Search

Aim: Oral squamous cell carcinoma (OSCC) exhibits dysregulation of cell death pathways, including necroptosis. miR-140 closely regulates the pathogenesis of OSCC and also interferes with different steps of the necroptotic pathway. This study investigates the molecular interaction between platelet-derived growth factor receptor A (PDGFRA)-associated miR-140 and necroptotic proteins (receptor-interacting protein kinase 3 [RIPK3] and mixed lineage kinase domain like pseudokinase [MLKL]) using computational docking. Materials and Methods: This is an in silico docking analysis performed to elucidate the involvement of PDGFRA-related microRNAs in necroptosis in OSCC. TargetScanHuman 8.0 was used to identify the micro ribonucleic acids (miRNAs) and obtain their sequence related to PDGFRA. The secondary structure of miRNA was predicted using the RNAfold web server, and the 3D structure was constructed using the RNAComposer (ibch.poznan.pl). The protein structures of RIPK3 and MLKL were retrieved from RCSB PDB: Homepage and molecular docking between the necroptotic proteins and miRNA was performed with HDOCK Server. Results: The docking analysis revealed that hsa-miR-140-5p binds to position 59-65 of PDGFRA 3' UTR. The sequence of hsa-miR-140-5p was determined as 23| CAGUGGUUUUACCCUAUGGUAG |44, and its secondary structure was predicted as CAGUGGUUUUACCCUAUGGUAG. HDOCK Server revealed molecular interactions between miR-140 and the necroptotic proteins. The docking analysis between miRNA and its target proteins, MLKL and RIPK3, yielded binding scores of -262.88 and -350.92, respectively. Conclusion: Our findings demonstrate that miR-140 binds to specific regions of RIPK3 and MLKL, potentially modulating necroptosis and influencing cancer progression. These insights could pave the way for miRNA-based therapeutic strategies targeting regulated cell death in OSCC. [ABSTRACT FROM AUTHOR]

Odontogenic keratocyst (OKC) is an uncommon developmental cyst with a high recurrence rate. Epithelial dysplasia is a rarely recognized phenomenon in OKCs, with only a few acceptable cases reported in the literature. The exact pathogenesis of dysplastic changes in epithelial lining is difficult to explain, in the absence of molecular analyses. Here, we report a rare case of maxillary OKC with multiple cystic compartments displaying epithelial dysplasia in a 62-year-old man with immunohistochemical analyses and a comprehensive review of the literature. It may be prudent to believe that the aggressive behaviour in the epithelial lining of OKC is an inherent property of all OKCs, which is only dictated by the epithelium but is also determined by the stromal cells of the cyst wall; the dysplastic changes, however, could be resultant to chronic inflammatory reaction and inflammation-mediated carcinogenesis mechanism. It is recommended that the dysplastic features in the epithelial lining of all odontogenic cysts must be addressed in all pathology reports along with close clinical follow-up. [ABSTRACT FROM AUTHOR]

Introduction: Medicinal plants and their substances are used as adjunctive therapies for a range of acute and chronic inflammatory diseases. Syzygium aromaticum and Persea americana, in particular, have demonstrated beneficial effects, including anti-inflammatory and antioxidant properties, in the management of inflammation. Although the extracts from these plants have been assessed in research, the possibility of combining them to synthesise a mouthwash and evaluate its effectiveness has not yet been investigated. Aim: To evaluate the combined anti-inflammatory and antioxidant properties of a mouthwash formulation based on the extensively nutritious avocado fruit (Persea americana) and clove (Syzygium aromaticum). Materials and Methods: This in-vitro investigation was carried out in the Oral Pathology and Microbiology Department at Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, Tamil Nadu, India, between December 2021 and July 2022. A mouthwash was formulated with extracts from clove and avocado fruit, and its anti-inflammatory and antioxidant properties were evaluated using Bovine Serum Albumin (BSA) denaturation and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays, respectively. Microsoft Excel was utilised for data collection, and Statistical Package for the Social Sciences (SPSS) version 23.0 with independent t-tests was used for statistical analysis. A p-value of 0.05 was considered statistically significant. Results: The anti-inflammatory activity of the prepared mouthwash based on P. americana and Syzygium aromaticum at a concentration of 50 µL (86.62% inhibition) was comparable to that of the standard drug (diclofenac sodium) (84.82% inhibition); however, its antioxidant properties were significantly lower. Conclusion: The mouthwash synthesised from the edible part of P. americana in conjunction with Syzygium aromaticum exhibited superior anti-inflammatory properties, with the highest activity observed at a concentration of 50 µL. Therefore, the prepared formulation could be used for managing minor inflammatory conditions. [ABSTRACT FROM AUTHOR]

