Search

Abstract Background To study the risk factors associated with misplacement of freehand pedicle screws through a posterior approach for degenerative scoliosis. Methods A total of 204 patients who underwent posterior pedicle screw-rod system surgery for degenerative scoliosis in our hospital from December 2020 to December 2023 were retrospectively analyzed. Patient demographics, radiographic accuracy, and surgery-related information were recorded. Results A total of 204 patients were included. A total of 2496 screws were placed. 2373 (95.07%) were in good position. Misplacement screws were 123 (4.93%). None of the patients had postoperative spinal nerve symptoms due to screw malposition. The misplacement rate of thoracic (T10-T12) pedicle screws was 11.11% (60/540). Misplacement of pedicle screws in the lumbar spine (L1-L5) was 3.22% (63/1956). Age, gender, surgeon, and operation time had no significant effect on misplacement of pedicle screws (P>0.05). Body mass index, Hu value, number of screw segments, Cobb angle, vertebral rotation, and spinal canal morphology had some correlation with pedicle screw misplacement. Among them, BMI, Hu value, number of screw segments, Cobb angle, and vertebral rotation grade were independent risk factors for PS misplacement (P

Abstract Background Patient navigators, whose value has become increasingly apparent, still face significant challenges, including a lack of support, funding, and recognition. These challenges have been exacerbated in the wake of COVID‐19 pandemic. Methods This study explored the potential use of artificial intelligence (AI) in patient navigation. Data were collected through structured surveys and individual interviews with patient navigators from a variety of institutions and professional backgrounds. The data were analyzed to understand the current state of patient navigation, identify existing gaps, and suggest best practices for the future. Results The findings showed that patient navigators (a) have diverse backgrounds and responsibilities, (b) lack technology support for their work, (c) are at risk for burnout, with the extent varying based on the level of technical support received, and (d) report significant overlap between current barriers and those that could potentially be addressed with AI‐driven technologies. Conclusion A novel intervention, that is enabled by AI and other technologies and tailored to individual needs, has the potential to reduce burnout, increase capacity, and help ensure the sustainability of patient navigation and other areas of healthcare. By addressing the specific needs of individual patients, this type of intervention could help improve the overall effectiveness of patient navigation and support the long‐term sustainability of the role.

Abstract Background The coexistence of cardiovascular disease and chronic kidney disease, termed chronic cardiovascular-kidney disorder (CCV-KD), is increasingly prevalent. However, limited studies have assessed the association between cardiovascular health (CVH), assessed by the American Heart Association’s Life’s Essential 8 (LE8), and CCV-KD. Methods We conducted a prospective cohort study using data from UK Biobank. Participants without cardiovascular disease and chronic kidney disease at baseline and having complete data on metrics of LE8 were included (N = 125,986). LE8 included eight metrics, and the aggregate score was categorized as low (

Abstract CT and MR tools are commonly used to diagnose lumbar fractures (LF). However, numerous limitations have been found in practice. The aims of this study were to innovate and develop a spinal disease-specific neural network and to evaluate whether synthetic MRI of the LF affected clinical diagnosis and treatment strategies. A total of 675 LF patients who met the inclusion and exclusion criteria were included in the study. For each participant, two mid-sagittal CT and T2-weighted MR images were selected; 1350 pairs of LF images were also included. A new Self-pix based on Pix2pix and Self-Attention was constructed. A total of 1350 pairs of CT and MR images, which were randomly divided into a training group (1147 pairs) and a test group (203 pairs), were fed into Pix2pix and Self-pix. The quantitative evaluation included PSNR and SSIM (PSNR1 and SSIM1: real MR images and Pix2pix-generated MR images; PSNR2 and SSIM2: real MR images and Self-pix-generated MR images). The qualitative evaluation, including accurate diagnosis of acute fractures and accurate selection of treatment strategies based on Self-pix-generated MRI, was performed by three spine surgeons. In the LF group, PSNR1 and PSNR2 were 10.884 and 11.021 (p

Converting carbohydrates into 5-hydroxymethylfurfural (5-HMF) is an attractive and promising route for value-added utilization of agricultural and forestry biomass resource. As an important platform compound, 5-HMF possesses high active furan structure with hydroxymethyl and aldehyde group for production of various bio-chemicals and materials, meanwhile, which suffer from low stability and poor yield during the industrial biorefinery process. Hence, selective production of 5-HMF with high-yield and low-cost has attracted extensive attention from scientific and industrial researchers. This review sorted and described the latest advanced research on solvent and catalyst system, as well as energy field effect for production of 5-HMF with different feedstock in detail, emphatically discussing the solvent effect and its synergistic effect with other aspects. Besides, the future prospects and challenges for production of 5-HMF from carbohydrates were also presented, which provide a profound insight into industrial 5-HMF process with economic and environmental feature.

Abstract Electrocatalytic H2 production from seawater, recognized as a promising technology utilizing offshore renewables, faces challenges from chloride-induced reactions and corrosion. Here, We introduce a catalytic surface where OH– dominates over Cl– in adsorption and activation, which is crucial for O2 production. Our NiFe-based anode, enhanced by nearby Cr sites, achieves low overpotentials and selective alkaline seawater oxidation. It outperforms the RuO2 counterpart in terms of lifespan in scaled-up stacks, maintaining stability for over 2500 h in three-electrode tests. Ex situ/in situ analyses reveal that Cr(III) sites enrich OH–, while Cl– is repelled by Cr(VI) sites, both of which are well-dispersed and close to NiFe, enhancing charge transfer and overall electrode performance. Such multiple effects fundamentally boost the activity, selectively, and chemical stability of the NiFe-based electrode. This development marks a significant advance in creating durable, noble-metal-free electrodes for alkaline seawater electrolysis, highlighting the importance of well-distributed catalytic sites.

Regulating macrophage phenotypes to reconcile the conflict between bacterial suppression and tissue regeneration is ideal for treating infectious skin wounds. Here, an injectable immunoregulatory hydrogel (SrmE20) that sequentially drives macrophage phenotypic polarization (M0 to M1, then to M2) was constructed by integrating anti-inflammatory components and proinflammatory solvents. In vitro experiments demonstrated that the proinflammatory solvent ethanol stabilized the hydrogel structure, maintained the phenolic hydroxyl group activity, and achieved macrophages' proinflammatory transition (M0 to M1) to enhance antibacterial effects. With ethanol depletion, the hydrogel's cations and phenolic hydroxyl groups synergistically regulated macrophages' anti-inflammatory transition (M1 to M2) to initiate regeneration. In the anti-contraction full-thickness wound model with infection, this hydrogel effectively eliminated bacteria and even achieved anti-inflammatory M2 macrophage accumulation at three days post-surgery, accelerated angiogenesis and collagen deposition. By sequentially driving macrophage phenotypic polarization, this injectable immunoregulatory hydrogel will bring new guidance for the care and treatment of infected wounds.

