Search

The serine/threonine kinase DYRK1A has been implicated in regulation of a variety of cellular processes associated with cancer progression, including cell cycle control, DNA damage repair, protection from apoptosis, cell differentiation, and metastasis. In addition, elevated-level DYRK1A activity has been associated with increased severity of symptoms in Down's syndrome. A selective inhibitor of DYRK1A could therefore be of therapeutic benefit. We have used fragment and structure-based discovery methods to identify a highly selective, well-tolerated, brain-penetrant DYRK1A inhibitor which showed in vivo activity in a tumor model. The inhibitor provides a useful tool compound for further exploration of the effect of DYRK1A inhibition in models of disease.

Combinatorial post-translational modifications (PTMs), which can serve as dynamic “molecular barcodes”, have been proposed to regulate distinct protein functions. However, studies of combinatorial PTMs on single protein molecules have been hindered by a lack of suitable analytical methods. Here, we describe erasable single-molecule blotting (eSiMBlot) for combinatorial PTM profiling. This assay is performed in a highly multiplexed manner and leverages the benefits of covalent protein immobilization, cyclic probing with different antibodies, and single molecule fluorescence imaging. Especially, facile and efficient covalent immobilization on a surface using Cu-free click chemistry permits multiple rounds (>10) of antibody erasing/reprobing without loss of antigenicity. Moreover, cumulative detection of coregistered multiple data sets for immobilized single-epitope molecules, such as HA peptide, can be used to increase the antibody detection rate. Finally, eSiMBlot enables direct visualization and quantitative profiling of combinatorial PTM codes at the single-molecule level, as we demonstrate by revealing the novel phospho-codes of ligand-induced epidermal growth factor receptor. Thus, eSiMBlot provides an unprecedentedly simple, rapid, and versatile platform for analyzing the vast number of combinatorial PTMs in biological pathways., An erasable single molecule blot (eSiMBlot) assay provides an unprecedentedly simple and versatile platform for analyzing the combinatorial post-translational modifications in biological pathways.

Serendipitously, mono-allyloxylated cucurbit[7]uril (AO1 CB[7]) was discovered to act as an unconventional amphiphile which self-assembles into light-responsive vesicles (AO1 CB[7]VC) in water. Although the mono-allyloxy group, directly tethered on the periphery of CB[7], is much shorter (C4) than the hydrophobic tails of conventional amphiphiles, it played an important role in vesicle formation. Light-activated transformation of the allyloxy group by conjugation with glutathione was exploited as a remote tool to disrupt the vesicle. The vesicle showed on-demand release of cargo upon irradiation by a laser, after they were internalized into cancer cells. This result demonstrated the potential of AO1 CB[7]VC as a new type of light-responsive intracellular delivery vehicle for the release of therapeutic cargo, within cells, on demand.

A supramolecular FRET pair based on the ultrahigh binding affinity between cyanine 3 conjugated cucurbit[7]uril (CB[7]-Cy3) and cyanine 5 conjugated adamantylamine (AdA-Cy5) was exploited as a new synthetic tool for imaging cellular processes in live cells. Confocal laser scanning microscopy revealed that CB[7]-Cy3 and AdA-Cy5 were intracellularly translocated and accumulated in lysosomes and mitochondria, respectively. CB[7]-Cy3 and AdA-Cy5 then formed a host-guest complex, reported by a FRET signal, as a result of the fusion of lysosomes and mitochondria. This observation not only indicated that CB[7] forms a stable complex with AdA in a live cell, but also suggested that this FRET pair can visualize dynamic organelle fusion processes, such as those involved in the degradation of mitochondria through autophagy (mitophagy), by virtue of its small size, chemical stability, and ease of use.

The host-guest complexes between commercially available fluorescence dyes and cucurbit[n]urils (CB[n], n = 6, 7 and 8) were exploited as multiple sensor elements to provide arrays for sensing biogenic amines using principal component analysis (PCA). Since the sensor elements responds differently to each amine, the array generates distinct patterns of fluorescence changes for each amine. We analyzed these results using PCA to allow precise discrimination of individual biogenic amines. This result demonstrated the great potential of these host-guest complexes as useful sensor elements for biogenic molecules, which may be useful to develop a diagnostic tool for diseases including cancers.

Mutations in leucine-rich repeat kinase 2 (LRRK2), such as G2019S, are associated with an increased risk of developing Parkinson’s disease. Surrogates for the LRRK2 kinase domain based on checkpoint kinase 1 (CHK1) mutants were designed, expressed in insect cells infected with baculovirus, purified, and crystallized. X-ray structures of the surrogates complexed with known LRRK2 inhibitors rationalized compound potency and selectivity. The CHK1 10-point mutant was preferred, following assessment of surrogate binding affinity with LRRK2 inhibitors. Fragment hit-derived arylpyrrolo[2,3-b]pyridine LRRK2 inhibitors underwent structure-guided optimization using this crystallographic surrogate. LRRK2-pSer935 HEK293 IC50 data for 22 were consistent with binding to Ala2016 in LRRK2 (equivalent to Ala147 in CHK1 10-point mutant structure). Compound 22 was shown to be potent, moderately selective, orally available, and brain-penetrant in wild-type mice, and confirmation of target engagement was demonstrated, with LR...

