Search

DNA damage repair (DDR) is a safeguard for genome integrity maintenance. Increasing DDR efficiency could increase the yield of induced pluripotent stem cells (iPSC) upon reprogramming from somatic cells. The epigenetic mechanisms governing DDR during iPSC reprogramming are not completely understood. Our goal was to evaluate the splicing isoforms of histone variant macroH2A1, macroH2A1.1, and macroH2A1.2, as potential regulators of DDR during iPSC reprogramming. GFP-Trap one-step isolation of mtagGFP-macroH2A1.1 or mtagGFP-macroH2A1.2 fusion proteins from overexpressing human cell lines, followed by liquid chromatography-tandem mass spectrometry analysis, uncovered macroH2A1.1 exclusive interaction with Poly-ADP Ribose Polymerase 1 (PARP1) and X-ray cross-complementing protein 1 (XRCC1). MacroH2A1.1 overexpression in U2OS-GFP reporter cells enhanced specifically nonhomologous end joining (NHEJ) repair pathway, while macroH2A1.1 knock-out (KO) mice showed an impaired DDR capacity. The exclusive interaction of macroH2A1.1, but not macroH2A1.2, with PARP1/XRCC1, was confirmed in human umbilical vein endothelial cells (HUVEC) undergoing reprogramming into iPSC through episomal vectors. In HUVEC, macroH2A1.1 overexpression activated transcriptional programs that enhanced DDR and reprogramming. Consistently, macroH2A1.1 but not macroH2A1.2 overexpression improved iPSC reprogramming. We propose the macroH2A1 splicing isoform macroH2A1.1 as a promising epigenetic target to improve iPSC genome stability and therapeutic potential.

Human-induced pluripotent stem cells (iPSCs) can be derived from adult stem cells by forced expression of defined transcription factors. This paves the way for autologous iPSC-derived therapies, which, however, are not yet considered safe. Moreover, reprogramming of somatic cells into iPSCs is an inefficient process, in the range of 0.1%–1%. The epigenetic mechanisms implicated in iPSCs reprogramming are not well understood. The substitution of canonical histone H2A with macroH2A1 histone variant exon-spliced isoforms (macroH2A1.1 and macroH2A1.2) appears as an emerging regulator of iPSCs identity. In particular, we have previously shown that overexpression of macroH2A1.1 led to a more efficient iPSCs reprogramming, by not fully defined mechanisms. Cleavage under targets and tagmentation (CUT&Tag) is a recent methodology used for robust epigenomic profiling of a limited amount of cells. Here, we performed the first integrative CUT&Tag/RNA-Seq analysis of the histone variant macroH2A1-dependent orchestration of iPSCs reprogramming using human umbilical vein endothelial cells (HUVEC) during their reprogramming into iPSC over-expressing tagged macroH2A1.1 or macroH2A1.2. Our results demonstrate a higher and more widespread genome occupancy and a greater number of differentially expressed genes orchestrated by macroH2A1.1 in HUVEC undergoing reprogramming as compared to macroH2A1.2, which involved pervasive functions related to the three embryonic germ layers and increased overlap with CTCF, FOS, GATA2, and POLR2A transcription factor binding sites. In particular, all predicted macroH2A1.1 activating pathways were related to ectoderm/neural processes. As macroH2A1 isoforms have been previously associated with pathologies of the nervous system, our findings may provide relevant molecular insights for modeling neurodegenerative diseases using iPSCs.

Human embryonic stem cells (hESCs) are used in cell therapy mainly in targeted therapy for not yet curable diseases such as diabetes mellitus, spinal cord injury or Parkinson's disease. The aim of this study is the derivation of clinical-grade hESCs, usable in drug development, non-native medicine and cell therapy. Embryos were thawed, cultivated to the blastocyst stage if necessary, and subsequently assisted hatching was performed. From 1/2018 to 7/2020, 138 selected clients were asked for consent with the donation, of whom 52 did not respond, 19 terminated and 29 extended embryo storage. Only 38 clients (27.5%) agreed to donate their embryos for the derivation of hESCs. At the same time, personal communication with clients took place and another 17 embryo donors were obtained. A total of 160 embryos from 55 donors aged 26–42 years were collected. The embryos were frozen at blastocyst (33.1%) or morula (46.3%) stage. A total of 160 donated embryos were obtained. After preparation of 64 embryos, the embryoblast was isolated and subsequently cultured. Finally, 7 hESC lines were obtained, 4 research-grade lines and 3 clinical-grade lines, the first created in the Czech Republic.

Objective The work deals with a clinical part of human embryonic stem cell (hESC) research. The aim of the project is the differentiation of somatic cell types, useful in drug development, regenerative medicine and cell therapy. The aim of this work is to enable targeted therapy of yet incurable diseases. The pluripotent hESCs have unlimited self-renewal capacity. This ability is used in therapy to create missing or damaged cells in the human body. It is of interest to develop clinical-grade hESC lines useful in preclinical and clinical studies. Methods The derivation of the hESC must respect the legislation of the Czech Republic and the EU. The aim was to develop an informed consent of both donors for donated discarded embryos that are not suitable for treatment by in vitro fertilization according to Directive 2004/23/EC. The FNBs Center for Assisted Reproduction (CAR) participates in oocyte collection, cultivation and cryopreservation of embryos, communication with clients and ensuring the informed consent of embryo donors. A transport protocol and a methodology for handing over the thawed embryos with the original numerical code were developed. Before the embryos are handed over to the ICRC co-authors workplace (CTEF), they are thawed and, if necessary, recultivated to the blastocyst stage; afterwards, assisted hatching is performed. Results In the period from January 2018 to July 2020, 138 selected suitable clients were asked for donations, with 52 not responding, 19 terminating and 29 extending the embryo storage. Only 38 clients, i.e. 27.5%, agreed with the usage of their embryos for the preparation of hESCs. In the same period, personal communication with suitable CAR clients took place and another 17 embryo donors were obtained. A total of 160 embryos were obtained from 55 donors aged 26 to 42 years. The embryos were most often frozen in the blastocyst (53 embryos - 33.1%) and morula (74 embryos - 46.3%) stages. Of the 29 genetically examined embryos, only 5 are euploid (17.2%), 2 are mosaic and 22 are aneuploid or with translocations or carriers with a monogenic defect. Conclusion We have an informed consent prepared and approved by the Ethics Committee of the Masaryk University and the University Hospital Brno; 160 donated embryos have been selected and secured. A transport protocol and handover methodology are developed. The plan for the transfer of thawed anonymized embryos in the first phase, October - December 2020, includes approximately 5 thawed blastocysts per week with assisted hatching. After their transfer to the CTEF, the embryoblast will be isolated with subsequent cultivation. The established hESCs must meet the specified criteria of safety, stability and pluripotency. We believe that, in accordance with the project plan, we will obtain at least 3 clinical-grade hESC lines, the first created in the Czech Republic, respecting the requirements for Advanced Medicinal Therapy Products (AMTP).