Abstract The functions of natural killer (NK) and T cells in innate and adaptive immunity, as well as their functions in tumor eradication, are complementary and intertwined. Here we show that utilization of multi-specific antibodies or nano-antibodies capable of simultaneously targeting both NK and T cells could be a valuable approach in cancer immunotherapy. Here, we introduce a tri-specific Nano-Antibody (Tri-NAb), generated by immobilizing three types of monoclonal antibodies (mAbs), using an optimized albumin/polyester composite nanoparticle conjugated with anti-Fc antibody. This Tri-NAb, targeting PDL1, 4-1BB, and NKG2A (or TIGIT) simultaneously, effectively binds to NK and CD8+ T cells, triggering their activation and proliferation, while facilitating their interaction with tumor cells, thereby inducing efficient tumor killing. Importantly, the antitumor efficacy of Tri-NAb is validated in multiple models, including patient-derived tumor organoids and humanized mice, highlighting the translational potential of NK and T cell co-targeting.

Abstract It is vital to explore effective ways for prolonging electrode lifespans under harsh electrolysis conditions, such as high current densities, acid environment, and impure water source. Here we report alternating electrolysis approaches that realize promptly and regularly repair/maintenance and concurrent bubble evolution. Electrode lifespans are improved by co-action of Fe group elemental ions and alkali metal cations, especially a unique Co2+-Na+ combo. A commercial Ni foam sustains ampere-level current densities alternatingly during continuous electrolysis for 93.8 h in an acidic solution, whereas such a Ni foam is completely dissolved in ~2 h for conventional electrolysis conditions. The work not only explores an alternating electrolysis-based system, alkali metal cation-based catalytic systems, and alkali metal cation-based electrodeposition techniques, and beyond, but demonstrates the possibility of prolonged electrolysis by repeated deposition-dissolution processes. With enough adjustable experimental variables, the upper improvement limit in the electrode lifespan would be high.

Abstract Background and objective Complex acetabular fractures involving quadrilateral areas are more challenging to treat during surgery. To date, there has been no ideal internal fixation for these acetabular fractures. The purpose of this study was to evaluate the biomechanical stability of complex acetabular fractures using a dynamic anterior titanium-plate screw system of the quadrilateral area (DAPSQ) by simulating the standing and sitting positions of pelvic specimens. Materials and methods Eight formal in-preserved cadaveric pelvises aged 30–50 years were selected as the research objects. First, one hip of the normal pelvises was randomly used as the control model (group B) for measurement, and then one hip of the pelvises was randomly selected to make the fracture model in the 8 intact pelvises as the experimental model (group A) for measurement. In group A, acetabular both-column fractures in the quadrilateral area were established, and the fractures were fixed by DAPSQ. The biomechanical testing machine was used to load (simulated physiological load) from 400 N to 700 N at a 1 mm/min speed for 30 s in the vertical direction when the specimens were measured at random in simulated standing or sitting positions in groups. The horizontal displacement and longitudinal displacement of the acetabular fractures in the quadrilateral area were measured in both the standing and sitting simulations. Results As the load increased, no dislocation or internal fixation breakage occurred during the measurements. In the standing position, the horizontal displacement of the quadrilateral area fractures in group A and group B appeared to be less than 1 mm with loads ranging from 400 N to 700 N, and there was no significant difference between group A and group B (p > 0.05). The longitudinal displacement appeared to be greater than 1 mm with a load of 700 mm in group A (700 N, 2 cases), and the difference was significant between group A and group B (p 0.05). Conclusion For complex acetabular fractures in the quadrilateral area, DAPSQ fixation may provide early sitting stability, but it is inappropriate for patients to stand too early.

Abstract Background Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent–offspring trios and proband only analysis. Methods We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. Results Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. Conclusion CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

To improve the microstructure and properties of Cu-Sn-Ti brazing alloy through component control, the effect of Si on the microstructure and properties of Cu-20Sn-15Ti brazing filler metals was studied using scanning electron microscopy, X-ray diffraction, and EDS energy spectrum analysis. The results show that the microstructure of Cu-20Sn-15Ti brazing filler metal is composed of large-sized polygonal CuSn3Ti5 phase, eutectic structure and α-Cu phase. A small amount of Si (≤ 2.0wt%) refines the polygonal-shaped CuSn3Ti5 phase in the brazing filler metal and generates small-sized Si3Ti5 phase. In contrast, a larger amount of Si (≥ 3.0wt%) differentiates the polygonal-shape CuSn3Ti5 phase, reduces the proportion of eutectic structure, and increases the content and size of the Si3Ti5 phase. When the Si content increases to 5.0wt%, the filler metal no longer generates polygonal-shaped CuSn3Ti5 phase and eutectic structure. Instead, Ti primarily forms Ti5Si3 phase, and the microstructure mainly consists of Ti5Si3 phase, α- Cu phase, Cu41Sn11 phase, and a small amount of strip-shaped CuSn3Ti5 phase. Compared with Cu and Sn, Si has a stronger chemical affinity with Ti and preferentially reacts with Ti to form Ti5Si3 phase. The three-dimensional structure of Ti5Si3 phase is prismatic and exhibits agglomerated growth characteristics. The coarse strip Ti5Si3 phase has central or lateral pore defects, which are mainly related to the growth mechanism. As the Si content increases, the shear strength of the filler metals shows a trend of “increasing-decreasing-increasing”, and the fracture morphology transitions from a mixed morphology of quasi-cleavage fracture and cleavage fracture to cleavage fracture. The CuSn3Ti5 phase is prone to breakage and cracking, becoming the source of cracking. The presence of coarse CuSn3Ti5 phase in different states can deteriorate the shear strength of the brazing filler metals to some extent.

Abstract Background posterior pedicle screw fixation is common method, one of the most severe complications is iatrogenic vascular damage, no report investigated association of different introversion angles (INTAs) and length of pedicle screw. The aims were to investigate the optimal introversion angle and length of pedicle screw for improving the safety of the operation, and to analyze the differences of vascular damage types at L1-S1. Methods Lumbar CT imaging data from110 patients were analyzed by DICOM software, and all parameters were measured by new Cartesian coordinate system, INTAs (L1-L5:5°,10°,15°,S1: 0°, 5°,10°,15°), DO−AVC (the distance between the origin (O) with anterior vertebral cortex (AVC)), DAVC−PGVs (the distance between AVC and the prevertebral great vessels (PGVs)), DO−PGVs (the distance between the O and PGVs). At different INTAs, DAVC−PGVs were divided into four grades: Grade III: DAVC−PGVs ≤ 3 mm, Grade II: 3 mm 5 mm, and N: the not touching PGVs. Results The optimal INTA was 5° at L1-L3, the left was 5° and the right was 15° at L4, and screw length was less than 50 mm at L1-L4. At L5, the left optimal INTA was 5° and the right was 10°, and screw length was less than 45 mm. The optimal INTA was 15° at S1, and screw length was less than 50 mm. However, screw length was less than 40 mm when the INTA was 0° or 5° at S1. Conclusions At L5-S1, the risk of vascular injury is the highest. INTA and length of the pedicle screw in lumbar operation are closely related. 3 mm interval of screw length may be more preferable to reduce vascular damage.

