Search

Transurethral resection of the prostate, or other methods to decrease outlet resistance usually leads to relief of symptoms in patients with bladder outlet obstruction (BOO). If symptoms of underactivity persist after normalization of outflow conditions, treatment options are limited. In this review, we hypothesize, based on results from basic research, what might become treatment options for such patients in the future. The primary local treatment will still aim at reducing outlet obstruction. We speculate that local secondary treatment in the future might include transplantation of stem cells or mature bladder ganglion cells into the bladder wall. There has been some success in transplanting ganglion cells into the rat bladder. The ganglion cells will sprout into the surrounding tissue but functional connections between the axons of the transplanted neurons, and the detrusor smooth muscle have so far not been demonstrated. Neurotrophins or neurotrimin might be injected into the bladder wall to increase the sprouting of existing or transplanted neurons. Stem cell transplantation has been performed and improves detrusor function, but it has so far, been difficult to demonstrate transplanted stem cells. BOO, persisting detrusor underactivity, and decreased nerve density are often combined with inflammatory activity of the lower urinary tract. NLR family pyrin domain containing 3 (NLRP3) and its messenger RNA (mRNA) as well as cyclooxygenase-2 (Cox-2) mRNA are increased in obstructed bladders. Systemic treatment with the NLRP3 inhibitor glyburide normalized nerve density in rat bladder, and, to some extent, bladder function. It is unclear whether Cox-2 is involved in the decreased nerve density following obstruction, but Cox-2 mRNA increases 5-fold in obstructed bladder. Future therapy against bladder underactivity remaining following relief of obstruction includes either systemic treatment, perhaps by anti-inflammatory drugs, or local treatment by injection of stem cells, mature ganglion cells, and/or neurotrophins or neurotrimin into the bladder wall.

The history of TRP channels and bladder started in the 1980-ies with the studies of Maggi and collaborators, who created the basis for using capsaicin and other vanilloids in LUT disorders. This narrative review gives a brief history of bladder TRP channels, from their discovery, distribution, and function in the bladder to the rationale for and current status of the use of agents acting on them in treating LUT dysfunction. The most studied TRP channels related to physiological and pathological bladder conditions are the TRPV1, TRPA1, TRPV4, and TRPM8 channels Their preclinical rationale and potential as targets for effective therapies are attractive. However, even if the results with agents blocking these channels have been promising in experimental models of LUT disorders, this has not resulted in any clinically useful treatments. Thus, the history of TRP channels, their involvement in the physiology and pathophysiology of the LUT, and the search for TRP channel-active drugs for treating LUT disorders are ongoing. Further research will reveal if the promises of these agents will be fulfilled.

Purpose The relative roles of urinary sphincter damage, aging, and childbirth in stress urinary incontinence (SUI), have not been established. This study was performed to elucidate the roles of these factors. Methods The study included: (1) 8 female cynomolgus monkeys (17–19 years of age and 7–8 vaginal births each); (2) six 5-year-old nulliparous monkeys with surgically created chronic urinary sphincter dysfunction; and (3) six 5-year-old, nulliparous, no-surgery controls. Sedated abdominal leak point pressure (ALPP) and maximum urethral sphincter pressures (MUP) were measured. Sphincters, bladders, and pelvic support muscles were quantified for collagen content. Additionally, bladders were analyzed for collagen fiber thickness, length, and angle using CT-FIRE analysis of Picrosirius red-stained tissues. Results Resting MUP values were similar in the controls and older multiparous monkeys (P>0.05). However, aging and multiple births reduced pudendal nerve-stimulated increases in MUP (P0.05 vs. young groups). Bladder collagen content was greater, and muscle content less, in the old multiparous monkeys (P