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Human embryonic stem cells (hESCs) represent a virtually unlimited source of cells suitable for a variety of biomedical applications. However, a diminishing allogeneic background and undefined culture conditions are essential for developing robust and replicable protocols for differentiation experiments, disease modeling, and drug testing. Therefore, here we report the generation of the two sex-discordant sibling hESC lines, MUNIe008-A and MUNIe009-A, using the mechanical biopsy of vitrified-thawed embryos under xeno- and feeder-free conditions. The presented approach is applicable for deriving high-quality clinical-grade hESC lines for cell replacement therapies.

Chimeric antigen receptor T-cells (CAR T-cells) represent a novel and promising approach in cancer immunotherapy. According to the World Health Organization (WHO), the number of oncological patients is steadily growing in developed countries despite immense progress in oncological treatments, and the prognosis of individual patients is still relatively poor. Exceptional results have been recorded for CAR T-cell therapy in patients suffering from B-cell malignancies. This success opens up the possibility of using the same approach for other types of cancers. To date, the most common method for CAR T-cell generation is the use of viral vectors. However, dealing with virus-derived vectors brings possible obstacles in the CAR T-cell manufacturing process owing to strict regulations and high cost demands. Alternative approaches may facilitate further development and the transfer of the method to clinical practice. The most promising substitutes for virus-derived vectors are transposon-derived vectors, most commonly sleeping beauty, which offer great coding capability and a safe integration profile while maintaining a relatively low production cost. This review is aimed at summarizing the state of the art of nonviral approaches in CAR T-cell generation, with a unique perspective on the conditions in clinical applications and current Good Manufacturing Practice. If CAR T-cell therapy is to be routinely used in medical practice, the manufacturing cost and complexity need to be as low as possible, and transposon-based vectors seem to meet these criteria better than viral-based vectors.

Mesenchymal stem cells (MSCs) have become a promising tool in cellular therapy for restoring immune system haemostasis, however, the success of clinical trials has been impaired by the lack of standardized manufacturing processes. This study aims to determine the suitability of source tissues and culture media for the production of MSC-based advanced therapy medicinal products (ATMPs) and to define parameters to extend the set of release criteria. MSCs were isolated from umbilical cord (UC), bone marrow and lipoaspirate and expanded in three different culture media. MSC phenotype, proliferation capacity and immunosuppressive parameters were evaluated in normal MSCs compared to primed MSCs treated with cytokines mimicking an inflammatory environment. Compared to bone marrow and lipoaspirate, UC-derived MSCs (UC-MSCs) showed the highest proliferative capacity, which was further enhanced by media supplemented with bFGF, while the cells maintained their immunosuppressive characteristics. Moreover, UC-MSCs expanded in the bFGF-enriched medium were the least sensitive to undesirable priming-induced changes in the MSC phenotype. Surface markers and secreted factors were identified to reflect the cell response to inflammatory priming and to be variable among MSCs from different source tissues. This study demonstrates that UC is a favorable cell source for manufacturing MSC-based ATMPs for immunosuppressive applications. UC-MSCs are able to use the bFGF-enriched medium for higher cell yields without the impairment of immunosuppressive parameters and undesirable phenotype changes after inflammatory preconditioning of MSCs before transplantation. Additionally, immunosuppressive parameters were identified to help finding predictors of clinically efficient MSCs in the following clinical trials.

Significance: Since their discovery, induced pluripotent stem cells (iPSCs) had generated considerable interest in the scientific community for their great potential in regenerative medicine, disease modeling, and cell-based therapeutic approach, due to their unique characteristics of self-renewal and pluripotency. Recent Advances: Technological advances in iPSC genome-wide epigenetic profiling led to the elucidation of the epigenetic control of cellular identity during nuclear reprogramming. Moreover, iPSC physiology and metabolism are tightly regulated by oxidation-reduction events that mainly occur during the respiratory chain. In theory, iPSC-derived differentiated cells would be ideal for stem cell transplantation as autologous cells from donors, as the risks of rejection are minimal. Critical Issues: However, iPSCs experience high oxidative stress that, in turn, confers a high risk of increased genomic instability, which is most often linked to DNA repair deficiencies. Genomic instability has to be assessed before iPSCs can be used in therapeutic designs. Future Directions: This review will particularly focus on the links between redox balance and epigenetic modifications-in particular based on the histone variant macroH2A1-that determine DNA damage response in iPSCs and derived differentiated cells, and that might be exploited to decrease the teratogenic potential on iPSC transplantation. Antioxid. Redox Signal. 34, 335-349.

Human pluripotent stem cells have the potential to change the way in which human diseases are cured. Clinical-grade human embryonic stem cells and human induced pluripotent stem cells have to be created according to current good manufacturing practices and regulations. Quality and safety must be of the highest importance when humans’ lives are at stake. With the rising number of clinical trials, there is a need for a consensus on hPSCs characterization. Here, we summarize mandatory and ′for information only′ characterization methods with release criteria for the establishment of clinical-grade hPSC lines.

The eukaryotic nucleus is a highly complex structure that carries out multiple functions primarily needed for gene expression, and among them, transcription seems to be the most fundamental. Diverse approaches have demonstrated that transcription takes place at discrete sites known as transcription factories, wherein RNA polymerase II (RNAP II) is attached to the factory and immobilized while transcribing DNA. It has been proposed that transcription factories promote chromatin loop formation, creating long-range interactions in which relatively distant genes can be transcribed simultaneously. In this study, we examined long-range interactions between thePOU5F1gene and genes previously identified as beingPOU5F1enhancer-interacting, namely,CDYL,TLE2,RARG, andMSX1(all involved in transcriptional regulation), in human pluripotent stem cells (hPSCs) and their early differentiated counterparts. As a control gene,RUNX1was used, which is expressed during hematopoietic differentiation and not associated with pluripotency. To reveal how these long-range interactions betweenPOU5F1and the selected genes change with the onset of differentiation and upon RNAP II inhibition, we performed three-dimensional fluorescence in situ hybridization (3D-FISH) followed by computational simulation analysis. Our analysis showed that the numbers of long-range interactions between specific genes decrease during differentiation, suggesting that the transcription of monitored genes is associated with pluripotency. In addition, we showed that upon inhibition of RNAP II, long-range associations do not disintegrate and remain constant. We also analyzed the distance distributions of these genes in the context of their positions in the nucleus and revealed that they tend to have similar patterns resembling normal distribution. Furthermore, we compared data createdin vitroand in silico to assess the biological relevance of our results.