Introduction: Decalcification is a technique used to remove calcium salts from hard tissue specimens, such as bone or teeth, to make them suitable for sectioning. X-rays, physical methods, and chemical methods are commonly used to determine the endpoint of decalcification. However, these procedures can be cumbersome, may deteriorate the specimen, and are often subjective. Aim: To determine the endpoint of decalcification of hard tissue specimens using a colour palette. Materials and Methods: A cross-sectional study was conducted in the Department of Oral Pathology at Saveetha Dental College and Hospitals in Chennai, Tamil Nadu, India, over a period of 5 months. A total of 25 hard tissue specimens (10 bone and 15 teeth) were subjected to decalcification in 20% formic acid. To evaluate the endpoint of decalcification, silver nitrate solution was added to the formic acid, and the colour change was noted. The resulting colour was compared with a previously patented colour palette (Patent number: 202241047215). Once a lighter colour was obtained, the specimen was processed, sectioned, and stained using Haematoxylin and Eosin (H&E). The slides were then evaluated by two pathologists. Results: A total of 8 (80%) bone samples exhibited excellent staining, while 2 (20%) samples showed a good staining score. Regarding the tooth samples, 14 (93.3%) showed excellent staining, and one (6.66%) tooth displayed a good staining score. Conclusion: The present method is a simple and safe way to determine the endpoint of decalcification for a specimen. It does not damage the tissue, thus preserving the integrity of the hard tissue specimen. [ABSTRACT FROM AUTHOR]

Introduction: Basaloid squamous cell carcinoma (BSCC) is a rare aggressive variant of oral squamous cell carcinoma (OSCC) with a high propensity for distant metastasis. In this article, we present clinicopathological and survival data of eight cases of BSCC and further analyse the behaviour of these tumours with the help of E-cadherin, CD34, CD105 and B cell lymphoma-2 (Bcl-2) immunoexpression. Materials and Methods: Histopathologically confirmed cases of BSCC were retrieved from the department archives. Clinicopathological details and survival data of these patients were collected. Immunohistochemical analysis was performed with Bcl-2, E-cadherin, CD34 and CD105 on these cases and compared with different grades of OSCC (well differentiated, moderately differentiated and poorly differentiated). The statistical analysis was done using IBM SPSS software version 23. Results: BSCC was seen commonly in males of age group 49–71 years and predominantly reported in the retromolar trigone. Bcl-2 expression was significantly lower in BSCCs when compared to the conventional OSCC groups (P < 0.05). E-cadherin expression showed no significant difference between BSCC and well-differentiated OSCC group (P = 0.487). The overall mean survival for patients with BSCC was 6.37 months. Discussion: BSCCs of the oral cavity show increased CD105, CD34, E-cadherin and low Bcl-2 labelling. A substantial relationship between the tumour neo-angiogenesis, collective cell migration and apoptotic property could be related to the aggressive nature of this tumour and its poor overall survival rate. BSCCs are common in middle to older aged male and show increased expression of CD105, CD34 and E-cadherin. [ABSTRACT FROM AUTHOR]