A new non-proteolytic method to harvest a cell-sheet was demonstrated using controllable host-guest interactions which can be dissociated by treating a strong guest on demand. Fibroblast cells (NIH3T3) were grown to confluence on a 1,6-diammoniumhexane conjugated hyaluronic acid (DAH-HA) polymer which was anchored to a cucurbit[7]uril (CB[7]) surface using the host-guest interaction between DAH and CB[7]. Treating with a strong guest allowed the cultured cells to be detached from the surface as a free standing sheet. This approach demonstrated the great potential of controllable host-guest chemistry as a novel tool for non-proteolytic harvesting of cell-sheets useful for regenerative therapy.

Chemical proteomics relies primarily on click-chemistry-based protein labeling and biotin-streptavidin enrichment, but these techniques have inherent limitations. Enrichment of intracellular proteins using a totally synthetic host-guest complex is described, overcoming the problem associated with the classical approach. We achieve this by affinity-based protein labeling with a target-specific probe molecule conjugated to a high-affinity guest (suberanilohydroxamic acid-ammonium-adamantane; SAHA-Ad) and then enriching the labeled species using a cucurbit[7]uril bead. This method shows high specificity for labeled molecules in a MDA-MB-231 breast cancer cell lysate. Moreover, this method shows promise for labeling proteins in live cells.

Cucurbit[6]uril (CB[6])-based polymer nanocapsules (CB[6]PNs) were used as a multimodal platform for cancer-targeted in vivo bioimaging. By taking advantage of the strong and robust host–guest interaction between CB[6] and spermidine (spmd) under in vivo conditions, the surface of the CB[6]PNs was non-covalently modified with various spmd-conjugated functionalities in a modular manner. The CB[6]PNs modified with imaging probes and targeting ligands showed tumor targeted PET and NIR imaging in mice. This proof of concept demonstrates the potential of non-covalently modified nanomaterials in real world in vivo systems.

Tb-based metal-organic framework nanoparticles (Tb-MOF NPs) with good colloidal stability and stable fluorescence properties in an aqueous solution were prepared by a simple mechanical grinding of Tb-MOF with a biocompatible polymer surfactant (F127). The characteristic fluorescence property of Tb-MOF NPs allowed us to use this nanomaterial as a cell imaging probe. Efficient cellular uptake of Tb-MOF NPs apparently via an energy-dependent endocytosis was observed by confocal laser scanning microscopy. By taking advantage of the porous nature of the Tb-MOF NPs an anticancer drug (doxorubicin) was successfully loaded and delivered to kill cancer cells to demonstrate their usage as a drug delivery vehicle. This simple grinding method afforded a nanosized, multifunctional biomaterial that was used for cell imaging and drug delivery, and it can be extended to other MOFs to widen their applications.

In this chapter, the synthesis, mechanism of formation, structural features, and functionalization of cucurbituril family members are introduced. Synthetic methodologies for the preparation of cucurbituril family members ranging from the initial discovery to recent developments are highlighted. A brief summary of the detailed investigation on the mechanism of cucurbituril formation, as well as key structural features of cucurbituril family members are showcased. Two major approaches to incorporate further functional groups on the skeleton of cucurbiturils are also introduced. One involves utilizing the building block approach, where the functional group is installed during the macrocyclization of cucurbiturils. The other applies direct functionalization of cucurbiturils, which installs the desired functional group through chemical and photochemical methods on the skeleton of cucurbituril macrocycles.

In this chapter, ultrastable synthetic binding pairs between cucurbit[7]uril and its guests are introduced as a supramolecular latching system. The unique features of the synthetic binding pairs including their small size with exceptionally high binding affinity, bio-orthogonality in binding, chemical tractability, scalable synthesis, and robust chemical structures are highlighted with a brief summary of their applications. Other interesting unique features of this binding pair system are also introduced such as delicate control of host–guest binding affinities by treatment with stronger guest molecules on-demand and negligible interferences of the binding properties from endogenous biomolecules, enabling accurate and precise analysis of bioimaging and proteomics.

We describe our work to establish structure- and fragment-based drug discovery to identify small molecules that inhibit the anti-apoptotic activity of the proteins Mcl-1 and Bcl-2. This identified hit series of compounds, some of which were subsequently optimized to clinical candidates in trials for treating various cancers. Many protein constructs were designed to identify protein with suitable properties for different biophysical assays and structural methods. Fragment screening using ligand-observed NMR experiments identified several series of compounds for each protein. The series were assessed for their potential for subsequent optimization using 1H and 15N heteronuclear single-quantum correlation NMR, surface plasmon resonance, and isothermal titration calorimetry measurements to characterize and validate binding. Crystal structures could not be determined for the early hits, so NMR methods were developed to provide models of compound binding to guide compound optimization. For Mcl-1, a benzodioxane/benzoxazine series was optimized to a Kd of 40 μM before a thienopyrimidine hit series was identified which subsequently led to the lead series from which the clinical candidate S 64315 (MIK 665) was identified. For Bcl-2, the fragment-derived series were difficult to progress, and a compound derived from a published tetrahydroquinone compound was taken forward as the hit from which the clinical candidate (S 55746) was obtained. For both the proteins, the work to establish a portfolio of assays gave confidence for identification of compounds suitable for optimization.