Abstract The interior environment of articular cartilage in osteoarthritis (OA) presents substantial hurdles, leading to the malfunction of chondrocytes and the breakdown of collagen II-enriched hyaline cartilage matrix. Despite this, most clinical treatments primarily provide temporary relief from OA discomfort without arresting OA progression. This study aimed to alleviate OA by developing intra-articular injectable dECM-enhanced hyaluronic (HE) microgels. The HE hydrogel was engineered and shaped into uniformly sized microgels using microfluidics and photopolymerization techniques. These microgels provided a spatiotemporal cascade effect, facilitating the rapid release of growth factors and a slower release of ECM macromolecules and proteins. This process assisted in the recovery of OA chondrocytes’ function, promoting cell proliferation, matrix synthesis, and cartilage-specific gene expression in vitro. It also effectively aided repair of the collagen II-enriched hyaline cartilage and significantly reduced the severity of OA, as demonstrated by radiological observation, gross appearance, histological/immunohistochemical staining, and analysis in an OA rat model in vivo. Collectively, the HE injectable microgels with spatiotemporal release of cartilage-specific molecules have shown promise as a potential candidate for a cell-free OA therapy approach. Graphical Abstract

Abstract The objective of regenerative wound healing dressings is to accelerate skin tissue regeneration and restore normal physiological function at wound sites. Achieving this goal requires biomaterials capable of repairing distinct phases of wound healing in a way that balances material function, degradation, safety, and tissue growth. In this study, we introduced a novel dual-stage wound dressing system comprising methacrylic anhydride-modified recombinant humanized type III collagen (rhCol III-MA) and methacrylic anhydride-modified dopamine (DMA) (RMDM), which was synthesized through free radical polymerization and π-π stacking. Within this system, RMDM was formulated into two forms with identical compositions: hydrogel and sponge, tailored for application across various stages of wound repair. These materials displayed favorable hemocompatibility, biocompatibility, antioxidant properties, and angiogenic potential in vitro. Moreover, the in vivo experiments also demonstrated that sponges could rapidly stop the bleeding of wounds in mouse tail amputation and liver incision models. Notably, the sponge/gel (S/G) system accelerated wound healing compared to individual sponge and gel treatments in a rat full-thickness skin wound model, underscoring the synergistic benefits of combining sponge and gel materials for wound repair at different stages. Therefore, this research provides valuable insights into designing advanced biomaterials that can be tailored to specific stages of wound healing, which may have significant potential for biomedical applications. Graphical Abstract

Aim: The aim of this study was to evaluate the potential protective effect of Qiju Granule in a rat model of age-related macular degeneration (AMD) and investigate the underlying mechanisms involved. Methods: Rats were injected intravenously with 40 mg/kg of sodium iodate (SI) to induce a dry AMD model. The rats in the treatment group received three different doses of Qiju Granule once a day via gavage, while the rats in the control group were given an equal volume of physiological saline. On day 14 and day 28 following the intervention, various methods were employed to evaluate retinal function and structure, including electroretinography (ERG), optical coherence tomography (OCT), and histological examination. The expression of glial fibrillary acidic protein (GFAP), basic fibroblast growth factor (bFGF), brain-derived neurotrophic factor (BDNF), and ciliary neurotrophic factor (CNTF) was assessed via immunofluorescence. Beyond immunofluorescence, the mRNA levels of bFGF, BDNF, and CNTF were quantitatively determined using real-time polymerase chain reaction (qRT-PCR). Results: Rats treated with Qiju Granule exhibited significant improvements in both retinal function and structure compared to the model group. The most noteworthy effects were observed at a high dose of Qiju Granule. Furthermore, the expression levels of bFGF, BDNF, and CNTF were significantly unregulated in the treated groups compared to the model group. Conclusions: Qiju Granule demonstrated a protective effect on the retina in the SI-induced rat model of AMD. The protective mechanism may be attributed to the upregulation of retinal neurotrophic factors expression.

Abstract Furin primarily localizes to the trans‐Golgi network (TGN), where it cleaves and activates a broad range of immature proproteins that play critical roles in cellular homeostasis, disease progression, and infection. Furin is retrieved from endosomes to the TGN after being phosphorylated, but it is still unclear how furin exits the TGN to initiate the post‐Golgi trafficking and how its activity is regulated in the TGN. Here three membrane‐associated RING‐CH finger (MARCHF) proteins (2, 8, 9) are identified as furin E3 ubiquitin ligases, which catalyze furin K33‐polyubiquitination. Polyubiquitination prevents furin from maturation by blocking its ectodomain cleavage inside cells but promotes its egress from the TGN and shedding. Further ubiquitin‐specific protease 32 (USP32) is identified as the furin deubiquitinase in the TGN that counteracts the MARCHF inhibitory activity on furin. Thus, the furin post‐Golgi trafficking is regulated by an interplay between polyubiquitination and phosphorylation. Polyubiquitination is required for furin anterograde transport but inhibits its proprotein convertase activity, and phosphorylation is required for furin retrograde transport to produce fully active furin inside cells.

Objective To systematically assess the risk prediction models for preoperative deep vein thrombosis in older patients with hip fractures. Method We searched four databases for literature through November 17, 2023. We included patients aged ≥60 with hip fractures and considered English-language case-control or cohort studies that focused on developing and/or validating risk prediction models for DVT in this population. Excluded were studies that solely analyzed risk factors without constructing a prediction model, had fewer than 2 predictive variables, or were not available in full-text or were duplicate publications. The Predictive Model Bias Risk Assessment tool was utilized to evaluate risk of bias. The area under the curve (AUC) values were meta-analyzed using R Studio software. The I 2 index and Cochrane q test were employed to assess heterogeneity. Additionally, sensitivity analysis was performed by systematically removing individual studies to explore the sources of heterogeneity. Results A total of 1880 studies were gathered. Out of these, seven studies were included, encompassing 8 models. The most commonly utilized factors in the models were D-dimer and the time from injury to admission. The pooled AUC value for the validation of 8 models was 0.84 (95% confidence interval: 0.80-0.87), indicating robust model performance. Conclusion Current risk prediction models for preoperative DVT in elderly hip fracture patients are still in the developmental phase. Future research should focus on developing new models with larger sample sizes, robust study designs, and multicenter external validation.