The aim of this review is to discuss how to link lower urinary tract symptoms (LUTS) and oxidative stress (OS) and to define relevant targets for therapeutic intervention. Narrative review based on published literature. Many of the multifactorial pathophysiological mechanisms behind LUTS can initiate reactive oxygen species (ROS) generation. Assuming that OS is a consequence rather than a primary cause of LUTS it seems reasonable to identify both the disease mechanism initiating LUTS, and the source of ROS involved. There are many possible sources of ROS overproduction, but the NADPH oxidase (NOX) family of enzymes is the primary source; NOX activation in turn, may result in the activation of secondary ROS sources, i.e., ROS-dependent ROS production. Selective NOX inhibition therefore seems an attractive therapeutic strategy in LUTS treatment. The finding of NOX2 localization to centers in the brain associated with micturition control, opens up for further studies of NOX involvement in the central control of micturition, normally and in disease. Further information on the localization of the different isoforms of NOX in the LUT e.g., the bladder wall and its components and the prostate, is desirable. To optimize treatment, the pathophysiological mechanism initiating LUTS, and the activated isoform of NOX, should be identified. Unfortunately, in most cases of LUTS this is currently not possible. Even if selective NOX inhibitors have entered the clinical trial stage for treatment of disorders other than LUT dysfunction, their efficacy for LUTS treatment has to be demonstrated. If this can be achieved, an attractive approach would be combination of selective NOX inhibition with established drug therapies.

Capsaicin acts on sensory nerves via vanilloid receptors. TRPV1 has been extensively studied with respect to functional lower urinary tract (LUT) conditions in rodents and humans. We aimed to (1) provide background information on capsaicin and TRPV1 and its mechanisms of action and basis for clinical use, (2) review the use of acute intravesical capsaicin instillation (AICI) in rodents to mimic various LUT disorders in which capsaicin sensitive C-fibers are involved and (3) discuss future innovative treatments. A comprehensive search of the major literature databases until June 2022 was conducted. Both capsaicin-sensitive and resistant unmyelinated bladder afferent C-fibers are involved in non-neurogenic overactive bladder/detrusor overactivity (OAB/DO). AICI is a suitable model to study afferent hyperactivity mimicking human OAB. Capsaicin-sensitive C-fibers are also involved in neurogenic DO (NDO) and potential targets for NDO treatment. AICI has been successfully tested for NDO treatment in humans. Capsaicin-sensitive bladder afferents are targets for NDO treatment. TRPV1-immunoreactive nerve fibers are involved in the pathogenesis of interstitial cystitis/painful bladder syndrome (IC/PBS). The AICI experimental model appears relevant for the preclinical study of treatments targeting bladder afferents for refractory IC/BPS. The activity of capsaicin-sensitive bladder afferents is increased in experimental bladder outlet obstruction (BOO). The AICI model may also be relevant for bladder disorders resulting from C-fiber hyperexcitabilities related to BOO. In conclusion, there is a rationale for the selective blockade of TRPV1 channels for various bladder disorders. The AICI model is clinically relevant for the investigation of pathophysiological conditions in which bladder C-fiber afferents are overexcited and for assessing innovative treatments for bladder disorders based on their pathophysiology.

Many patients with outlet obstruction secondary to prostatic enlargement have lower urinary tract symptoms (LUTSs) and an increased frequency of micturition. The standard treatment is transurethral resection of the prostate (TURP), which alleviates obstruction and symptoms. However, after TURP, 20–40 percent of patients continue to experience LUTSs. The aim of the present study in rats was to identify the mechanisms that do not normalize after the removal of the obstruction and that could explain the persisting symptoms. We had microarray data from control, obstructed, and de-obstructed female rat bladders, which made it possible to study 14,553 mRNA expressions. We also had a bank of electron micrographs from similar detrusors. Microarrays: There were significant differences between the control and obstructed bladders for 1111 mRNAs. The obstructed and de-obstructed bladders differed significantly for 1059 mRNAs. The controls and the de-obstructed bladders differed significantly for 798 mRNAs. We observed many mRNAs that were increased in the obstructed bladder and then decreased to control levels after de-obstruction, and many mRNAs that were decreased in the obstructed bladder and then increased following de-obstruction. mRNAs that were significantly higher or lower in the de-obstructed bladder than in the control bladder were also found. Ultrastructure: The detrusor cells in the obstructed bladders had cross-sectional areas that were much larger than those in the controls. The control cells had smooth outlines and similar cross-sectional areas. The de-obstructed detrusor cells had larger cross-sectional areas than the controls, as well as corrugated surfaces. The cell areas varied, suggesting that the shrinkage of the de-obstructed cells was not even. We did not find any points of contact of the gap junction plaque type between the detrusor cells. There were abundant finger-like processes between the detrusor cells in the obstructed and in de-obstructed bladders, which were only occasionally found in the control detrusors. They are the only possible localization for gap junction channels. The de-obstructed rat bladder is not an organ with properties intermediate between those of the control and obstructed bladders. Instead, de-obstructed bladders have gene expressions, morphologies, and functional properties of the individual cells and their organization, which make them distinctly different from both control and obstructed bladders.