Here we report a recombinant protein (MS) obtained by genetic fusion of a mussel foot protein (Mfp3) motif into a silk spidroin (MaSp1). The MS not only self-assembled into a supramolecular fibre, as does the parent MaSp1, but also showed enhanced adhesiveness resulting from the DOPA-containing Mfp3 portion. The successful incorporation of the wet adhesiveness of Mfp3 into the well-structured assembly of MaSp1 may provide a new insight for the genetic design of underwater adhesive recombinant proteins by utilizing the structural features of a spidroin protein.

Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system., Although protein-ligand pairs are useful tools for bioimaging, they are susceptible to enzymatic degradation and interference from endogenous species. Here, the authors show that a synthetic and bioorthogonal cucurbit[7]uril-guest binding pair can be used to visualize proteins in cells, overcoming limitations of protein-based platforms.

Single-molecule surface-enhanced Raman spectroscopy (SERS) offers new opportunities for exploring the complex chemical and biological processes that cannot be easily probed using ensemble techniques. However, the ability to place the single molecule of interest reliably within a hot spot, to enable its analysis at the single-molecule level, remains challenging. Here we describe a novel strategy for locating and securing a single target analyte in a SERS hot spot at a plasmonic nanojunction. The "smart" hot spot was generated by employing a thiol-functionalized cucurbit[6]uril (CB[6]) as a molecular spacer linking a silver nanoparticle to a metal substrate. This approach also permits one to study molecules chemically reluctant to enter the hot spot, by conjugating them to a moiety, such as spermine, that has a high affinity for CB[6]. The hot spot can accommodate at most a few, and often only a single, analyte molecule. Bianalyte experiments revealed that one can reproducibly treat the SERS substrate such that 96% of the hot spots contain a single analyte molecule. Furthermore, by utilizing a series of molecules each consisting of spermine bound to perylene bisimide, a bright SERS molecule, with polymethylene linkers of varying lengths, the SERS intensity as a function of distance from the center of the hot spot could be measured. The SERS enhancement was found to decrease as 1 over the square of the distance from the center of the hot spot, and the single-molecule SERS cross sections were found to increase with AgNP diameter.

A permselective membrane with a non-covalently tailorable surface has been fabricated by deposition of a cucurbit[6]uril-based 2D polymer film onto a simple support membrane. Tuneable permselectivity of this membrane has been achieved through non-covalent surface modification using the remarkable host-guest chemistry of the incorporated cucurbit[6]uril units.

In this Commentary, we discuss cucurbit[7]uril-based ultrastable artificial binding pairs as a supramolecular latching system and how we envision this becoming important tools in proteomics. The limitations of current proteomic techniques are described with an emphasis on the lack of tools to answer questions about the complex and dynamic nature of the proteome. Our thoughts as to how artificial ultrastable binding pairs may be able to address these questions are given especially when they are combined with existing methods.

This tutorial review summarizes the continuining exploration of three prominent water-soluble hosts: cucurbiturils, pillar[n]arenes and deep-cavity cavitands. As we describe, these hosts are revealing how orchestrating the Hydrophobic Effect can lead to a broad range of properties and applications, from: nano-reactors, supramolecular polymers, stimuli-responsive biointerfaces, switches, and novel purification devices. We also describe how their study is also revealing more details about the properties of water and aqueous solutions.

A supramolecular hydrogel was formed by a simple mixing of solutions of nor-seco-cucurbit[10]uril (NS-CB[10]) and adamantylamine-terminated 4-armed polyethylene glycol (AdA-4-arm-PEG). In the formation of the hydrogel, NS-CB[10] acted as a noncovalent crosslinker to form a ternary complex with two AdA moieties. The dynamic and selective nature of the host-guest interaction between NS-CB[10] and AdA enabled the supramolecular hydrogel to rapidly recover its physical properties after it was damaged. In addition, the recovered hydrogel retained its physical properties with negligible differences from those of the pristine material, even after multiple self-healing cycles. The NS-CB[10]-based hydrogel with the self-healing property may be useful for various biological applications such as drug delivery, cell therapy and tissue engineering.

Libraries of nonpurified resorcinol amide derivatives were screened by surface plasmon resonance (SPR) to determine the binding dissociation constant (off-rate, kd) for compounds binding to the pyruvate dehydrogenase kinase (PDHK) enzyme. Parallel off-rate measurements against HSP90 and application of structure-based drug design enabled rapid hit to lead progression in a program to identify pan-isoform ATP-competitive inhibitors of PDHK. Lead optimization identified selective sub-100-nM inhibitors of the enzyme which significantly reduced phosphorylation of the E1α subunit in the PC3 cancer cell line in vitro.