ObjectiveSARS-CoV-2 transmission has become a serious worldwide public health concern. However, there is currently insufficient data to determine whether SARS-CoV-2 infection would affect opportunistic infections in inflammatory bowel disease (IBD) patients.MethodsA retrospective study included 451 IBD patients (294 UC and 157 CD). The IBD patients were divided into two groups: before SARS-CoV-2 infection and after SARS-CoV-2 infection, and outcomes were measured for these groups. The primary outcome was the presence and distribution of opportunistic infections. The secondary outcomes included factors associated with opportunistic infections, based on which a nomogram prediction model was developed and validated.ResultsAfter SARS-CoV-2 infection, the proportion of IBD patients with opportunistic infections by Clostridium difficile (21.31% vs. 14.01%, p = 0.044) and Epstein–Barr virus (13.93% vs. 4.35%, p = 0.001) was significantly higher compared to that before. Conversely, the proportion of patients with hepatitis B virus (3.69% vs. 10.14%, p = 0.006) and herpes simplex virus type I (1.23% vs. 4.35%, p = 0.04) infections was significantly lower after the infection. Additionally, pre-SARS-CoV-2 infection factors associated with opportunistic infections in IBD include duration of illness, red blood cell count, the presence of comorbid chronic illnesses, and alcohol consumption, while post-SARS-CoV-2 infection, the primary risk factors involve corticosteroid use, red blood cell count, protein level, and high-sensitivity C-reactive protein.ConclusionAfter the SARS-CoV-2 infection, there has been a shift in the occurrence of opportunistic infections among IBD patients. It might be attributed to the use of corticosteroids and also the strengthening of containment measures, heightened public health awareness, and widespread vaccination.

Background: The associations of age at diagnosis of breast cancer with incident myocardial infarction (MI) and heart failure (HF) remain unexamined. Addressing this problem could promote understanding of the cardiovascular impact of breast cancer. Methods: Data were obtained from the UK Biobank. Information on the diagnosis of breast cancer, MI, and HF was collected at baseline and follow-ups (median = 12.8 years). The propensity score matching method and Cox proportional hazards models were employed. Results: A total of 251,277 female participants (mean age: 56.8 ± 8.0 years), of whom 16,241 had breast cancer, were included. Among breast cancer participants, younger age at diagnosis (per 10-year decrease) was significantly associated with elevated risks of MI (hazard ratio [HR] = 1.36, 95% confidence interval [CI] 1.19–1.56, p

Abstract Seawater electroreduction is attractive for future H2 production and intermittent energy storage, which has been hindered by aggressive Mg2+/Ca2+ precipitation at cathodes and consequent poor stability. Here we present a vital microscopic bubble/precipitate traffic system (MBPTS) by constructing honeycomb-type 3D cathodes for robust anti-precipitation seawater reduction (SR), which massively/uniformly release small-sized H2 bubbles to almost every corner of the cathode to repel Mg2+/Ca2+ precipitates without a break. Noticeably, the optimal cathode with built-in MBPTS not only enables state-of-the-art alkaline SR performance (1000-h stable operation at –1 A cm−2) but also is highly specialized in catalytically splitting natural seawater into H2 with the greatest anti-precipitation ability. Low precipitation amounts after prolonged tests under large current densities reflect genuine efficacy by our MBPTS. Additionally, a flow-type electrolyzer based on our optimal cathode stably functions at industrially-relevant 500 mA cm−2 for 150 h in natural seawater while unwaveringly sustaining near-100% H2 Faradic efficiency. Note that the estimated price (~1.8 US$/kgH2) is even cheaper than the US Department of Energy’s goal price (2 US$/kgH2).

Abstract Abnormal hemoglobin anti-Lepore Hong Kong is a rare βδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of β0-thalassemia and α-thalassemia (–SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with β0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2–40.8%) and behaved with β-thalassemia trait. Furthermore, determination of the α/β-mRNA ratio revealed a slight downregulation of β-globin, similar to that of β-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, β0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

High-performance flexible pressure sensors provide comprehensive tactile perception and are applied in human activity monitoring, soft robotics, medical treatment, and human-computer interface. However, these flexible pressure sensors require extensive nano-architectural design and complicated manufacturing and are time-consuming. Herein, a highly sensitive, flexible piezoresistive tactile sensor is designed and fabricated, consisting of three main parts: the randomly distributed microstructure on T-ZnOw/PDMS film as a top substrate, multilayer Ti3C2-MXene film as an intermediate conductive filler, and the few-layer Ti3C2-MXene nanosheet-based interdigital electrodes as the bottom substrate. The MXene-based piezoresistive sensor with randomly distributed microstructure exhibits a high sensitivity over a broad pressure range (less than 10 ​kPa for 175 ​kPa−1) and possesses an out-standing permanence of up to 5000 cycles. Moreover, a 16-pixel sensor array is designed, and its potential applications in visualizing pressure distribution and an example of tactile feedback are demonstrated. This fully sprayed MXene-based pressure sensor, with high sensitivity and excellent durability, can be widely used in, electronic skin, intelligent robots, and many other emerging technologies.

Abstract The assembly of oligopeptide and polypeptide molecules can reconstruct various ordered advanced structures through intermolecular interactions to achieve protein-like biofunction. Here, we develop a “molecular velcro”-inspired peptide and gelatin co-assembly strategy, in which amphiphilic supramolecular tripeptides are attached to the molecular chain of gelatin methacryloyl via intra-/intermolecular interactions. We perform molecular docking and dynamics simulations to demonstrate the feasibility of this strategy and reveal the advanced structural transition of the co-assembled hydrogel, which brings more ordered β-sheet content and 10-fold or more compressive strength improvement. We conduct transcriptome analysis to reveal the role of co-assembled hydrogel in promoting cell proliferation and chondrogenic differentiation. Subcutaneous implantation evaluation confirms considerably reduced inflammatory responses and immunogenicity in comparison with type I collagen. We demonstrate that bone mesenchymal stem cells-laden co-assembled hydrogel can be stably fixed in rabbit knee joint defects by photocuring, which significantly facilitates hyaline cartilage regeneration after three months. This co-assembly strategy provides an approach for developing cartilage regenerative biomaterials.

Abstract Ratios of glycerol dialkyl glycerol tetraethers (GDGT), which are membrane lipids of bacteria and archaea, are at the base of several paleoenvironmental proxies. They are frequently applied to soils as well as lake‐ and marine sediments to generate records of past temperature and soil pH. To derive meaningful environmental information from these reconstructions, high analytical reproducibility is required. Based on submitted results by 39 laboratories from across the world, which employ a diverse range of analytical and quantification methods, we explored the reproducibility of brGDGT‐based proxies (MBT′5ME, IR, and #ringstetra) measured on four soil samples and four soil lipid extracts. Correct identification and integration of 5‐ and 6‐methyl brGDGTs is a prerequisite for the robust calculation of proxy values, but this can be challenging as indicated by the large inter‐interlaboratory variation. The exclusion of statistical outliers improves the reproducibility, where the remaining uncertainty translates into a temperature offset from median proxy values of 0.3–0.9°C and a pH offset of 0.05–0.3. There is no apparent systematic impact of the extraction method and sample preparation steps on the brGDGT ratios. Although reported GDGT concentrations are generally consistent within laboratories, they vary greatly between laboratories. This large variability in brGDGT quantification may relate to variations in ionization efficiency or specific mass spectrometer settings possibly impacting the response of brGDGTs masses relative to that of the internal standard used. While ratio values of GDGT are generally comparable, quantities can currently not be compared between laboratories.