The molecular machinery of endoplasmic reticulum (ER) integrates various intracellular and extracellular cues to maintain homeostasis in diverse physiological or pathological scenarios. ER stress and the unfolded protein response (UPR) have been found to mediate molecular and biochemical mechanisms that affect cell proliferation, differentiation, and apoptosis. Although a number of reviews on the ER stress response have been published, comprehensive reviews that broadly summarize ER physiology in the context of pluripotency, embryonic development, and tissue homeostasis are lacking. This review complements the current ER literature and provides a summary of the important findings on the role of the ER stress and UPR in embryonic development and pluripotent stem cells.

The incorporation of histone H3 with an acetylated lysine 56 (H3K56ac) into the nucleosome is important for chromatin remodeling and serves as a marker of new nucleosomes during DNA replication and repair in yeast. However, in human cells, the level of H3K56ac is greatly reduced, and its role during the cell cycle is controversial. Our aim was to determine the potential of H3K56ac to regulate cell cycle progression in different human cell lines. A significant increase in the number of H3K56ac foci, but not in H3K56ac protein levels, was observed during the S and G2 phases in cancer cell lines, but was not observed in embryonic stem cell lines. Despite this increase, the H3K56ac signal was not present in late replication chromatin, and H3K56ac protein levels did not decrease after the inhibition of DNA replication. H3K56ac was not tightly associated with the chromatin and was primarily localized to active chromatin regions. Our results support the role of H3K56ac in transcriptionally active chromatin areas but do not confirm H3K56ac as a marker of newly synthetized nucleosomes in DNA replication.

New approaches in regenerative medicine and vasculogenesis have generated a demand for sufficient numbers of human endothelial cells (ECs). ECs and their progenitors reside on the interior surface of blood and lymphatic vessels or circulate in peripheral blood; however, their numbers are limited, and they are difficult to expand after isolation. Recent advances in human induced pluripotent stem cell (hiPSC) research have opened possible avenues to generate unlimited numbers of ECs from easily accessible cell sources, such as the peripheral blood. In this study, we reprogrammed peripheral blood mononuclear cells, human umbilical vein endothelial cells (HUVECs), and human saphenous vein endothelial cells (HSVECs) into hiPSCs and differentiated them into ECs. The phenotype profiles, functionality, and genome stability of all hiPSC-derived ECs were assessed and compared with HUVECs and HSVECs. hiPSC-derived ECs resembled their natural EC counterparts, as shown by the expression of the endothelial surface markers CD31 and CD144 and the results of the functional analysis. Higher expression of endothelial progenitor markers CD34 and kinase insert domain receptor (KDR) was measured in hiPSC-derived ECs. An analysis of phosphorylated histone H2AX (γH2AX) foci revealed that an increased number of DNA double-strand breaks upon reprogramming into pluripotent cells. However, differentiation into ECs restored a normal number of γH2AX foci. Our hiPSCs retained a normal karyotype, with the exception of the HSVEC-derived hiPSC line, which displayed mosaicism due to a gain of chromosome 1. Peripheral blood from adult donors is a suitable source for the unlimited production of patient-specific ECs through the hiPSC interstage. hiPSC-derived ECs are fully functional and comparable to natural ECs. The protocol is eligible for clinical applications in regenerative medicine, if the genomic stability of the pluripotent cell stage is closely monitored.

Background: Endothelial progenitor cells (EPCs) were indicated in vascular repair, angiogenesis of ischemic organs, and inhibition of formation of initial hyperplasia. Differentiation of endothelial cells (ECs) from human induced pluripotent stem cells (hiPSC)-derived endothelial cells (hiPSC-ECs) provides an unlimited supply for clinical application. Furthermore, magnetic cell labelling offers an effective way of targeting and visualization of hiPSC-ECs and is the next step towards in vivo studies. Methods: ECs were differentiated from hiPSCs and labelled with uncoated superparamagnetic iron-oxide nanoparticles (uSPIONs). uSPION uptake was compared between hiPSC-ECs and mature ECs isolated from patients by software analysis of microscopy pictures after Prussian blue cell staining. The acute and long-term cytotoxic effects of uSPIONs were evaluated by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay) and Annexin assay. Results: We showed, for the first time, uptake of uncoated SPIONs (uSPIONs) by hiPSC-ECs. In comparison with mature ECs of identical genetic background hiPSC-ECs showed lower uSPION uptake. However, all the studied endothelial cells were effectively labelled and showed magnetic properties even with low labelling concentration of uSPIONs. uSPIONs prepared by microwave plasma synthesis did not show any cytotoxicity nor impair endothelial properties. Conclusion: We show that hiPSC-ECs labelling with low concentration of uSPIONs is feasible and does not show any toxic effects in vitro, which is an important step towards animal studies.

Imatinib mesylate is a standard first-line therapy for patients with chronic myelogenous leukemia. However, there is still a significant proportion of these patients who reflect sub-optimal responses or fail imatinib therapy. Knowledge of the distribution within the studied system (e.g., peripheral blood) may be of high importance for understanding the principles of drug action and possible patient resistance to treatment. Intracellular or more precisely cell-associated, imatinib concentrations in patients, were shown to be higher compared to those in plasma, but still only limited data related to the methodology aspects of cell-associated concentrations are available. Herein is presented an assessment of the cell-associated imatinib determination assay by mass spectrometry. Three approaches were evaluated to isolate cells from the peripheral blood of chronic myelogenous leukemia patients. Erythrocyte lysis was found to cause substantial leakage of cell-associated imatinib in the first step. Selected alte...

In this study, the effects of insulin and dexamethasone on the expression and mRNA transcription of 4 pulmonary surfactant-associated proteins [surfactant protein (SFTP)A, SFTPB, SFTPC and SFTPD] were examined. The commercially available cell lines, A549 and H441, were used as acceptable models of lung surfactant-producing cells. Subsequently, the effects of insulin on the expression of surfactant-associated proteins were examined in patients with lung adenocarcinoma during lung resection. Our results demonstrated the inhibitory effects of insulin on the transcription of the SFTPB, SFTPC and SFTPD genes in H441 cells and the SFTPB gene in A549 cells. Treatment with insulin significantly decreased the protein expression of SFTPA1 and SFTPA2 in the H441 cells and that of proSFTPB in the A549 cells. Dexamethasone promoted the transcription of the SFTPB, SFTPC and SFTPD genes in the A549 and H441 cells and reduced the transcription of the SFTPA1 and SFTPA2 genes in the H441 cells (SFTPA mRNA expression was not detected in A549 cells). Furthermore, we demonstrated that the mRNA levels of the selected genes were significantly lower in the cell lines compared to the lung tissue. A549 and H441 cells represent similar cell types. Yet, in our experiments, these cells reacted differently to insulin and/or dexamethasone treatment, and the mRNA levels of their main protein products, surfactant-associated proteins, were significantly lower than those in real tissue. Therefore, the results obtained in this study challenge the suitability of A549 and H441 cells as models of type II pneumocytes and Clara cells, respectively. However, we successfully demonstrate the possibility of studying the effects of insulin on pulmonary surfactant-associated genes and proteins in patients with lung adenocarcinoma.