Conventional immunoassays rely on antibodies that provide high affinity, specificity, and selectivity against a target analyte. However, the use of antibodies for the detection of small-sized, nonimmunogenic targets, such as pharmaceuticals and environmental contaminants, presents a number of challenges. Recent advances in protein engineering have led to the emergence of antibody mimetics that offer the high affinity and specificity associated with antibodies, but with reduced batch-to-batch variability, high stability, and in vitro selection to ensure rapid discovery of binders against a wide range of targets. In this work we explore the potential of Affimers, a recent example of antibody mimetics, as suitable bioreceptors for the detection of small organic target compounds, here methylene blue. Target immobilization for Affimer characterization was achieved using long-chained alkanethiol linkers coupled with oligoethylene glycol (LCAT–OEG). Using quartz crystal microbalance with dissipation monitoring (QCM-D), we determine the affinity constant, KD, of the methylene blue Affimer to be comparable to that of antibodies. Further, we demonstrate the high selectivity of Affimers for its target in complex matrixes, here a limnetic sample. Finally, we demonstrate an Affimer-based competition assay, illustrating the potential of Affimers as bioreceptors in immunoassays for the detection of small-sized, nonimmunogenic compounds.

Time scale control of molecular interactions is an essential part of biochemical systems, but very little is known about the structural factors governing the kinetics of molecular recognition. In drug design, the lifetime of drug-target complexes is a major determinant of pharmacological effects but the absence of structure-kinetic relationships precludes rational optimization of this property. Here we show that almost buried polar atoms--a common feature on protein binding sites--tend to form hydrogen bonds that are shielded from water. Formation and rupture of this type of hydrogen bonds involves an energetically penalized transition state because it occurs asynchronously with dehydration/rehydration. In consequence, water-shielded hydrogen bonds are exchanged at slower rates. Occurrence of this phenomenon can be anticipated from simple structural analysis, affording a novel tool to interpret and predict structure-kinetics relationships. The validity of this principle has been investigated on two pairs of Hsp90 inhibitors for which detailed thermodynamic and kinetic data has been experimentally determined. The agreement between macroscopic observables and molecular simulations confirms the role of water-shielded hydrogen bonds as kinetic traps and illustrates how our finding could be used as an aid in structure-based drug discovery.

Pin1 is an emerging oncology target strongly implicated in Ras and ErbB2-mediated tumourigenesis. Pin1 isomerizes bonds linking phospho-serine/threonine moieties to proline enabling it to play a key role in proline-directed kinase signalling. Here we report a novel series of Pin1 inhibitors based on a phenyl imidazole acid core that contains sub-μM inhibitors. Compounds have been identified that block prostate cancer cell growth under conditions where Pin1 is essential.

The anti-apoptotic function of the 70 kDa family of heat shock proteins and their role in cancer is well documented. Dual targeting of Hsc70 and Hsp70 with siRNA induces proteasome-dependent degradation of Hsp90 client proteins and extensive tumor specific apoptosis as well as the potentiation of tumor cell apoptosis following pharmacological Hsp90 inhibition.We have previously described the discovery and synthesis of novel adenosine-derived inhibitors of the 70 kDa family of heat shock proteins; the first inhibitors described to target the ATPase binding domain. The in vitro activity of VER-155008 was evaluated in HCT116, HT29, BT474 and MDA-MB-468 carcinoma cell lines. Cell proliferation, cell apoptosis and caspase 3/7 activity was determined for VER-155008 in the absence or presence of small molecule Hsp90 inhibitors.VER-155008 inhibited the proliferation of human breast and colon cancer cell lines with GI(50)s in the range 5.3-14.4 microM, and induced Hsp90 client protein degradation in both HCT116 and BT474 cells. As a single agent, VER-155008 induced caspase-3/7 dependent apoptosis in BT474 cells and non-caspase dependent cell death in HCT116 cells. VER-155008 potentiated the apoptotic potential of a small molecule Hsp90 inhibitor in HCT116 but not HT29 or MDA-MB-468 cells. In vivo, VER-155008 demonstrated rapid metabolism and clearance, along with tumor levels below the predicted pharmacologically active level.These data suggest that small molecule inhibitors of Hsc70/Hsp70 phenotypically mimic the cellular mode of action of a small molecule Hsp90 inhibitor and can potentiate the apoptotic potential of a small molecule Hsp90 inhibitor in certain cell lines. The factors determining whether or not cells apoptose in response to Hsp90 inhibition or the combination of Hsp90 plus Hsc70/Hsp70 inhibition remain to be determined.

Virtual screening against a pCDK2/cyclin A crystal structure led to the identification of a potent and novel CDK2 inhibitor, which exhibited an unusual mode of interaction with the kinase binding motif. With the aid of X-ray crystallography and modelling, a medicinal chemistry strategy was implemented to probe the interactions seen in the crystal structure and to establish SAR. A fragment-based approach was also considered but a different, more conventional, binding mode was observed. Compound selectivity against GSK-3beta was improved using a rational design strategy, with crystallographic verification of the CDK2 binding mode.