BackgroundTo investigate whether the novel mutation of PKHD1 could cause polycystic kidney disease by affecting splicing with a recessive inheritance pattern.MethodsA nonconsanguineous Chinese couple with two recurrent pregnancies showed fetal enlarged echogenic polycystic kidney and oligoamnios were recruited. Pedigree WES, minigene splicing assay experiment and following bioinformatics analysis were performed to verify the effects, and inheritance pattern of diseasing-causing mutations.ResultsWES revealed that both fetuses were identified as carrying the same novel mutation c.3592_3628 + 45del, p.? and c.11207 T>C, p.(Ile3736Thr) in the PKHD1 gene (NM_138694.4), which inherited from the father and mother respectively. Both bioinformatic method prediction and minigene splicing assay experience results supported the mutation c.3592_3628 + 45del, p.? affects the splicing of the PKHD1 transcript, resulting in exon 31 skipping. Another missense mutation c.11207 T>C, p.(Ile3736Thr) has a low frequency in populations and is predicted to be deleterious by bioinformatic methods.ConclusionThese findings provide a direct clinical and functional evidence that the truncating mutations of the PKHD1 gene could lead to more severe phenotypes, and cause ARPKD as a homozygous or compound heterozygous pattern. Our study broadens the variant spectrum of the PKHD1 gene and provides a basis for genetic counseling and diagnosis of ARPKD.

Evaluating environmental flow (EF) is pivotal for conserving and restoring riverine ecosystems. Yet, prevalent EF evaluations presume that a river reach's hydraulic conditions are exclusively governed by inflow discharge, presupposing a state of equilibrium in the river channel. This presumption narrows the scope of EF evaluations in expansive alluvial rivers like the Middle Yangtze River (MYR), characterized by marked channel alterations. Here we show the profound channel erosion process and its impact on EF requirements for riparian habitats within the MYR. Our research unveils that: (i) pronounced erosion has led to a mean reduction of 1.0–2.7 m in the riverbed across four sub-reaches of the MYR; (ii) notwithstanding a 37–107% increase in minimal discharges post the Three Gorges Project, the lowest river stages at some hydrometric stations diminished owing to bed erosion, signifying a notable transformation in MYR's hydraulic dynamics; (iii) a discernible rightward shift in the correlation curve between the weighted useable area and discharge from 2002 to 2020 in a specific sub-reach of the MYR, instigated by alterations in hydraulic conditions, necessitated an increase of 1500–2600 m³ s−1 in the required EF for the sub-reach; (iv) it is deduced that macroinvertebrate biomass rapidly decreases as the flow entrains the riverbed substrate, with the maximum survivable velocity for macroinvertebrates being contingent on their entrainment threshold. These findings highlight the importance of incorporating channel morphological changes in devising conservation strategies for the MYR ecosystem.

Soybean production, integral to sustainable agriculture and reliant on imports, faces vulnerability to international risk factors impacting domestic food security. The 2021 Central Rural Work Conference advocated strategic adjustments for sustainable soybean production amidst resource constraints, trade conflicts, and the lingering impact of COVID-19. This study scrutinizes the developmental framework of China’s soybean industry within current domestic policies. This paper uses the soybean sown area and soybean production in each province of China from 1995 to 2020 to measure China’s soybean concentration, production layout, and comparative advantage of regional scale, to analyze in depth the overall situation of China’s soybean production as well as the differences between regions, and to pave the way for the subsequent soybean production forecast. Further, taking the domestic soybean supply and demand situation in China in 2020 as the base period, while considering the growth values of soybean production under different scenarios, the potential forecasting model is utilized to estimate China’s soybean production under different scenarios. The results show that, in terms of inter-annual variability, revealing an upward trajectory from 1995 to 2020, with a shift to major soybean producing areas, notably in the northeast and the Huanghe-Huaihe-Haihe area. From inter-provincial changes, Soybean production on the left and right sides of the “Hu-Huanyong line” has significant heterogeneity; specifically, east of the “Hu-Huanyong line,” soybean production advantages are more obvious. Additionally, the study considered the actual planting situation of soybeans and envisaged two scenarios of compound planting and strip planting. The soybean production range in 2030 is expected to be 20.73–22.32 million tons and 21.15–27.55 million tons, with self-sufficiency rates varying from 18.57 to 19.98% and 18.95 to 24.68%, respectively. The research aims to provide a comprehensive understanding of China’s soybean industry and its potential trajectories, employing a model combining historical trends, policy analysis, and technological advancements. Results suggest a promising future with strategic adjustments in planting structures. Recommendations emphasize policymakers’ prioritization of technological investments and sustainable planting practices to achieve projected production targets. Policy interventions must address challenges tied to resource limitations, trade conflicts, and the ongoing COVID-19 effects, ensuring soybean industry resilience.

Scutellaria baicalensis Georgi is a medicinal herb with a rich history of use in traditional Chinese medicine. This review concentrates on the chemical constituents of Scutellaria baicalensis Georgi, with a particular emphasis on flavonoids such as baicalin, baicalein, and wogonin. Additionally, it examines the effects of probiotic fermentation on the plant’s chemical profile and pharmacological actions. Evidence suggests that probiotic fermentation markedly modifies the bioactive components of Scutellaria baicalensis Georgi, thereby augmenting its medicinal potency. The paper delves into the mechanisms by which the primary active constituents of Scutellaria baicalensis Georgi are altered during fermentation and how these changes influence its pharmacological properties. This review aims to lay a theoretical groundwork for the clinical utilization of Scutellaria baicalensis Georgi and the formulation of innovative therapeutic approaches.

Summary: This review explores the hallmarks of cancer resistance, including drug efflux mediated by ATP-binding cassette (ABC) transporters, metabolic reprogramming characterized by the Warburg effect, and the dynamic interplay between cancer cells and mitochondria. The role of cancer stem cells (CSCs) in treatment resistance and the regulatory influence of non-coding RNAs, such as long non-coding RNAs (lncRNAs), microRNAs (miRNAs), and circular RNAs (circRNAs), are studied. The chapter emphasizes future directions, encompassing advancements in immunotherapy, strategies to counter adaptive resistance, integration of artificial intelligence for predictive modeling, and the identification of biomarkers for personalized treatment. The comprehensive exploration of these hallmarks provides a foundation for innovative therapeutic approaches, aiming to navigate the complex landscape of cancer resistance and enhance patient outcomes.