Background Human induced pluripotent stem cells (hiPSCs) play roles in both disease modelling and regenerative medicine. It is critical that the genomic integrity of the cells remains intact and that the DNA repair systems are fully functional. In this article, we focused on the detection of DNA double-strand breaks (DSBs) by phosphorylated histone H2AX (known as γH2AX) and p53-binding protein 1 (53BP1) in three distinct lines of hiPSCs, their source cells, and one line of human embryonic stem cells (hESCs). Methods We measured spontaneously occurring DSBs throughout the process of fibroblast reprogramming and during long-term in vitro culturing. To assess the variations in the functionality of the DNA repair system among the samples, the number of DSBs induced by γ-irradiation and the decrease over time was analysed. The foci number was detected by fluorescence microscopy separately for the G1 and S/G2 cell cycle phases. Results We demonstrated that fibroblasts contained a low number of non-replication-related DSBs, while this number increased after reprogramming into hiPSCs and then decreased again after long-term in vitro passaging. The artificial induction of DSBs revealed that the repair mechanisms function well in the source cells and hiPSCs at low passages, but fail to recognize a substantial proportion of DSBs at high passages. Conclusions Our observations suggest that cellular reprogramming increases the DSB number but that the repair mechanism functions well. However, after prolonged in vitro culturing of hiPSCs, the repair capacity decreases. Electronic supplementary material The online version of this article (doi:10.1186/s13287-017-0522-5) contains supplementary material, which is available to authorized users.

Cardiovascular diseases belong to the most widespread illnesses in the developed countries. Therefore, the regenerative medicine and tissue modeling applications are highly interested in studying the ability of endothelial cells, derived from human stem cells, to form vascular networks. Several characteristics can be measured on images of these networks and hence describe the quality of the endothelial cells. With advances in the image processing, automatic analysis of these complex images becomes increasingly common. In this study, we introduce a new graph structure and additional constraints to the cellular Potts model, a framework commonly utilized in computational biology. Our extension allows to generate visually plausible synthetic image sequences of evolving fluorescently labeled vascular networks with ground truth data. Such generated datasets can be subsequently used for testing and validating methods employed for the analysis and measurement of the images of real vascular networks.

Gammadelta T cells are intensively studied because their function in infection, allergy, autoimmune disease, cancer and post-transplant period is not yet fully understood. PCR-based techniques were established to study the gamma variable (Vgamma) and delta variable (Vdelta) gene families. PCR product evaluation is routinely carried out by Southern blot analysis or the third complementarity-determining region (CDR3) spectratyping, but a fast and simple assessment of Vgamma and Vdelta gene family expression is missing. The aim of our study was to test capillary electrophoresis as a potential method for evaluating the composition of the gammadelta T-cell population. This report provides optimized PCR conditions for gammadelta T-cell receptor amplification. Further it describes the utilization of capillary electrophoresis in the Agilent 2100 Bioanalyzer to evaluate the relative expression of Vgamma and Vdelta gene families after their amplification. An application of the methodology to peripheral blood mononuclear cell samples from patients during hemato-oncological treatment is shown. The described methodology is fast and simple to operate and is therefore suitable as a first screening of the gammadelta T-cell population composition in tissues of interest.

International audience; CD34 is the most frequently used marker for the selection of cells for bone marrow (BM) transplantation. The use of CD133 as an alternative marker is an open research topic. The goal of this study was to evaluate the proliferation and differentiation potential for hematopoiesis (short and long term) of CD133+ and CD34+ populations from bone marrow and mobilized peripheral blood. Eight cell populations were compared: CD34+ and CD133+ cells from both the BM (CML Ph−, CML Ph+, and healthy volunteers) and mobilized peripheral blood cells. Multicolor flow cytometry and cultivation experiments were used to measure expression and differentiation of the individual populations. It was observed that the CD133+ BM population showed higher cell expansion. Another finding is that during a 6-day cultivation with 5(6)-carboxyfluorescein diacetate -succinimidyl ester (CFSE), more cells remained in division D0 (non-dividing cells). There was a higher percentage of CD38− cells observed on the CD133+ BM population. It was also observed that the studied populations contained very similar but not the same pools of progenitors: erythroid, lymphoid, and myeloid. This was confirmed by CFU-GM and CFU-E experiments. The VEGFR antigen was used to monitor subpopulations of endothelial sinusoidal progenitors. The CD133+ BM population contained significantly more VEGFR+ cells. Our findings suggest that the CD133+ population from the BM shows better proliferation activity and a higher distribution of primitive progenitors than any other studied population.

The progression of colorectal cancer involves accumulation of various genetic and epigenetic events that dramatically change gene expression. The aim of this study was to investigate a possible new approach to the diagnosis of colorectal carcinoma patients, based on their gene expression profiles. Human 19K cDNA microarrays were used to analyze the gene expression profiles of 18 colorectal carcinoma patients. Transcriptome maps (TMs) were analyzed to detect chromosomal regions that could serve as potential diagnostic markers for colon cancer. A comparison of TMs showed chromosome regions with conserved changes of gene expression typical of colorectal cancer in general, and also patient-specific variable regions. We identified 195 genes with significantly altered expression in colon cancer. Functional analysis of the regulated genes distinguished three main categories: biological processes, cellular components, and molecular functions. We found that different patients had chromosome regions characterized by very similar changes of gene expression, probably linked to the most fundamental events in carcinogenesis. On the other hand, variable chromosome regions can be patient-specific. The variable regions may provide further information on the individual pathogenesis and prognosis of the patient. Comparison of TMs is proposed as a tool to facilitate diagnosis and treatment planning for individual patients.