Background: Oral mucoceles (OMs) are common cystic lesions seen mainly on the lower lip in young males. Histologically, OMs show variegated features such as clear cell changes, myxoglobulosis, calcifications, and papillary synovial metaplasia (PSM)‐like changes. The aim of the present paper is to morphometrically analyze PSM‐like changes seen in OMs. Methodology: Seventy‐two cases of histologically proven OMs were retrospectively retrieved and divided into two groups: group I without PSM‐like changes and group II with PSM‐like changes. The internal area was measured using Image J software. SPSS version 26 was used to analyze the data. Results: There were 50 cases in group I (mean age 19.23 years) and 22 cases in group II (mean age 30.25 years). The lower lip was the most commonly affected site for both groups. The mean age in group II was significantly higher than group I. In contrast, the mean internal area was significantly higher in group I. Conclusion: We speculate that PSM‐like changes in OMs represent an incomplete repair phenomenon. Knowledge of such an innocuous process is essential for differentiation from malignant histopathological mimickers. [ABSTRACT FROM AUTHOR]

Introduction: Oral cancer poses a serious health challenge globally, particularly for nations undergoing economic transition. The number and size of lymph nodes obtained, along with nodal involvements, are crucial for proper diagnosis, treatment, and prognosis. Aim: To assess the number of lymph nodes obtained before and after treating the specimens with the Lymph Node Revealing Solution (LNRS) along with staining characteristics. Materials and Methods: The present prospective observational study was conducted at the Department of Oral Pathology and Microbiology, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Chennai, Tamil Nadu, India, over a period of six months from January 2023 to June 2023 in a tertiary oral healthcare centre in Chennai. Six histologically confirmed Oral Squamous Cell Carcinoma (OSCC) cases with neck dissection were included in the study, involving 32 lymph node levels. Lymph nodes were grossed using both routine procedures of palpation and visualisation and after treatment with LNRS for two days. The number of nodes obtained through both methods was compared along with the staining characteristics. The data were analysed using Statistical Package for Social Sciences (SPSS) software version 26.0. Chi-square and paired t-tests were used to compare the two groups, and any value less than or equal to 0.05 was considered statistically significant. Results: Out of 134 lymph nodes, 21 were positive with conventional fixation, whereas after the application of LNRS, an additional 41 lymph nodes were retrieved. Two nodes showed metastatic deposits; fortunately, the additional positive nodes did not affect the staging. No statistically significant difference was found before and after immersion in LNRS regarding staining characteristics. The mean area of the yielded nodes was 84.71±4.85 mm2. There was a statistically significant difference between the size of lymph nodes between the manual grossing method and after immersion in LNRS (p-value <0.001). Conclusion: The study confirmed that the LNRS technique identified very small lymph nodes in oral cancer patients, which may contain metastatic deposits. This might change the stage of the disease and influence the mode of treatment. [ABSTRACT FROM AUTHOR]

Introduction: Human teeth serve many crucial functions, and aesthetics is one of these. Aesthetics and beauty are often correlated with the Golden Divine Ratio (GDR), a unique proportion hypothesised to exist in individuals or things with a harmonious appearance. Aim: To estimate the crown length, root length, and GDR in extracted human permanent maxillary and mandibular Central Incisors (CI) in the population of Tamil ethnicity from South India. Materials and Methods: This in-vitro cross-sectional study was conducted in the Department of Oral Pathology and Microbiology at Saveetha Dental College and Hospitals, Chennai, Tamil Nadu, India, from January 2023 to October 2023. The study included a total of 90 extracted human teeth from the Institutional tooth repository, out of which 27 were upper permanent CIs and the remaining 63 were mandibular CIs. Crown length and root length were measured using digital vernier calipers, and golden ratios were derived. Statistical Package for Social Sciences (SPSS) software version 26.0. was used for descriptive analysis and deriving means and standard deviation. Results: The average crown length, root length, and total length of upper CIs were 8.06±0.09 mm, 13.01±1.47 mm, and 21.06±2.36 mm, respectively. For the remaining 63 extracted permanent mandibular CIs, the mean crown length, root length, and total length were 7.85±0.66 mm, 12.6±0.97 mm, and 20.45±1.49 mm, respectively. The Root-to-Crown (R/C) ratio and Total Length to Root Length (T/R) ratio approximated 1.618 for both sets of teeth. Conclusion: The crown length of maxillary and mandibular CIs from the Tamil population followed the golden ratio in the present study. [ABSTRACT FROM AUTHOR]