Probiotics are defined as living or dead bacteria and their byproducts that maintain the balance of the intestinal microbiome. They are non-toxic, non-pathogenic, and do not release any toxins either within or outside the body. Adequate consumption of probiotics can enhance metabolite production, increase immunity, maintain a balanced intestinal flora, and stimulate growth. Probiotics do not have negative antibiotic effects and help maintain the natural flora in animals in a balanced state or prevent dysbacteriosis. Heyndrickxia coagulans (H. coagulans) is a novel probiotic species that is gradually being used for the improvement of human health. Compared to commonly used probiotic lactic acid bacteria, H. coagulans can produce spores, which provide the species with high resistance to adverse conditions. Even though they are transient residents of the gut, beneficial bacteria can have a significant impact on the microbiota because they can outnumber harmful germs, and vice versa. This article discusses the probiotic mechanisms of H. coagulans and outlines the requirements for a substance to be classified as a probiotic. It also addresses how to assess strains that have recently been discovered to possess probiotic properties.

Abstract SARS-CoV-2 and filovirus enter cells via the cell surface angiotensin-converting enzyme 2 (ACE2) or the late-endosome Niemann-Pick C1 (NPC1) as a receptor. Here, we screened 974 natural compounds and identified Tubeimosides I, II, and III as pan-coronavirus and filovirus entry inhibitors that target NPC1. Using in-silico, biochemical, and genomic approaches, we provide evidence that NPC1 also binds SARS-CoV-2 spike (S) protein on the receptor-binding domain (RBD), which is blocked by Tubeimosides. Importantly, NPC1 strongly promotes productive SARS-CoV-2 entry, which we propose is due to its influence on fusion in late endosomes. The Tubeimosides’ antiviral activity and NPC1 function are further confirmed by infection with SARS-CoV-2 variants of concern (VOC), SARS-CoV, and MERS-CoV. Thus, NPC1 is a critical entry co-factor for highly pathogenic human coronaviruses (HCoVs) in the late endosomes, and Tubeimosides hold promise as a new countermeasure for these HCoVs and filoviruses.

Abstract Breast cancer (BC) is a multifaceted disease characterized by distinct molecular subtypes and varying responses to treatment. In BC, the phosphatidylinositol 3-kinase (PI3K) pathway has emerged as a crucial contributor to the development, advancement, and resistance to treatment. This review article explores the implications of the PI3K pathway in predictive, preventive, and personalized medicine for BC. It emphasizes the identification of predictive biomarkers, such as PIK3CA mutations, and the utility of molecular profiling in guiding treatment decisions. The review also discusses the potential of targeting the PI3K pathway for preventive strategies and the customization of therapy based on tumor stage, molecular subtypes, and genetic alterations. Overcoming resistance to PI3K inhibitors and exploring combination therapies are addressed as important considerations. While this field holds promise in improving patient outcomes, further research and clinical trials are needed to validate these approaches and translate them into clinical practice. Graphical Abstract

This paper reports a performance optimized operational amplifier (OPAMP) using transconductance enhancement topology based on the amorphous indium- gallium-zinc-oxide (a-IGZO) thin-film transistors (TFTs). The performance of TFTs is enhanced by N2O plasma treatment that presents electrical characteristics suitable for accomplishing an OPAMP. The circuit consists of 19 TFTs with measured phase margin (PM) and unity-gain frequency (UGF) of 35.8° and 200 kHz, respectively. The DC power consumption (PDC) is 0.68 mW. Notably, it exhibits a high voltage gain (Av) of 32.67 dB and bandwidth (BW) of 15 kHz with 15 V DC supply voltage. Scarcely any work was reported with such a high gain while having a sufficient BW. The OPAMP demonstrates excellent performance among all a-IGZO literature and provides substantial support for the future development of TFT-based integrated circuits (ICs).

Abstract The regeneration of articular cartilage posed a formidable challenge due to the restricted treatment efficacy of existing therapies. Scaffold-based tissue engineering emerges as a promising avenue for cartilage reconstitution. However, most scaffolds exhibit inadequate mechanical characteristics, poor biocompatibility, or absent cell adhesion sites. In this study, cartilage-like protein-polysaccharide hybrid hydrogel based on DOPA-modified hyaluronic acid, bovine type I collagen (Col I), and recombinant humanized type II collagen (rhCol II), denoted as HDCR. HDCR hydrogels possessed the advantage of injectability and in situ crosslinking through pH adjustment. Moreover, HDCR hydrogels exhibited a manipulable degradation rate and favorable biocompatibility. Notably, HDCR hydrogels significantly induced chondrogenic differentiation of rabbit bone marrow mesenchymal stem cells in vitro, as demonstrated by the upregulation of crucial chondrogenic genes (type II collagen, aggrecan) and the abundant accumulation of glycosaminoglycan. This approach presented a strategy to manufacture injectable, biodegradable scaffolds based on cartilage-like protein-polysaccharide polymers, offering a minimally invasive solution for cartilage repair. Graphical abstract

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

The jackfruit seed dietary fiber was modified by high temperature cooking combined with ultrasonic enzymatic method. Single factor combined with response surface method was applied to optimize the modification process conditions. The structure of soluble dietary fiber (SDF) before and after modification was compared and analyzed by scanning electron microscope (SEM), X-ray diffraction (XRD), thermogravimetry (TGA) and Fourier transform infrared spectrometer (FTIR). The functional properties of SDF before and after modification were determined with water holding capacity, expansion capacity, oil holding capacity and adsorption capacity for nitrite ion, glucose, bile salt and cholesterol as indicators. The results showed that the optimum modification conditions of DF were as follows: The ratio of material to liquid 1:21 g/mL, cooking temperature 121 ℃, cooking time 43 min, cellulase amount 8%, ultrasonic-assisted enzymatic (UAE) power 360 W, UAE temperature 40 ℃, UAE time 52 min. Under these conditions, the yield of SDF was 24.39%±0.03%, the yield of unmodified SDF was 16.93%±0.60%. Compared with unmodified SDF, FTIR results showed that the cellulose components of jackfruit seeds were redistributed. SEM indicated a more porous structure. XRD results showed an increase in crystallinity, and TGA results showed better thermal stability. The water holding capacity, expansion capacity, oil retention capacity, nitrite ion adsorption capacity, glucose adsorption capacity, bile salt adsorption capacity, and cholesterol adsorption capacity of modified SDF were significantly better than those of unmodified SDF (P

Abstract Conventional underground gas pipeline equipment can only map straight pipelines at close distances. As such, a dual-robot mapping technique is proposed in this study, based on laser ranging and a gyroscope, for application to straight, bent, or sloped underground pipelines. This process is facilitated by two robots (a detecting vehicle and a mapping vehicle) alternately moving from the entrance to the exit of a pipe system. The two vehicles acquire data using individual distance sensors and a gyroscope, producing 3D maps of each section. Mapping results can then be produced for the entire pipeline by splicing images from multiple sections. Simulated validation experiments were conducted using horizontal straight, bent horizontal fixed turning radius, sloped uphill or downhill, and composite sections. Results showed this approach could effectively map different types of pipelines with inner diameters of 300–500 mm. Distance errors over 2000 m of travel were within 1 m, while the angular error was within 1.5°, demonstrating our approach to be highly accurate for complex pipeline system mapping.

