, and later spread inland concomitantly with rice introduction. In West Africa, the contrasted history of rice cultivation among regions differently shaped RYMV populations. A biogeographical approach - which jointly considers the spatial distribution of the virus and its hosts over time - was applied to reach these conclusions. We linked the evolution of RYMV over the past two centuries to a geographical map of the history of rice cultivation in Africa.

Significance Middle East respiratory syndrome (MERS) is a zoonotic disease of global health concern, and dromedary camels are the source of human infection. Although Africa has the largest number of dromedary camels, and MERS-coronavirus (MERS-CoV) is endemic in these camels, locally acquired zoonotic MERS is not reported from Africa. However, little is known of the genetic or phenotypic characterization of MERS-CoV from Africa. In this study we characterize MERS-CoV from Burkina Faso, Nigeria, Morocco, and Ethiopia. We demonstrate viral genetic and phenotypic differences in viruses from West Africa, which may be relevant to differences in zoonotic potential, highlighting the need for studies of MERS-CoV at the animal–human interface., Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of zoonotic infection. Although MERS-CoV infection is ubiquitous in dromedaries across Africa as well as in the Arabian Peninsula, zoonotic disease appears confined to the Arabian Peninsula. MERS-CoVs from Africa have hitherto been poorly studied. We genetically and phenotypically characterized MERS-CoV from dromedaries sampled in Morocco, Burkina Faso, Nigeria, and Ethiopia. Viruses from Africa (clade C) are phylogenetically distinct from contemporary viruses from the Arabian Peninsula (clades A and B) but remain antigenically similar in microneutralization tests. Viruses from West (Nigeria, Burkina Faso) and North (Morocco) Africa form a subclade, C1, that shares clade-defining genetic signatures including deletions in the accessory gene ORF4b. Compared with human and camel MERS-CoV from Saudi Arabia, virus isolates from Burkina Faso (BF785) and Nigeria (Nig1657) had lower virus replication competence in Calu-3 cells and in ex vivo cultures of human bronchus and lung. BF785 replicated to lower titer in lungs of human DPP4-transduced mice. A reverse genetics-derived recombinant MERS-CoV (EMC) lacking ORF4b elicited higher type I and III IFN responses than the isogenic EMC virus in Calu-3 cells. However, ORF4b deletions may not be the major determinant of the reduced replication competence of BF785 and Nig1657. Genetic and phenotypic differences in West African viruses may be relevant to zoonotic potential. There is an urgent need for studies of MERS-CoV at the animal–human interface.

Acacia nilotica var adansonii (Guill. et Perr.) O. Ktze and Acacia raddiana (Savi) species are local ressources important to feed animals in Sahelian area of Burkina Faso. Thus, this experiment was to investigate the in vitro effect of both Acacias on ruminal fermentation, CH4 production and rumen microbial community using a semi-automatic system. In all experiments, 25 mL of the inoculum solution was incubated with 50 mL of buffered rumen fluid at 39 °C and gas production was measured at 2, 4, 8, 12 and 24 h. The results show that A. nilotica was rich in condensed tannins and fiber content compared to A. raddiana which was rich in total tannins. A. raddiana treatment presented greater degradability of organic matter and lower CH4 production compared to A. nilotica and control group (P0.05). We conclude that A. nilotica leaves showed negative effect on ruminal fermentation due to high fiber and CT content, and A. raddiana could be an interesting plant to increase fiber digestion and reduce CH4 production in vitro., Acacia nilotica var adansonii (Guill. et Perr.) O. Ktze y Acacia raddiana (Savi) son recursos locales importantes para alimentar animales en la región saheliana de Burkina Faso. Por lo tanto, este experimento fue para investigar el efecto in vitro de Acacia en la fermentación ruminal, la producción de CH4 y la comunidad microbiana del rumen utilizando un sistema semi-automático. La técnica de producción de gas in vitro se utilizó para evaluar el efecto de las plantas ricas en taninos en la formación de CH4 por las ovejas. En todos los experimentos, se incubaron 25 ml de la solución de inóculo con 50 ml de fluido ruminal tamponado a 39 °C y se midió la producción de gas a las 2, 4, 8, 12 y 24 h. Los resultados muestran que A. nilotica es rica en taninos condensados y contenido de fibra (NDF, ADF y ADL) en comparación con A. raddiana que es rica en taninos totales. El tratamiento con A. raddiana presentó mayor degradabilidad de la materia orgánica (DMO) y menor producción de CH4 en comparación con A. nilotica y el grupo control (P 0.05). Concluimos que las hojas de A. nilotica mostraron un efecto negativo sobre la fermentación ruminal debido al alto contenido de fibra y CT, y A. raddiana podría ser una planta interesante para aumentar la digestión de la fibra y reducir la producción de CH4 in vitro.