Amikacin is the 4,6-linked aminoglycoside modified at position N1 of the 2-deoxystreptamine ring (ring II) by the L-haba group. In the present study, the crystal structure of a complex between oligonucleotide containing the bacterial ribosomal A site and amikacin has been solved at 2.7 A resolution. Amikacin specifically binds to the A site in practically the same way as its parent compound kanamycin. In addition, the L-haba group interacts with the upper side of the A site through two direct contacts, O2*...H-N4(C1496) and N4*-H...O6(G1497). The present crystal structure shows how the introduction of the L-haba group on ring II of aminoglycoside is an effective mutation for obtaining a higher affinity to the bacterial A site.

The X-ray crystal structures for the complexes of three designer antibiotics, compounds 1, 2, and 3, bound to two models for the ribosomal aminoacyl-tRNA site (A site) at 2.5-3.0 Angstroms resolution and that of neamine at 2.8 Angstroms resolution are described. Furthermore, the complex of antibiotic 1 bound to the A site in the entire 30S ribosomal subunit of Thermus thermophilus is reported at 3.8 Angstroms resolution. Molecular dynamics simulations revealed that the designer compounds provide additional stability to bases A1492 and A1493 in their extrahelical forms. Snapshots from the simulations were used for free energy calculations, which revealed that van der Waals and hydrophobic effects were the driving forces behind the binding of designer antibiotic 3 when compared to the parental neamine.

The dissociation rate constant kd (off-rate) is the component of ligand–protein binding with the most significant potential to enhance compound potency. Here we provide theoretical and empirical data to show that this parameter can be determined accurately from unpurified reaction products containing designed test compounds. This screening protocol is amenable to parallel chemistry, provides efficiencies of time and materials, and complements existing methodologies for the hit-to-lead phase in fragment-based drug discovery.

The coat protein of bacteriophage MS2 is known to bind specifically to an RNA hairpin formed within the MS2 genome. Structurally this hairpin is built up by an RNA double helix interrupted by one unpaired nucleotide and closed by a four-nucleotide loop. We have performed crystallographic studies of complexes between MS2 coat protein capsids and four RNA hairpin variants in order to evaluate the minimal requirements for tight binding to the coat protein and to obtain more information about the three-dimensional structure of these hairpins. An RNA fragment including the four loop nucleotides and a two-base-pair stem but without the unpaired nucleotide is sufficient for binding to the coat protein shell under the conditions used in this study. In contrast, an RNA fragment containing a stem with the unpaired nucleotide but missing the loop nucleotides does not bind to the protein shell.

The secondary structure of an RNA aptamer, which has a high affinity for the Escherichia coli MetJ repressor protein, has been mapped using ribonucleases and with diethyl pyrocarbonate. The RNA ligand is composed of a stem-loop with a highly structured internal loop. Interference modification showed that the bases within the internal loop, and those directly adjacent to it, are important in the binding of the RNA ligand to MetJ. Most of the terminal stem-loop could be removed with little effect on the binding. Ethylation interference suggests that none of the phosphate groups are absolutely essential for tight binding. The data suggest that the MetJ binding site on the aptamer is distinct from that of the natural DNA target, the 8-base pair Met box.

A method for the preparation of an oligodeoxynucleotide, 20 bases in length, containing centrally located thio analogues of (6-4) pyrimidine-pyrimidinone thymine photo-dimers is reported. The approach is based on the selective irradiation, at 350 nm, of a Tp4ST (4ST=4-thiothymidine) step within a 20-mer having the sequence: d(ACTCGGACCT(4ST)CGCTGTGAT). Conversion of the S5-(6-4)/S5-thietane pyrimidine-pyrimidinone, initially formed, to its S5-Dewar isomer is by a subsequent irradiation at 300 nm. Both of the photo-dimer-containing oligonucleotides were purified by HPLC (ion exchange and reverse phase) and characterised by base composition analysis. The S5-(6-4)/S5-thietane pyrimidine-pyrimidinone containing 20-mer has a characteristic UV absorbance at 320 nm and exhibits strong fluorescence when excited at this wavelength. As expected, conversion to the S5-Dewar isomer abolished both the 320 nm absorbance and the fluorescence emission. The lengths of the oligonucleotides produced allowed the formation of stable double-stranded DNA, by hybridisation to a complementary sequence. Examination of these duplexes by circular dichroism spectroscopy showed that they formed B-DNA, with little changes to their gross structure as compared to the parent duplex. However, local structural perturbations in the region of the photo-dimer cannot be excluded. The S5-(6-4)/S5-thietane photoproduct lowered the tmby 10.5 deg. C and the Dewar isomer by 12 deg. C. The degree of curvature induced in the DNA sequence by the introduction of the photo-dimers was assessed by analysing the migration of modified and unmodified multimer ladders on polyacrylamide gels. Both photoproducts induced considerable bending into the DNA. A comparison with a six-base-pair T tract, a bending standard that has a known bend angle of 19°, gave values of around 47° for the S5-(6-4)/S5-thietane product and about 28° for the S5-Dewar isomer.