Abstract The pandemic of COVID-19 was a major public health events and had a deeply impact on the healthcare acquired by patients with inflammatory bowel disease (IBD). The purpose of this study was to evaluate the long-term impacts on healthcare service in Chinese IBD patients under the dynamic zero-COVID strategy. The study was performed in the Inflammatory Bowel Disease Quality of Care Centers in mainland China in 2021. The data about the healthcare was collected by a 44-item questionnaire. Totally 463 were from ulcerative colitis (UC) patients and 538 from Crohn’s disease (CD) patients were included in the study. The pandemic impacted 37.5% patients on their treatment, and the biggest problem was unable to follow up timely (77.9%). There was a significant increase in healthcare costs in CD (P

To analyze the impact of volcanic rocks in the Offshore Indus Basin on hydrocarbon reservoir formation, seismic data interpretation, seismic data inversion, and sea–land correlation analysis were carried out. The results show that, longitudinally, volcanic rocks are mainly distributed at the top of the Cretaceous system or at the bottom of the Paleocene, and carbonate rock platforms or reefs of the Paleocene–Eocene are usually developed on them. On the plane, volcanic rocks are mainly distributed on the Saurashtra High in the southeastern part of the basin. In terms of thickness, the volcanic rocks revealed by drilling in Karachi nearshore are about 70 m thick. We conducted sparse spike inversion for acoustic impedance in the volcanic rock area. The results show that the thickness of the Deccan volcanic rocks in the study area is between 250 and 750 m which is thinning from southeast to northwest. Based on sea–land comparison and comprehensive research, the distribution of volcanic rocks in the Indian Fan Offshore Basin played a constructive role in the Mesozoic oil and gas accumulation in the Indus offshore. Therefore, in the Indian Fan Offshore Basin, attention should be paid to finding Mesozoic self-generated and self-stored hydrocarbon reservoirs and Cenozoic lower-generated and upper-stored hydrocarbon reservoirs.

ABSTRACTGrowing evidence indicates that gut microbiota is involved in the regulation of the host’s sex hormone levels, such as through interfering with the sex hormone metabolism in the intestine. However, if gut microbiota or its metabolites directly influence the sex hormone biosynthesis in the gonad remains largely unknown. Our previous study showed that colistin, as a narrow-spectrum antibiotic, can significantly downregulate the serum testosterone levels and thus enhance the antitumor efficiency of anti-PD-L1 in male mice; however, the underlying mechanism for the regulation of the host’s testosterone levels remains uninvestigated. In the present study, we analyzed the impact of colistin on the immune microenvironment of the testis as well as the composition and metabolism of gut microbiota in male mice. Our results showed that colistin has an impact on the immune microenvironment of the testis and can downregulate serum testosterone levels in male mice through inhibition of Akkermansia, leading to destroyed inosine metabolism. Supplement with inosine can restore testosterone secretion probably by prompting the recovery of the intestinal mucus barrier and the serum lipopolysaccharides levels. All these findings reveal a new pathway for the regulation of the host’s sex hormone levels by gut microbiota.IMPORTANCEThis study demonstrates that exposure to even narrow-spectrum antibiotics may affect the host’s testosterone levels by altering the gut microbiota and its metabolites. Our findings provide evidence that some specific gut bacteria have an impact on the sex hormone biosynthesis in the testis.

Activating transcription factor 4 (ATF4) is an adaptive response regulator of metabolic and oxidative homeostasis. In response to cellular stress, ATF4 is activated and functions as a regulator to promote cell adaptation for survival. As a transcriptional regulator, ATF4 also widely participates in the regulation of amino acid metabolism, autophagy, redox homeostasis and endoplasmic reticulum stress. Moreover, ATF4 is associated with the initiation and progression of glioblastoma, hepatocellular carcinoma, colorectal cancer, gastric cancer, breast cancer, prostate cancer and lung cancer. This review primarily aims to elucidate the functions of ATF4 and its role in multiple cancer contexts. This review proposes potential therapeutic targets for clinical intervention.

Abstract Soft porous organic crystals with stimuli‐responsive single‐crystal‐to‐single‐crystal (SCSC) transformations are important tools for unraveling their structural transformations at the molecular level, which is of crucial importance for the rapid development of stimuli‐responsive systems. Carefully balancing the crystallinity and flexibility of materials is the prerequisite to construct advanced organic crystals with SCSC, which remains challenging. Herein, a squaraine‐based soft porous organic crystal (SPOC‐SQ) with multiple gas‐induced SCSC transformations and temperature‐regulated gate‐opening adsorption of various C1‐C3 hydrocarbons is reported. SPOC‐SQ is featured with both crystallinity and flexibility, which enable pertaining the single crystallinity of the purely organic framework during accommodating gas molecules and directly unveiling gas‐framework interplays by SCXRD technique. Thanks to the excellent softness of SPOC‐SQ crystals, multiple metastable single crystals are obtained after gas removals, which demonstrates a molecular‐scale shape‐memory effect. Benefiting from the single crystallinity, the molecule‐level structural evolutions of the SPOC‐SQ crystal framework during gas departure are uncovered. With the unique temperature‐dependent gate‐opening structural transformations, SPOC‐SQ exhibits distinctly different absorption behaviors towards C3H6 and C3H8, and highly efficient and selective separation of C3H6/C3H8 (v/v, 50/50) is achieved at 273 K. Such advanced soft porous organic crystals are of both theoretical values and practical implications.

Abstract Uterine corpus endometrial carcinoma (UCEC) is infiltrated by immune cells, which are involved in the growth and proliferation of malignant tumors and resistance to immunotherapy. This study suggested that RNA modification regulators played an important role in the development and prognosis of UCEC. Many studies confirmed that RNA modification played an essential role in tumor immune regulation, and abnormal RNA modification contributed to tumorigenesis and cancer progression. Based on the RNA modification regulatory factors, the UCEC samples from TCGA (The Cancer Genome Atlas) were classified into two clusters, namely Cluster A and Cluster B, using unsupervised consensus clustering. We obtained DEG (differentially expressed genes) between the two clusters, and constructed a risk model of RNA modification-related genes using DEGs. Cluster A had lower RNA modification regulatory factors, richer immune cell infiltration, and better prognosis. The differentially expressed genes between the two clusters were obtained, and these genes were used for modeling. This model divided patients with UCEC into two groups. The low-risk group had better immune infiltration, and the ROC (receiver operating characteristic) curve showed that this model had good predictive efficacy. The low-risk group had a better response to immunotherapy by immune checkpoint prediction. We obtained the key gene l-dopa decarboxylase (DDC) through the intersection of LASSO model genes and GEO dataset GSE17025. We evaluated the potential biological functions of DDC. The differences in the expression of DDC were verified by immunohistochemistry. We evaluated the relationship between DDC and immune cell infiltration and verified this difference using immunofluorescence. Cluster A with low expression of RNA modification regulators has better prognosis and richer immune cell infiltration, therefore, we believed that RNA modification regulators in UCEC were closely related to the tumor microenvironment. Also, the risk score could well predict the prognosis of patients and guide immunotherapy, which might benefit patients with UCEC.