Chromosomal aberrations and the nuclear topography of retinoblastoma tumour cells as well as lymphocytes of patients suffering from the familiar or sporadic form of retinoblastoma were studied. Fluorescence in situ hybridisation (FISH) on fresh, paraffin-embedded tumour tissues and on peripheral blood leukocytes was used for cytogenetic analysis. The cell cycle profile and induction of apoptosis was studied by flow cytometry and gene expression changes were detected by RT-PCR. Using the repeated FISH technique, the average distances between the nuclear membrane and the fluorescence gravity centre (FGC) of seven selected chromosomes were determined in the same tumour population and three other cell types. Chromosome order in positioning from the nuclear membrane was similar in all cell populations investigated. Our experimental studies were focused on specific genetic loci relevant for retinoblastoma tumour pathogenesis. We revealed a certain heterogeneity in the copy number of the Rb1, N-myc, and TP53 gene loci in tumour cells. In addition, in lymphocytes isolated from peripheral blood of the patients, a high degree of copy number heterogeneity was also detected. In 60% of analysed retinoblastomas we observed numerical aberration involving the centromeric region of chromosome 6. In these tumours, apoptotic bodies were found irrespective of clinical therapy. Chromosome instability seems to be a typical feature of primary retinoblastomas as well as of the human pseudodiploid cell line Y79. These cells, of a hereditary form of retinoblastoma (Y79), were irradiated by gamma rays and exposed to anti-tumour drugs such as etoposide, vincristine, and cisplatin. These treatments induced apoptosis, changes in the cell cycle profile, and specific modifications in the nuclear topography of selected loci. Treatment with a non-lethal concentration of hydroxyurea was shown to induce the loss of the amplified N-myc gene involved in the homogenously staining region (HSR) that was found to be associated with the nuclear membrane of retinoblastoma Y79 cells. We assume that not only cytological and cytogenetic parameters but also aberrant chromatin structures and their nuclear topography can be useful tools for optimal tumour marker specification.

The nuclear arrangement of the ABL, c-MYC, and RB1 genes was quantitatively investigated in human undifferentiated HL-60 cells and in a terminally differentiated population of human granulocytes. The ABL gene was expressed in both cell types, the c-MYC gene was active in HL-60 cells and down-regulated in granulocytes, and expression of the RB1 gene was undetectable in HL-60 cells but up-regulated in granulocytes. The distances of these genes to the nuclear center (membrane), to the center of the corresponding chromosome territory, and to the nearest centromere were determined. During granulopoesis, the majority of selected genetic structures were repositioned closer to the nuclear periphery. The nuclear reposition of the genes studied did not correlate with the changes of their expression. In both cell types, the c-MYC and RB1 genes were located at the periphery of the chromosome territories regardless of their activity. The centromeres of chromosomes 8 and 13 were always positioned more centrally within the chromosome territory than the studied genes. Close spatial proximity of the c-MYC and RB1 genes with centromeric heterochromatin, forming the chromocenters, correlated with gene activity, although the nearest chromocenter of the silenced RB1 gene did not involve centromeric heterochromatin of chromosome 13 where the given gene is localized. In addition, the role of heterochromatin in gene silencing was studied in retinoblastoma cells. In these differentiated tumor cells, one copy of the RB1 gene was positioned near the heterochromatic chromosome X, and reduced RB1 gene activity was observed. In the experiments presented here, we provide evidence that the regulation of gene activity during important cellular processes such as differentiation or carcinogenesis may be realized through heterochromatin-mediated gene silencing.

Fluorescence in situ hybridization (FISH) combined with high-resolution cytometry was used to determine the topographic characteristics of the centromeric heterochromatin (of the chromosomes 6, 8, 9, 17) and the tumor suppressor gene TP53 (which is located on chromosome 17) in cells of the human leukemia cell lines ML-1 and U937. Analysis was performed on cells that were either untreated or irradiated with gamma rays and incubated for different intervals after exposure. Compared to untreated cells, homologous centromeres and the TP53 genes were found closer to each other and also closer to the nuclear center 2 h after irradiation. The spatial relationship between genetic elements returned to that of the unirradiated controls during the next 2-3 h. Statistical evaluation of our experimental results shows that homologous centromeres and the homologous genes are positioned closer to each other 2 h after irradiation because they are localized closer to the center of the nucleus (probably due to more pronounced decondensation of the chromatin related to repair). This radial movement of genetic loci, however, is not connected with repair of DSBs by processes involving homologous recombination, because the angular distribution of homologous sequences remains random after irradiation.

Cardiovascular disease has become the leading cause of death in high income countries worldwide and the available treatment is not able to provide a complete recovery. Tissue engineering offers a possibility to construct autologous vein replacements for surgery. In this review we summarize approaches leading to artificial vascular graft construction. We discuss biomaterials currently in use, various drug delivery systems and the most appropriate cell cultures for vein engineering. Despite the progress in biomaterials and drug delivery systems, generating a suitable tissue microenvironment and selection of the appropriate cell population for graft seeding remains a major challenge. Here we focus on endothelial progenitor stem cells as the most suitable cell type for vascular graft construction. We discuss its sources, isolation techniques and differentiation procedures.

Background The surgical resection of lung disrupts glucose homeostasis and causes hyperglycemia, as in any other major surgery or critical illness. We performed a prospective study where we carefully lowered hyperglycemia by insulin administration during the surgery, and for the first time we monitored immediate insulin effects on lung physiology and gene transcription. Methods The levels of blood gases (pH, pCO2, pO2, HCO3-, HCO3- std, base excess, FiO2, and pO2/FiO2) were measured at the beginning of surgery, at the end of surgery, and two hours after. Samples of healthy lung tissue surrounding the tumour were obtained during the surgery, anonymized and sent for subsequent blinded qPCR analysis (mRNA levels of surfactant proteins A1, A2, B, C and D were measured). This study was done on a cohort of 64 patients who underwent lung resection. Patients were randomly divided, and half of them received insulin treatment during the surgery. Results We demonstrated for the first time that insulin administered intravenously during lung resection does not affect levels of blood gases. Furthermore, it does not induce immediate changes in the expression of surfactant proteins. Conclusion According to our observations, short insulin treatment applied intravenously during resection does not affect the quality of breathing.

Hematopoietic progenitors derived from human embryonic stem cells (hESCs) present both a potential cell source for cell-replacement therapies and an in vitro model for hematopoietic stem cell (HSC) development. Current protocols for the hematopoietic differentiation of hESCs suffer from low efficiency and functional defects in the derived HSCs. Epigenetic mechanisms of HSC development should be addressed to overcome these imperfections. The focus of this review is to summarize the knowledge on the epigenetic regulation of pluripotency and lineage-specific genes with the emphasis on the hematopoietic cell lineage. The potential utilization of this knowledge to improve the generation of HSCs for clinical application is also discussed.