We present the results of in vitro binding studies aimed at defining the key recognition elements on the MS2 RNA translational operator (TR) essential for complex formation with coat protein. We have used chemically synthesized operators carrying modified functional groups at defined nucleotide positions, which are essential for recognition by the phage coat protein. These experiments have been complemented with modification-binding interference assays. The results confirm that the complexes which form between TR and RNA-free phage capsids, the X-ray structure of which has recently been reported at 3.0 A, are identical to those which form in solution between TR and a single coat protein dimer. There are also effects on operator affinity which cannot be explained simply by the alteration of direct RNA-protein contacts and may reflect changes in the conformational equilibrium of the unliganded operator. The results also provide support for the approach of using modified oligoribonucleotides to investigate the details of RNA-ligand interactions.

The fluorescent nucleoside 2-pyrimidinone-1-β-d-riboside (4HC) has been incorporated into oligoribonucleotides using standard cyanoethyl phosphoramidite methods. This base provides a useful probe for the exocyclic amino function in cytidine. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUGUCUCGAGC as the substrate and GGCUCGA[4HC]UGAUGAGGCGC as a modified ribozyme resulted in a cleavage rate 17.5-fold slower than the unmodified analogue. The strand GGCUCGACUGA[4HC]GAGGCGC represents an oligoribonucleotide in which a fluorescent base is introduced into a site non-essential for ribozyme function but is centrally located in the ribozyme's core of conserved nucleotides, thus providing a possible physical probe for ribozyme cleavage.

A reliable preparation of S 4 -cyanoethyl-4-thiouridine and its incorporation into oligoribonucleotides is reported. Deprotection of oligoribonucleotides with DBU in acetonitrile followed by methanolic ammonia allows the use of standard N-benzoyl and N-isobutyryl protected phosphoramidites. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUG[ 4S U]CUCGAGC as the modified substrate and GGCUCGACUGAUGAGGCGC as the ribozyme resulted in a halving of the cleavage rate when compared to the unmodified substrate, which is consistent with the proposal that the A 9 -U 17 base pair plays a key role in the active structure.

78 kDa glucose-regulated protein (Grp78) is a heat shock protein (HSP) involved in protein folding that plays a role in cancer cell proliferation. Binding of adenosine-derived inhibitors to Grp78 was characterized by surface plasmon resonance and isothermal titration calorimetry. The most potent compounds were 13 (VER-155008) with K(D) = 80 nM and 14 with K(D) = 60 nM. X-ray crystal structures of Grp78 bound to ATP, ADPnP, and adenosine derivative 10 revealed differences in the binding site between Grp78 and homologous proteins.

A reliable preparation of S 4 -cyanoethyl-4-thiouridine and its incorporation into oligoribonucleotides is reported. Deprotection of oligoribonucleotides with DBU in acetonitrile followed by methanolic ammonia allows the use of standard N-benzoyl and N-isobutyryl protected phosphoramidites. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUG[ 4S U]CUCGAGC as the modified substrate and GGCUCGACUGAUGAGGCGC as the ribozyme resulted in a halving of the cleavage rate when compared to the unmodified substrate, which is consistent with the proposal that the A 9 -U 17 base pair plays a key role in the active structure.

The fluorescent nucleoside 2-pyrimidinone-1-β-d-riboside (4HC) has been incorporated into oligoribonucleotides using standard cyanoethyl phosphoramidite methods. This base provides a useful probe for the exocyclic amino function in cytidine. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUGUCUCGAGC as the substrate and GGCUCGA[4HC]UGAUGAGGCGC as a modified ribozyme resulted in a cleavage rate 17.5-fold slower than the unmodified analogue. The strand GGCUCGACUGA[4HC]GAGGCGC represents an oligoribonucleotide in which a fluorescent base is introduced into a site non-essential for ribozyme function but is centrally located in the ribozyme's core of conserved nucleotides, thus providing a possible physical probe for ribozyme cleavage.

The design and synthesis of novel adenosine-derived inhibitors of HSP70, guided by modeling and X-ray crystallographic structures of these compounds in complex with HSC70/BAG-1, is described. Examples exhibited submicromolar affinity for HSP70, were highly selective over HSP90, and some displayed potency against HCT116 cells. Exposure of compound 12 to HCT116 cells caused significant reduction in cellular levels of Raf-1 and Her2 at concentrations similar to that which caused cell growth arrest.

The crystal structures of six complexes between aminoglycoside antibiotics (neamine, gentamicin C1A, kanamycin A, ribostamycin, lividomycin A and neomycin B) and oligonucleotides containing the decoding A site of bacterial ribosomes are reported at resolutions between 2.2 and 3.0 Å. Although the number of contacts between the RNA and the aminoglycosides varies between 20 and 31, up to eight direct hydrogen bonds between rings I and II of the neamine moiety are conserved in the observed complexes. The puckered sugar ring I is inserted into the A site helix by stacking against G1491 and forms a pseudo base pair with two H-bonds to the Watson–Crick sites of the universally conserved A1408. This central interaction helps to maintain A1492 and A1493 in a bulged-out conformation. All these structures of the minimal A site RNA complexed to various aminoglycosides display crystal packings with intermolecular contacts between the bulging A1492 and A1493 and the shallow/minor groove of Watson–Crick pairs in a neighbouring helix. In one crystal, one empty A site is observed. In two crystals, two aminoglycosides are bound to the same A site with one bound specifically and the other bound in various ways in the deep/major groove at the edge of the A sites.