Counter-flow engines are often used for aircraft slowing or separating. In order to study the interaction between the counter-flow jets and free stream at high altitudes, the rarefied flow driven by two counter-flow jets and hypersonic free stream was constructed. By the direct simulation Monte Carlo (DSMC) method, it is found that a large area of mutual interference will be formed under the condition of rarefied free stream, and there are serious unsteady flow phenomena in the interference area. According to preliminary analysis, the range and unsteady evolution of the interference area are closely related to the kinetic energy of free stream and the flow rate of counter-flow jets.

Abstract Single-crystal silicon carbide (SiC) has been widely applied in the military and civil fields because of its excellent physical and chemical properties. However, as is typical in hard-to-machine materials, the good mechanical properties result in surface defects and subsurface damage during precision or ultraprecision machining. In this study, single- and double-varied-load nanoscratch tests were systematically performed on single-crystal 4H-SiC using a nanoindenter system with a Berkovich indenter. The material removal characteristics and cracks under different planes, indenter directions, normal loading rates, and scratch intervals were analyzed using SEM, FIB, and a 3D profilometer, and the mechanisms of material removal and crack propagation were studied. The results showed that the Si-plane of the single-crystal 4H-SiC and edge forward indenter direction are most suitable for material removal and machining. The normal loading rate had little effect on the scratch depth, but a lower loading rate increased the ductile region and critical depth of transition. Additionally, the crack interaction and fluctuation of the depth-distance curves of the second scratch weakened with an increase in the scratch interval, the status of scratches and chips changed, and the comprehensive effects of the propagation and interaction of the three cracks resulted in material fractures and chip accumulation. The calculated and experimental values of the median crack depth also showed good consistency and relativity. Therefore, this study provides an important reference for the high-efficiency and precision machining of single-crystal SiC to ensure high accuracy and a long service life.

The influence of epigallocatechin gallate (EGCG) on the physicochemical–rheological properties of silver carp surimi gel was investigated. The gel strength, texture, water-holding capacity (WHC), dynamic distribution of water, and rheological properties of surimi gels added with different levels (0, 0.02, 0.04, 0.06, 0.08, and 0.1%) of EGCG were measured. The results showed that with the increase of EGCG content, the gel strength, hardness, WHC, and immobilized water contents of surimi gels showed a trend of first increasing and then decreasing, and EGCG 0.02% and EGCG 0.04% showed better gel performance as compared with the control. EGCG 0.02% had the highest gel strength (406.62 g·cm), hardness (356.67 g), WHC (64.37%), and immobilized water contents (98.958%). The gel performance decreased significantly when the amounts of EGCG were higher than 0.06%. The viscosity, G′, and G″ of the rheological properties also showed the same trends. The chemical interaction of surimi gels, secondary structure of myofibrillar protein (MP), and molecular docking results of EGCG and silver carp myosin showed that EGCG mainly affected the structure and aggregation behavior of silver carp myosin through non-covalent interactions such as those of hydrogen bonds, hydrophobic interactions, and electrostatic interactions. The microstructures of EGCG 0.02% and EGCG 0.04% were compact and homogeneous, and had better gel formation ability. The lower concentrations of EGCG formed a large number of chemical interactions such as those of disulfide bonds and hydrophobic interactions inside the surimi gels by proper cross-linking with MP, and also increased the ordered β-sheet structure of MP, which facilitated the formation of the compact three-dimensional network gel.

Presently, there is limited data on the potential survival benefits of transurethral resection of the prostate (TURP) in patients with metastatic hormone-sensitive prostate cancer (mHSPCa). In this study, we aimed to assess the effects of TURP on the survival of mHSPCa patients. Of the 59 patients diagnosed with mHSPCa included, 28 received androgen deprivation therapy (ADT) alone, and the remaining received TURP plus ADT. Their time to biochemical progression (TBCP) and progression-free survival (PFS) were analyzed. Our results showed that for a median follow-up time of 15 (range, 3–40) months and 21 (range, 6–39) months for the ADT group and the TURP group, respectively, the TURP group exhibited significantly longer TBCP than the ADT group (p = 0.020). In addition, patients in the TURP group had numerically longer PFS, although the difference between the two groups was not significantly different (p = 0.110). Cox multivariate analysis indicated that longer TBCP was independently associated with TURP (p = 0.032) and lower Gleason scores (p = 0.001). Altogether this study showed that TURP could prolong TBCP and potentially improve the PFS of mHSPCa patients. However, further studies with a larger sample size are needed to confirm these findings.

Abstract Background Huangqi Guizhi Wuwu decoction (HQGZWWD) has been used to treat and prevent deep vein thrombosis (DVT) in China. However, its potential mechanisms of action remain unclear. This study aimed to utilize network pharmacology and molecular docking technology to elucidate the molecular mechanisms of action of HQGZWWD in DVT. Methods We identified the main chemical components of HQGZWWD by reviewing the literature and using a Traditional Chinese Medicine Systems Pharmacology (TCMSP) database. We used GeneCards and Online Mendelian Inheritance in Man databases to identify the targets of DVT. Herb-disease-gene-target networks using Cytascape 3.8.2 software; a protein–protein interaction (PPI) network was constructed by combining drug and disease targets on the STRING platform. Additionally, we conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. Finally, molecular docking verification of active components and core protein targets was conducted. Results A total of 64 potential targets related to DVT were identified in HQGZWWD, with 41 active components; quercetin, kaempferol, and beta-sitosterol were the most effective compounds. The PPI network analysis revealed that AKT1, IL1B, and IL6 were the most abundant proteins with the highest degree. GO analysis indicated that DVT treatment with HQGZWWD could involve the response to inorganic substances, positive regulation of phosphorylation, plasma membrane protein complexes, and signaling receptor regulator activity. KEGG analysis revealed that the signaling pathways included pathways in cancer, lipid and atherosclerosis, fluid shear stress and atherosclerosis, and the phosphatidylinositol 3-kinases/protein kinase B(PI3K-Akt) and mitogen-activated protein kinase (MAPK) signaling pathways. The molecular docking results indicated that quercetin, kaempferol, and beta-sitosterol exhibited strong binding affinities for AKT1, IL1B, and IL6. Conclusion Our study suggests that AKT1, IL1B, and IL6 are promising targets for treating DVT with HQGZWWD. The active components of HQGZWWD likely responsible for its effectiveness against DVT are quercetin, kaempferol, and beta-sitosterol, they may inhibit platelet activation and endothelial cell apoptosis by regulating the PI3K/Akt and MAPK signaling pathways, slowing the progression of DVT.