Aim: The aim of this study was to present and analyze detailed clinicopathological data of periapical cysts (PCs) and periapical granuloma (PG) in a cohort of 135 cases from the South Indian Population. Methodology: The present study included 135 cases of PC and PG out of 2696 biopsies submitted over 3 years. The clinicodemographic data which included age, gender, location, radiographic appearance, and treatment were collected along with the histopathological examination of the biopsied specimen. Data were entered in a Microsoft Excel spreadsheet, 2021, and analyzed using SPSS software ver. 26. Results: There were 71 cases of PG and 64 cases of PC. The mean age of occurrence in PG was slightly lower than cases in PC. Irrespective of the group, there was a clear male preponderance, and maxillary permanent central incisors were most commonly affected. However, no significant difference was noted. Radiographically, PC significantly showed more well-defined corticated radiolucent lesions compared to PG where most cases were ill-defined (69.01%). Histologically, all cases showed classic features for diagnosis with additional histological characteristics which may aid in diagnosis. Conclusion: PG was more common than PC. There was a predilection for the male gender in both lesions. The actual incidence of these lesions would be actually high, as some cases are lost to private practitioners, and not all the lesions are submitted for histopathological examination. [ABSTRACT FROM AUTHOR]

Background: Forensic odontology plays an important role in mass disasters, house fires, criminal deaths, identification of missing persons, and child abuse cases. Teeth are the most stable part of the human body and are resistant to thermal, mechanical, and chemical insults. The aim of this study was to evaluate the effectiveness of mandibular intercanine distance and mesiodistal width of mandibular first molar in gender determination. Materials and Methods: The study comprised 100 participants (50 males and 50 females) in the age group of 18-23 years. The mandibular impressions were made, and casts were prepared using dental stone. The intercanine distance and mesiodistal width of the right mandibular first molar were measured using digital vernier callipers. The data obtained was statistically analysed using SPSS software version 23. Results: The mean mandibular intercanine distance was found to be 27.2 ± 2.3 in males and 25.94 ± 1.76 in females (P = 0.03). There was no statistical difference in the mesiodistal width of the mandibular molar between males and females (P = 0.166). However, the mean mesiodistal width of males was higher when compared to females. Conclusion: Males have a greater intercanine width and mesiodistal dimension when compared to females. This result will be helpful in forensic medicine, anthropology, orthodontic treatments, and clinical dentistry. [ABSTRACT FROM AUTHOR]

Background: Intraosseous rhabdomyosarcoma (I-RMS) with unique unique TFCP2 mutation is a recently described entity with an aggressive clinical course. The present review aimed to summarize and analyse the available data on head and neck I-RMS with TFCP2 mutation to update the current cognizance about the pathology for nobler diagnostic and therapeutic purposes. Methodology: Electronic databases were searched, and data were extracted for age, gender, location, histopathology of primary lesion, tumor cell type, necrosis and mitosis, immunohistochemical markers, mutation, follow-up and overall survival. Results: 27 cases were included and showed a mean age of 28.1±16.84 years (median- 22.5 years; Range 11-74 years). There was no definitive gender preponderance. Undisputedly, mandible was the most common affected site. Histologically, I-RMS show predominantly spindle and epithelioid morphology with rare rhabdoid differentiation. CK, desmin, MyoD1 and ALK are useful immunohistochemical markers. The fusion partner does not seem to affect the survival in I-RMS Conclusion: I-RMS is rare malignancy with limited information available in literature. Molecular characterization should be done for all cases with adequate follow-up. TPCP2 could also be an attractive target for therapies. [ABSTRACT FROM AUTHOR]