Objective: To use our knowledge of the three-dimensional structure and self-assembly mechanism of RNA bacteriophage capsids to develop novel virus-like particles (VLPs) for drug delivery and epitope presentation. Methods: Site-directed mutagenesis of a recombinant MS2 coat protein expression construct has been used to generate translational fusions encompassing short epitope sequences. These chimeric proteins still self-assemble in vivo into T = 3 shells with the foreign epitope in an accessible location. Covalent conjugation has also been used to generate RNA stem-loops attached to the toxin, ricin A chain, or to nucleotide-based drugs, that are still capable of stimulating self-assembly of the capsid in vitro. These packaged drugs can then be directed to specific cells in culture by further covalent decoration of the capsids with targeting molecules. Results: Chimeric VLPs are strongly immunogenic when carrying either B or T cell epitopes, the latter generating cytokine profiles consistent with memory responses. Immune responses to the underlying phage epitopes appear to be proportional to the area of the phage surface accessible. Phage shells effectively protect nucleic acid-based drugs and, for the toxin construct, make cell-specific delivery systems with LD50 values in culture sub-nanomolar. Conclusion: VLP technology has potential for therapeutic and prophylactic intervention in disease.

Publisher Summary This chapter discusses the methods used for conventional and time-resolved crystallographic analyses of the hammerhead ribozyme. In the case of the hammerhead ribozyme sequence, the catalytic turnover rate in the crystal is approximately 0.4 molecule/minute when crystals grown at pH 5–6 are activated with the addition of a mother liquor solution buffered at pH 8.5 and containing 50–100 mM divalent metal ion. The time it takes for a fairly complex substrate to diffuse into a crystal of isocitrate dehydrogenase measuring 0.5 mm in each dimension and to saturate the enzyme's active sites is approximately 10 seconds when measured directly by video absorbance spectroscopy. A hammerhead ribozyme cleavage reaction in the crystal can be initiated by removing a crystal from the drop in which it has grown, using a small rayon loop mounted on a wire. The crystal is then immediately immersed into an artificial mother liquor solution containing divalent metal ions at a higher pH. The relatively slow reaction rate of the hammerhead ribozyme allows to use this very simple method of freeze trapping. Depending on the turnover rate of other ribozymes whose reactions might be examined in the crystal, it may be necessary to employ a flow cell to deliver a carefully timed pulse of substrate or divalent metal ion cofactor or even to use a photochemically activatable “caged” substrate precursor to initiate the reaction rapidly throughout the crystal lattice.

Theoretical mechanisms of proton translocation by the vacuolar H(+)-ATPase require that a transmembrane acidic residue of the multicopy 16-kDa proteolipid subunit be exposed at the exterior surface of the membrane sector of the enzyme, contacting the lipid phase. However, structural support for this theoretical mechanism is lacking. To address this, we have used cysteine mutagenesis to produce a molecular model of the 16-kDa proteolipid complex. Transmembrane helical contacts were determined using oxidative cysteine cross-linking, and accessibility of cysteines to the lipid phase was determined by their reactivity to the lipid-soluble probe N-(1-pyrenyl)maleimide. A single model for organization of the four helices of each monomeric proteolipid was the best fit to the experimental data, with helix 1 lining a central pore and helix 2 and helix 3 immediately external to it and forming the principal intermolecular contacts. Helix 4, containing the crucial acidic residue, is peripheral to the complex. The model is consistent not only with theoretical proton transport mechanisms, but has structural similarity to the dodecameric ring complex formed by the related 8-kDa proteolipid of the F(1)F(0)-ATPase. This suggests some commonality between the proton translocating mechanisms of the vacuolar and F(1)F(0)-ATPases.

The MS2 RNA operator capsid offers an unparalleled opportunity to study sequence-specific protein-protein and RNA-protein interactions in molecular detail. RNA molecules encompassing the minimal translational operator recognition elements can be soaked into crystals of RNA-free coat protein shells, allowing the RNA to access the interior of the capsids and make contact with the operator binding sites. Correct interpretation of these structural studies depends critically on functional analysis in solution to confirm that the interactions seen in the crystal are not an artefact of the unusual approach used to generate the RNA-protein complexes. Here we present a series of in vivo and in vitro functional assays, using coat proteins carrying single amino acid substitutions at residues which either interact with the operator RNA or are involved in stabilizing the conformation of the FG loop, the site of the major quasi-equivalent conformational change. Variant operator RNAs have been assayed for coat protein affinity in vitro. The results reveal the robustness of the operator-coat protein interaction and the requirement for both halves of a protein dimer to contact RNA in order to achieve tight binding. They also suggest that there may be a direct link between the conformation of the FG loop and RNA binding.