International audience; In West Africa, the use of organophospates and pyrethroid insecticides to control cotton pests has led to the evolution of resistance in field populations of Bemisia tabaci Gennadius. Three pest management programs have been commonly recommended: the Conventional Program (CP) where 6 treatments are applied, the use of Bt cotton plants for which only 2 applications of neonicotinoids are required and that has been adopted in many countries, and a biological program (BP) without any chemical treatment. The present study aimed to determine the influence of these practices on the frequency of mutations that confer resistance to pyrethroids (mutation L925I in the para-type voltage-gated sodium channel gene) and organophosphates (mutation F331W in the acetylcholinesterase enzyme ace1: allele Ace1 R) in B. tabaci populations using Bt cotton and CP areas in Pô and Saria (Burkina Faso), CP and BP areas in Kandi (Benin) and only CP areas in Tové and Infa (Togo). All individuals sampled belonged to the MED (biotypes MED-Q1) and Africa Silver Leafing (ASL) species. MED-Q1 was found in sympatry with ASL in Burkina Faso both on CP and Bt cotton areas at variable frequencies. In Togo and Benin, only ASL was found, except in Tové where MED-Q1 was also detected, but at low frequency. Frequencies of mutations that confer resistance varied between localities and species but we did not find any strong evidence of a relationship between the pest management program and these frequencies except for the allele Ace1 R in Burkina Faso for which the frequencies decrease when chemical applications are reduced. This study provides valuable information for the development of efficient integrated pest management programs.

International audience; Begomoviruses (family Geminiviridae) are frequently associated with alphasatellites and betasatellites in the Old World. Tomato yellow leaf curl virus, one of the most damaging begomovirus species worldwide, was recently found associated with betasatellites in the eastern coast of the Mediterranean Sea, and in the Middle East region. Tomato yellow leaf curl virus (TYLCV)/betasatellite associations were shown to increase TYLCV virulence in experimental conditions. The sustainability of TYLCV/satellite associations in tomato was assessed here by estimating accumulation levels of satellites in comparison to TYLCV, vector transmission efficiency, and by testing how far the popular Ty-1 resistance gene used in most TYLCV-resistant tomato cultivars in the Mediterranean Basin is effective against betasatellites. Three satellites previously isolated from okra in Burkina Faso-of the species Cotton leaf curl Gezira betasatellite, Cotton leaf curl Gezira alphasatellite and Okra leaf curl Burkina Faso alphasatellite-were shown to accumulate at levels similar to, or higher than, the helper virus TYLCV-Mld in tomato plants from 32 to 150 days post inoculation (dpi). Cotton leaf curl Gezira betasatellite (CLCuGB) reduced TYLCV-Mld accumulation whereas alphasatellites did not. Transmission tests were performed with B. tabaci from plants infected with TYLCV-Mld/CLCuGB- or TYLCV-Mld/Okra leaf curl Burkina Faso alphasatellite. At 32 dpi, both satellites were transmitted to more than 50% of TYLCV-infected test plants. Betasatellite transmission, tested further with 150 dpi source plants was successful in more than 30% of TYLCV-infected test plants. Ty-1 resistant tomato plants co-infected with TYLCV (-Mld or -IL) and CLCuGB exhibited mild leaf curling and mosaic symptoms at the early stage of infection associated with a positive effect on TYLCV-IL accumulation, while resistant plants infected with TYLCV only, were asymptomatic. Together with previous experimental studies, these results further emphasize the potential risk of betasatellites to tomato cultivation, including with Ty-1 resistant cultivars.