The potential clinical applications of human induced pluripotent stem cells (hiPSCs) are limited by genetic and epigenetic variations among hiPSC lines and the question of their equivalency with human embryonic stem cells (hESCs). We used MethylScreen technology to determine the DNA methylation profile of pluripotency and differentiation markers in hiPSC lines from different source cell types compared to hESCs and hiPSC source cells. After derivation, hiPSC lines compromised a heterogeneous population characterized by variable levels of aberrant DNA methylation. These aberrations were induced during somatic cell reprogramming and their levels were associated with the type of hiPSC source cells. hiPSC population heterogeneity was reduced during prolonged culture and hiPSCs acquired an hESC-like methylation profile. In contrast, the expression of differentiation marker genes in hiPSC lines remained distinguishable from that in hESCs. Taken together, in vitro culture facilitates hiPSC acquisition of hESC epigenetic characteristics. However, differences remain between both pluripotent stem cell types, which must be considered before their use in downstream applications.

The demand for determining protein levels in a continuously decreasing amount of input cells is currently being developed by scientists and medical doctors. Another demanding area is the splitting of active and inactive (phosphorylated and unphosphorylated, respectively) forms of the protein being monitored, e.g., during different phases of the cell cycle, differentiation or carcinogenesis. The Western blot technique has been typically used for this purpose. The utilization of multi color flow cytometry allows for measurements of multiple proteins in parallel, regardless of the protein length. As the technique evolves, it is possible to obtain information on over 13 parameters per cell (Krutzik et al., 2004).

In this study, we assessed BCR-ABL kinase activity by measuring the protein levels of CrkL and its phosphorylated form (p-CrkL) in order to predict the clinical outcome of newly diagnosed chronic myeloid leukemia patients. CD34+ cells from these patients were collected before the start of imatinib therapy and treated in vitro with imatinib. The reduction of p-CrkL and CrkL protein levels was then measured by flow cytometry. The data were processed using three independent approaches: an assessment of a) IC50imatinib, b) p-CrkL/CrkL ratio, and c) p-CrkL ratio. The results were subsequently correlated with the clinical response of patients after 3 and 6 months of imatinib therapy. None of the three p-CrkL parameters measured in CD34+ cells was found to be predictive of clinical outcome.

The immune systems of multiple myeloma patients are suppressed by the disease itself, and this immunosuppression is further enhanced by standard therapies. The aim of our study was to evaluate the effects of initial chemotherapy and a peripheral blood mobilisation regimen on T-cell population diversity. Reverse transcription–polymerase chain reaction (RT–PCR) with a new set of primers, in combination with capillary electrophoresis, was established. The methodology was used to analyse the relative expression of 27 T-cell receptor beta variable gene families (BV families) in multiple myeloma patients undergoing peripheral blood stem cell harvest. We found that the overall BV family usage in these patients was restricted; the relative expression of 10 BV families was significantly depressed in patients compared to healthy donors. These findings demonstrate that the preparative regimen for autologous stem cell transplantation affects the T-cell population in terms of the restriction of its T-cell receptor diversity.

Objective Hematopoietic stem cells (enriched in fraction of CD34 + cells) have the ability to regenerate hematopoiesis in all of its lineages, and this potential is clinically used in transplanting bone marrow or peripheral blood stem cells. Our objective was to assemble a suitable method for evaluating gene expression in enriched populations of hematopoietic stem cells. We compared biologic properties of cells cultured ex vivo obtained using two different ways of immunomagnetic separation (positive selection of CD34 + cells and negative selection of Lin − cells) by means of a cDNA microarray technique. Methods CD34 + and Lin − cells were enriched from peripheral blood stem cell (PBSCs) grafts of patients with non-Hodgkin's lymphoma. Isolated cells were in the presence of cytokine PBSCs, Flt-3 ligand, interleukin-3, interleukin-6, and granulocyte colony-stimulating factor. At days 0, 4, 6, 8, 10, 12, and 14 cells were harvested and analyzed by cDNA microarrays. Total cell expansion, CD34 + , colony-forming unit for granulocyte-macrophage and megakaryocytes expansion, vitality, and phenotype of cells were also analyzed. Results cDNA microarray analysis of cultured hematopoietic cells proved equivalence of the two enrichment methods for PBSC samples and helped us characterize differentiating cells cultured ex vivo. Conclusion Our methodologic approach is helpful in characterizing cultured hematopoietic cells cultured ex vivo, but it is also suitable for more general purposes. Equivalence of CD34 + and Lin − selection methods from PBSC samples proved by cDNA microarray may have an implication for graft manipulation in an experimental setting of hematopoietic transplantation. Total cell expansion and colony formation and phenotype from CD34 + selected and from Lin − samples were comparable.

A complex study of the spatial arrangement of different genetic elements (genes, centromeres and chromosomal domains) in the cell nucleus is presented and the principles of this arrangement are discussed. We show that the radial location of genetic elements in the three-dimensional (3D) space between the center of the nucleus and the nuclear membrane is element specific and dependent on the position of the element on the chromosome. In contrast, mutual angular positioning of both homologous and heterologous genetic elements is, in the majority of cases, random. In several cases, tethering of heterologous genetic elements was observed. This close proximity of specific loci may be responsible for their mutual rearrangement and the development of cancer. Comparison of our results with transcriptome maps shows that the nuclear location of chromosomal domains with highly expressed genes is more central when compared with chromosomes with low expression. The higher-order chromatin structure is strikingly similar in various human cell types, which correlates with the fact that the profiles of gene expression are also similar.

To detect the frequencies of interchanges among 11 chromosomes in lymphocytes irradiated with gamma-rays and to find out whether these frequencies reflect the proximity of some of these chromosomes within the interphase nucleus.Exchange aberrations were detected in the first mitosis after irradiation of human lymphocytes with 3 and 5 Gy gamma-rays of 60Co. Two-colour repeated FISH with two differently chemically modified probes in each hybridization was applied. The microscope stage positions of each mitosis were recorded after the first hybridization and used for the automatic scanning of images after all successive experiments. Five images were obtained for each mitosis differing in visualized pairs of chromosomes. Comparing these images, exchanges among 10 chromosomes could be detected. Painting of the p arm of chromosome 21 with the painting probe for chromosome 22 also made it possible to detect exchanges of this chromosome with other chromosomes of the selected group.Frequencies of exchange aberrations induced in chromosomes of the selected group as well as interchanges between many pairs of chromosomes of this group were roughly proportional to the DNA content of chromosomes. Higher frequencies of interchanges than expected according to the model of linear proportionality were found between several chromosomes involved in translocations frequent in different subtypes of leukaemia.Frequencies of interchanges among 11 chromosomes of human lymphocytes induced by gamma-rays do not indicate as clearly as fast neutrons the non-random arrangement of chromosomes in the cell nucleus. The interaction of a large number of chromosomes in exchange aberrations suggests that the chromatin in the territory of one chromosome is accessible for several other chromosomes.