Gingival diseases are commonly observed in children and young adults. However, Giant Cell Fibroma (GCF) is a rare occurrence in children, accounting for only 2.2-7.3% of oral fibrous tumour cases. Clinically, these lesions often resemble squamous papillomas, and a definitive diagnosis can only be confirmed through histopathological {Haematoxylin and Eosin (H&E)} examination. Hereby, the authors present a rare case of gingival GCF in a three-year-old boy who presented with a pebbly growth on the mandibular gingiva. Initially, the lesion was clinically diagnosed as a papilloma and subsequently excised. The final diagnosis of GCF was established through histological examination. It is crucial for paediatric dentists to consider GCF as a differential diagnosis for lesions, particularly those with a papillary surface. Additionally, submitting all excised specimens for histopathological examination is recommended. [ABSTRACT FROM AUTHOR]

Dentinogenic ghost cell tumor (DGCT) is a rare tumor of odontogenic origin. A locally invasive lesion can be described by the presence of ameloblast-like epithelial islands, ghost cells, and dentinoid material. It is one of the few lesions with a predilection for the Asian population. The available literature has revealed that only 131 cases to date have been reported and published from 1968 to 2022. The following is a case report of a 25-year-old male with a tumor in the left lower back teeth region for the past 1 month. Orthopantomogram (OPG) reveals a well-defined unilocular radiolucency extending anteroposteriorly and crossing the midline. Histopathology revealed basal ameloblast-like cells and central stellate reticulum-like cells with the characteristic presence of ghost cells. The diagnosis was made based on the clinical, radiographical, and histopathological correlation and was confirmed using immunohistochemical analysis as a DGCT. [ABSTRACT FROM AUTHOR]

Introduction: Oral submucous fibrosis (OSMF) is a potentially malignant disorder of the oral cavity. The malignant transformation rate of OSMF is 7.6%, with a mean transformation rate of 4.7 years. It is characterized by epithelial atrophy and progressive accumulation of collagen fibers in lamina propria and submucosa of the oral mucosa. Increased collagen synthesis and decreased collagen breakdown play a major role in OSMF pathogenesis. In such fibrotic disorders, mediators such as growth factors, hormones, cytokines, and lymphokines primarily affect the production of extracellular matrix and collagen. PDGF-BB plays a major role in stimulating the replication, survival, and migration of myofibroblasts during the pathogenesis of fibrotic diseases. Aim: The main objective of this study is to assess the correlation between clinicopathological parameters and serum expression of PDGF-BB in OSMF and healthy controls. Materials and methods: A cross-sectional study, including fifteen patients with OSMF and fifteen healthy controls, was conducted. All cases had complete clinical and histopathological investigations. The PDGF-BB serum was assessed using an enzyme-linked immunosorbent assay. Results and discussion: The mean serum PDGF-BB expression values for stages I, II, and III are 1238.3±165.3 pg/ml, 1437.7±134.6 pg/ ml, and 1739.2±143.3 pg/ml, respectively. There was a correlation between the mean difference between the OSMF and control, and the clinical staging subgroups. (p-value<0.05) The mean serum expression of PDGF-BB in subgroups of histopathological grade I, II, and III was 1654.42±187.3 pg/ml, 1873.7±276.3 pg/ml,1739.2±143.3 pg/ml, with an insignificant p-value>0.05. Conclusions: The mean serum PDGF-BB level was significantly elevated in OSMF patients. There was a positive correlation between the clinical stages, compared to the control groups. Therefore, evaluation of PDGF-BB can be used as an adjunctive serological biomarker in monitoring and predicting OSMF progression as, by inhibiting it, this protein PDGF BB could provide a unique therapeutic approach to combat fibrosis, and may also aid in an effective treatment of this precancerous condition. [ABSTRACT FROM AUTHOR]