Sorghum [Sorghum bicolor (L.) Moench] is an important food crop in Burkina Faso. Farmers grow various sorghum landraces, distinguished by their morphological and phenological characteristics. This study aimed addressing how this varietal diversity is managed by farmers, and how their management shape the genetic structures of local sorghum. Diversity levels in ten local sorghum guinea varieties (25 panicles per variety) collected from different farms in three agro-ecological regions across Burkina Faso were assessed using nine agro-morphological traits and twelve SSR markers. The importance of phenotypic intra-varietal diversity in early, intermediate and late maturing varieties varied in relation to the observed trait. The genetic analysis specified that the highest diversity rates were in the late maturing varieties (3.3 for allelic richness and 0.47 for gene diversity). Factorial Discriminant Analysis on quantitative traits and cluster analysis based on SSR markers showed that early maturing varieties were discriminated from late and intermediate ones, confirming farmers’ classification of maturity groups (MG). Multivariate QST and FST values revealed two subgroups of quantitative traits that underwent either stabilizing or divergent selection among MG scale. These results underline the role of farmer practices in phenotypic and genetic evolution of sorghum. This concept should be well considered in sorghum breeding programs.© 2016 International Formulae Group. All rights reserved.Keywords: Sorghum, landraces, intra-varietal diversity, FST, QST

International audience; The aim of this study was to investigate the influence of volatile compounds from four secondary host plants on the ability of [i]Dinarmus basalis[/i] Rond. (Hymenoptera: Pteromalidae) to locate, recognize, and parasitize its host, 4th instar larvae or pupae of [i]Callosobruchus maculatus[/i] F. ([i]Coleoptera: Chrysomelidae[/i]). To examine this, strains of [i]D. basalis[/i] were transferred from cowpea seeds [i](Vigna unguiculata[/i] (L.) Walp. (Fabales: [i]Fabaceae[/i])) to pigeon pea ([i]Cajanus cajan[/i] (L.) Millsp.) and two varieties of Bambara groundnut ([i]Vigna subterranea[/i] (L.) Verdc.) seeds. The ability of D. [i]basalis[/i] females to recognize the volatile compounds emanating from their complex host plant was tested by using a Y-tube olfactometer and a three-dimensional device. The results suggest that when females have a choice between pure air and the air emanating from their complex host of origin, they are attracted to the air tainted by the volatile compounds they have become accustomed to. They spent significantly more time (p < 0.0001) in the branch of the tube leading to the odorous air than in the tube leading to the pure air. When females from pigeon pea seed hosts were offered a choice between cowpea and pigeon pea seeds, all containing 4th instar larvae, the familiar odor of pigeon pea seeds were most attractive. When females from Bambara groundnut (white and striped) seed hosts were offered a choice between cowpea and pigeon pea seeds, all containing 4th instar larvae, they were significantly attracted to the odour of cowpea seeds. In the three-dimensional system, the females from the four strains did not appear to have any preference for a given type of seed containing 4th instar larvae or pupae. The parasitism rate remained high on all four types of seeds used. These results show that the use of D. [i]basalis[/i] as a biological control agent is possible in host changing situations where C. maculatus starts to attack other legumes. The results of this study also provide information supporting the behavioral plasticity of D. [i]basalis[/i]. Understanding the mechanisms involved in the adaptive phenomena of biological control agents is discussed in the context of the development of adequate methods of pest control.