The structural organisation of chromatin in eukaryotes plays an important role in a number of biological processes. Our results provide a comprehensive insight into the nuclear topography of human peripheral blood granulocytes, mainly neutrophils. The nuclei of granulocytes are characterised by a segmented shape consisting of two to five lobes that are in many cases connected by a thin DNA-containing filament. The segregation of chromosomes into the nuclear lobes was studied using fluorescence in situ hybridisation (FISH). We were able to distinguish different topographic types of granulocytes on the basis of the pattern of segregation. Five topographic types were detected using dual-colour FISH in two-lobed nuclei. The segregation of four sets of genetic structures could be studied with the aid of repeated FISH and a large number of topographic types were observed. In all these experiments a non-random distribution of chromosomes into nuclear lobes was found. The painting of a single type of chromosome in two-lobed nuclei showed the prevalence of symmetric topographic types (on average in 65.5% of cases) with significant variations among individual chromosomes. The results of analysis of five topographic types (defined by two chromosomes in two-lobed nuclei) showed that the symmetric topographic types for both chromosomes are significantly more frequent than predicted. Repeated hybridisation experiments confirmed that the occurrence of certain patterns of chromosome segregation is much higher than that predicted from the combination of probabilities. The frequency of symmetric topographic types for chromosome domains was systematically higher than for genes located on these chromosomes. It appears that the prevalence of symmetric segregation patterns is more probable for large objects such as chromosome domains than for genes located on chromatin loops extending outwards from the surface of the domain defined by specific chromosome paints. This means that one chromosome domain may occur in different lobes of granulocytic nuclei. This observation is supported by the fact that both genes and centromeres were observed on filaments joining different lobes. For all chromosomes, the distances between the membrane and fluorescence gravity centre of the chromosome were measured and correlated with the segregation patterns. A higher percentage of symmetric topographic types was found in those chromosomes that were located closer to the nuclear membrane. Nuclear positioning of all genetic elements in granulocytic nuclei was studied in two-dimensional projection; however, the results were verified using three-dimensional analysis.

The c-myc gene plays an essential role in the regulation of the cell cycle and differentiation. Therefore, changes of the c-myc positioning during differentiation are of great interest. As a model system of cell differentiation, the HL-60 and U-937 human leukemic cell lines were used in our experiments. These cells can be induced to differentiation into granulocytes that represent one of the pathways of blood cell maturation. In this study, changes of the topographic characteristics of the c-myc gene (8q24), centromeric region of chromosome 8 and chromosome 8 domain during differentiation of HL-60 and U-937 cells were detected using fluorescence in-situ hybridisation (FISH). FISH techniques and fluorescence microscopy combined with image acquisition and analysis (high-resolution cytometry) were used in order to detect the topographic features of nuclear chromatin. Increased centre of nucleus-to-gene and gene-to-gene distances of c-myc genes, centromeric region of chromosome 8 and chromosome 8 domains were found early after the induction of granulocytic differentiation by dimethyl sulfoxide (DMSO) or retinoic acid (RA); the size of the chromosome 8 domains was rapidly reduced. In differentiated cells, c-myc is located at greater distances from the centromeric regions of chromosome 8. These results support the idea that relocation of the c-myc gene to the nuclear periphery and the condensation of the chromosome 8 domain might be associated with the c-myc gene expression due to common kinetics during granulocytic differentiation.

Abstract 1668 Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder of hemopoietic stem cells. The constitutively active tyrosine kinase BCR-ABL causes defects in the proliferation and differentiation of blood cells. CML is currently treated with tyrosine kinase specific inhibitors (TKIs), such as imatinib, nilotinib, and dasatinib. Transient, potent BCR-ABL inhibition with TKIs was demonstrated to commit CML cells to apoptosis irreversibly (Shah et al., Cancer Cell, 2008; Snead et al., Blood., 2009; Hiwase et al., Leukemia, 2009). This mechanism would explain the clinical efficacy of once-daily dasatinib treatment, despite the rapid clearance of the drug from the plasma. The restoration of BCR-ABL activity after TKI washout was demonstrated using phosphorylated CRKL (p-CRKL) protein as a surrogate marker. Our in vitro data challenges this model. We suggest that apoptosis observed in the BCR-ABL-positive cell line K562 and progenitor cells from chronic phase CML patients with transient dasatinib treatment is instead caused by residual kinase inhibition that persists as a consequence of intracellular drug retention. Relatively high intracellular concentrations of imatinib and dasatinib residues were measured in transiently treated K562 cells using a nanoscale liquid chromatography in-line-coupled with ion trap mass spectrometry (nanoLC-MS/MS system) (Table 1). Western blot analysis confirmed that TKI washout restored p-CRKL. However, STAT5 and ERK, two other important BCR-ABL downstream pathways, remained inhibited in K562 cells. These data suggest that p-CRKL, may not have the capacity to detect this residual TKI. Subsequent flow cytometric analysis confirmed that the residual kinase inhibition is not detectable by p-CRKL assay. To prove apoptosis is caused by residual TKI, we rescued apoptosis by performing additional washout steps in K562 cells treated with various concentrations of TKIs and measured Annexin-V expression (Figure 1). The apoptosis was completely reversible in all samples. We conclude that the reason for the equivalent efficacy of the once-daily and twice-daily TKI treatments is the most likely the intracellular retention of a low TKI concentration rather than the induction of irreversible apoptosis under a high-dose pulse treatment. Our data suggest that BCR-ABL is inhibited by residual TKI that cannot be detected by p-CRKL assay. The residual TKI was directly measured intracellularly, and it is possible to remove it by subsequent washout steps, which gradually restore apoptosis. These findings confirm that continuous target inhibition is required for the optimal efficacy of kinase inhibitors. Table 1. Intracellular concentrations of imatinib and dasatinib in K562 cells. Cells were incubated with the indicated TKI either continuously or for 0.3 hours followed by drug washout and further culture in TKI-free medium. Aliquots were lysed at defined time points and analyzed by nanoLC-MS/MS (n=3) Hours after initiation of exposure 0.3 2 6 12 24 2.5 ìM imatinib continuous (ìM) 76 ± 2 225 ± 3 32.5 ìM imatinib continuous (ìM) 4000 ± 200 1140 ± 60 32.5 ìM imatinib pulse (ìM) 3000 ± 100 66 ± 3 70.0 ± 0.2 60 ± 1 40 ± 2 1 nM dasatinib continuous (nM) 120 ± 20 200 ± 4 100 nM dasatinib continuous (nM) 4400 ± 100 3190 ± 80 100 nM dasatinib pulse (nM) 4600 ± 100 350 ± 20 250 ± 10 290 ± 10 257 ± 8 Figure 1. Effect of multiple TKI washouts on early apoptosis in K562 cells. Cells were treated in vitro with imatinib (A) or dasatinib (B) at a low-dose (i; 2.5 μM or 1 nM, respectively) or high-dose (ii; 32.5 μM or 100 nM, respectively). Cells were cultured under four conditions, as indicated: 1) continuous TKI; 2) TKI washout after 0.3 hours (1× washout); 3) TKI washout after 0.3 hours + second washout after 1 hour (2× washout) and 4) TKI washout after 0.3 hours + second washout after 1 hour + third washout after 2 hours (3× washout). Each TKI washout was performed three times with 10 ml of PBS. Cell aliquots were harvested after 0.3, 24, 48, and 72 hours, and Annexin-V was used to measure apoptosis by flow cytometry (n=3). Figure 1. Effect of multiple TKI washouts on early apoptosis in K562 cells. Cells were treated in vitro with imatinib (A) or dasatinib (B) at a low-dose (i; 2.5 μM or 1 nM, respectively) or high-dose (ii; 32.5 μM or 100 nM, respectively). Cells were cultured under four conditions, as indicated: 1) continuous TKI; 2) TKI washout after 0.3 hours (1× washout); 3) TKI washout after 0.3 hours + second washout after 1 hour (2× washout) and 4) TKI washout after 0.3 hours + second washout after 1 hour + third washout after 2 hours (3× washout). Each TKI washout was performed three times with 10 ml of PBS. Cell aliquots were harvested after 0.3, 24, 48, and 72 hours, and Annexin-V was used to measure apoptosis by flow cytometry (n=3). Disclosures: No relevant conflicts of interest to declare.