In MS2 assembly of phage particles results from an interaction between a coat protein dimer and a stem-loop of the RNA genome (the operator hairpin). Amino acid residues Thr45, which is universally conserved among the small RNA phages, and Thr59 are part of the specific RNA binding pocket and interact directly with the RNA; the former through a hydrogen bond, the latter through hydrophobic contacts. The crystal structures of MS2 protein capsids formed by mutants Thr45Ala and Thr59Ser, both with and without the 19 nt wild-type operator hairpin bound, are reported here. The RNA hairpin binds to these mutants in a similar way to its binding to wild-type protein. In a companion paper both mutants are shown to be deficient in RNA binding in an in vivo assay, but in vitro the equilibrium dissociation constant is significantly higher than wild-type for the Thr45Ala mutant. The change in binding affinity of the Thr45Ala mutant is probably a direct consequence of removal of direct hydrogen bonds between the protein and the RNA. The properties of the Thr59Ser mutant are more difficult to explain, but are consistent with a loss of non-polar contact.

Crystal structures of two complexes between recombinant MS2 capsids and RNA operator fragments have been determined at 2.7 A resolution. The coat protein of the RNA bacteriophage MS2 is bifunctional; it forms the icosahedral virus shell to protect the viral nucleic acid and it acts as a translational repressor by binding with high specificity to a unique site on the RNA, a single stem-loop structure, containing the initiation codon of the gene for the viral replicase. In order to determine the structure of these protein-RNA complexes, we have used chemically synthesized variants of the stem-loop fragment and soaked them into crystals of recombinant capsids. The RNA stem-loop, as bound to the protein, forms a crescent-like structure and interacts with the surface of the beta-sheet of a coat protein dimer. It makes protein contacts with seven phosphate groups on the 5' side of the stem-loop, with a pyrimidine base at position -5, which stacks onto a tyrosine, and with two exposed adenine bases, one in the loop and one at a bulge in the stem. Replacement of the wild-type uridine with a cytosine at position -5 increases the affinity of the RNA to the dimer significantly. The complex with RNA stem-loop having cytosine at this position differs from that of the wild-type complex mainly by having one extra intramolecular RNA interaction and one extra water-mediated hydrogen bond.

The crystal structure of an unmodified hammerhead RNA in the absence of divalent metal ions has been solved, and it was shown that this ribozyme can cleave itself in the crystal when divalent metal ions are added. This biologically active RNA fold is the same as that found previously for two modified hammerhead ribozymes. Addition of divalent cations at low pH makes it possible to capture the uncleaved RNA in metal-bound form. A conformational intermediate, having an additional Mg(II) bound to the cleavage-site phosphate, was captured by freeze-trapping the RNA at an active pH prior to cleavage. The most significant conformational changes were limited to the active site of the ribozyme, and the changed conformation requires only small additional movements to reach a proposed transition-state.

A screening of a range of common laboratory antibiotics for inhibition of the hammerhead ribozyme has shown that in addition to certain aminoglycosides (most notably neomycin B) the tetracyclines are also effective inhibitors, with chlorotetracycline being more effective than tetracycline. Inhibition by chlorotetracycline is not as strong as that by neomycin B but is more complicated, with at least two binding sites apparent. As with hammerhead inhibition by neomycin B, chlorotetracycline inhibition can be overcome by raising the concentration of the Mg2+ ion cofactor. We find that around six Mg2+ ions will displace neomycin B, compared with twelve for chlorotetracycline. Inhibition observed in the presence of mixtures of neomycin B and chlorotetracycline is consistent with separate binding sites on the hammerhead for these two classses of antibiotic. Under certain conditions of the mixing order and low concentration of chlorotetracycline, enhancement of single-turnover hammerhead cleavage by up to 20% is observed, with higher concentrations of antibiotic being inhibitory. We have also found that the presence of 2.5% (v/v) DMSO causes a 30% enhancement of the single-turnover cleavage. These results thus extend the range of known inhibitors of hammerhead cleavage, and also demonstrate how the cleavage can be accelerated.

We report details of the synthesis and characterization of oligoribonucleotides containing 4-thiouridine or 2-pyrimidinone ribonucleoside (4HC). We have used these probes to examine the roles of the conserved pyrimidines in the central core of the hammerhead ribozyme. The effects on catalysis of singly-substituted hammerhead ribozyme and substrate strands were quantified in multiple-turnover reactions. Various effects were observed on kcat. and Km, with up to a 7-fold decrease and a 3-fold increase respectively. For substitutions with 4HC at positions 3 or 17, catalytic activity in single turnover reactions can be increased up to 8-fold equivalent to 40% of wild-type activity, by increasing the concentration of the Mg2+ cofactor, implying that these substitutions had a deleterious effect on Mg2+ binding. Calculations of the change in the apparent free energy of binding for variants at positions 3, 4 or 17 are each consistent with deletion of a single hydrogen-bond to an uncharged group in the ribozyme. The cytidine 5′ to the scissile phosphate had not previously been thought to play a direct role in catalysis, however, removal of the exocyclic amino group decreased kcat. 4-fold. Recently, the crystal structures of a hammerhead ribozyme bound to either a non-cleavable 2′-deoxy substrate strand or a ribo-substrate strand have been reported. The kinetic properties of the variants described here are consistent with several key interactions seen in the crystals, in particular they provide experimental support for the assignment of the proposed catalytically active magnesium ion-binding site.