Abstract 4472 Chronic myeloid leukaemia (CML) is a clonal disorder of haematopoietic stem cells, characterized by constitutively active BCR-ABL kinase. It was previously shown, that transient inhibition of BCR-ABL by tyrosin kinase inhibitor (TKI) dasatinib induces apoptosis in CML cells (Shah 2008). Dasatinib mediated apoptosis is accompanied by increasing expression level of proapoptotic protein BIM and inhibition of its degradation in proteasome. Our aim is to find alterations in BCR-ABL downstream pathways and changes in BIM expression after pulse (wash-out after 20min) or continuous treatment with TKI dasatinib alone or in combination with proteasome inhibitor bortezomib in K562 cells. Higher mRNA levels of BIM were confirmed in both transiently and continuously treated (100nM dasatinib) K562 cells compared to low dose continuous (1nM dasatinib) treatment. Western blot analysis of BCR-ABL induced signalling pathways activity revealed, among others, sustained inhibition of MEK/ERK pathway even in the case of re-activation of BCR-ABL after drug wash-out. MEK/ERK inhibition leads to activation of proapoptotic BIM expression and inhibition of its degradation. We used bortezomib, a reversible inhibitor of proteasome, in order to test the block of BIM degradation in dasatinib treated cells. However, we have not found any difference in cell viability caused by adding of 30nM bortezomib to dasatinib treated cells neither in continuous or transient exposure. These findings suggest that equal increase of BIM in the case of pulse and continuous dasatinib treatment is caused by MEK/ERK inhibition in cells with restored BCR-ABL activity. This project is supported by grants from the Ministry of Education of Czech Republic NPVII (2B06052) and MSM-0021622430. The substance (dasatinib) for this project was supplied by BMS company. Disclosures: Mayer: BMS: Consultancy, Research Funding.

To understand how genes are distributed on chromosomes we bring new insights into gene positional clustering and its properties. We have made a large-scale analysis of three types of differentiation and we observed that genes that subsequently enter into different cell processes are positionally clustered on chromosomes. Genes from the clusters are transcribed subsequently with respect to time kinetics and also to position. This means that the genes related to a cellular process are clustered together, independent of the period of time during which they are active and important for the process. Our results also demonstrate not only that there are general regions of increased or decreased levels of gene expression, but also that, in fact, in some chromosome regions we can find clustering of genes related to specific cell processes. The results provided in this paper also support the theory of “transcription factories” and show that transcription of genes from the clusters is managed by softer epigenetic mechanisms.

Changes in nuclear architecture play an important role in the regulation of gene expression. The importance of epigenetic changes is observed during granulopoiesis, when changes in the nuclear architecture are considered a major factor that influences the downregulation of genes. We aimed to assess the influence of chromatin condensation on the regulation of gene expression during granulopoiesis. Based on a previously published microarray analysis, we chose loci with different levels of transcriptional activity during granulopoiesis. Fluorescent in situ hybridisation (FISH) and immunofluorescent labelling of RNA polymerase II were used to determine the relationship between the transcriptional activity of gene clusters and their localisation within areas with different levels of chromatin condensation. Although active loci were positioned outside of areas of condensed chromatin, downregulation of genes during granulopoiesis was not accompanied by a shift of the downregulated loci to condensed areas. Only the beta-globin cluster was subjected to chromatin condensation and localised to condensed areas. Our results indicate that granulopoiesis is accompanied by a non-random, tissue-specific pattern of chromatin condensation. Furthermore, we observed that the decrease in the quantity of RNA polymerase II correlates with the differentiation process and likely acts in synergy with chromatin condensation to downregulate total gene expression.

This study combines mRNA and protein analysis using cDNA and antibody microarray techniques, respectively. These create a novel, integrated perspective into cellular molecular profiles. The aims of this study were to establish a reliable way of integrating these two approaches in order to obtain complex molecular profiles of the cell and to find suitable methods to normalize the data obtained using these approaches.p align="justify"Antibody microarray and cDNA microarray techniques were used to study expression alterations in HL-60 cells that were differentiated into granulocytes using all-emtrans/emretinoic acid (ATRA). We selected this model to evaluate this combined profiling technique because the expression levels of most of the mRNA and protein species in these cells are not altered; therefore it is easier to track and define those species that are changed. The proteins whose levels were altered included c-myc, c-jun, Pyk2, FAK, PKC, TRF1, NF-kappaB and certain caspase types. These proteins are involved in apoptosis and hematopoietic differentiation pathways, and some have also been reported to have oncogenic potential. We compared the results obtained using the two methods, verified them by immunoblotting analysis, and devised normalization approaches./pp align="justify"This is one of the first demonstrations that a combination of antibody microarray and cDNA microarray techniques is required for complex molecular profiling of cells based on multiple parameters. This approach allows a more detailed molecular phenotype of the given sample to be obtained. The results obtained using a combination of the two profiling methods are consistent with those from previous studies that used more traditional methods./pmicroarray, cell profiling, protein expression, mRNA expression, HL-60.