Purpose A major question remaining in approaches to tissue engineering and organ replacement is the role of native mobilized native cells in the regeneration process of damaged tissues and organs. The goal of this study was to compare the cell mobilizing effects of the chemokine CXCL12 and cell therapy on the urinary sphincter of nonhuman primates (NHP) with chronic intrinsic urinary sphincter dysfunction. Methods Either autologous lenti-M-cherry labeled skeletal muscle precursor cells (skMPCs) or CXCL12 were injected directly into the sphincter complex of female NHPs with or without surgery-induced chronic urinary sphincter dysfunction (n=4/treatment condition). All monkeys had partial bone marrow transplantation with autologous lenti-green fluorescent protein (GFP) bone marrow cells prior to treatment. Labeled cells were identified, characterized and quantified using computer-assisted immunohistochemistry 6 months posttreatment. Results GFP-labeled bone marrow cells (BMCs) were identified in the bone marrow and both BMCs and skMPCs were found in the urinary sphincter at 6-month postinjection. BMCs and skMPCs were present in the striated muscle, smooth muscle, and lamina propria/urothelium of the sphincter tissue. Sphincter injury increased the sphincter content of BMCs when analyzed 6-month postinjection. CXCL12 treatment, but not skMPCs, increased the number of BMCs in all layers of the sphincter complex (P

The symptoms of interstitial cystitis (IC)/bladder pain syndrome (BPS) may have multiple causes and involve many contributing factors. Traditional treatments (intravesical instillations) have had a primary focus on the bladder as origin of symptoms without adequately considering the potential influence of other local (pelvic) or systemic factors. Systemic pharmacological treatments have had modest success. A contributing factor to the low efficacy is the lack of phenotyping the patients. Individualized treatment based on is desirable, but further phenotype categorization is needed. There seems to be general agreement that IC is a unique disease and that BPS is a syndrome with multiple pathophysiologies, but this has so far not been not been well reflected in preclinical research with the aim of finding new pharmacological treatments. Current research approaches, including anti-nerve growth factor treatment, anti-tumor necrosis factor-α treatment, activation of SHIP1 (AQX-1125), and P2X3 receptor antagonists, and α1-adrenoceptor antagonists are potential systemic treatments, implying that not only the bladder is exposed to the administered drug, which may be beneficial if the IC/BPS is a bladder manifestation of a systemic disease, or negative (adverse effects) if it is a local bladder condition. Local treatment approaches such as the antagonism of Toll-like receptors (which still is only experimental) and intravesical liposomes (with positive proof-of-concept), may have the advantages of a low number of systemic adverse effects, but cannot be expected to have effects on symptoms generated outside the bladder. Assessment of which of the treatment approaches discussed in this review that can be developed into useful therapies requires further studies.

Chronic pelvic pain (CPP) is a common condition involving multiple, organ-specific medical specialties, each with its own approach to diagnosis and treatment. Management requires knowledge of the interplay between pelvic organ function and neuro-functional anatomy, and of the neurologic and psychological aspects of CPP, but no current specialty fully encompasses this approach. Neuropelveology is an emerging discipline focusing on pathologies of the pelvic nervous system on a cross-disciplinary basis. It involves a neurological/neurosurgical approach, combining the knowledge required for a proper neurologic diagnosis, confirmation by transvaginal/transrectal examination of the pelvic nerves, and advanced laparoscopic surgery in selected cases of CPP. The management of CPP requires multidisciplinary contributions, and neuropelveology may offer an educational framework for the interdisciplinary exchange of knowledge between clinical physicians and basic researchers.

Abstract We investigated the characteristics of bladder mechanosensitive single-unit afferent activities (SAAs) in rats with a bladder outlet obstruction (BOO) and their relationship with bladder microcontractions. Male Wistar rats were divided into Sham and BOO groups. Four or 10 days after the surgery, rats were anesthetized with urethane. The SAAs of Aδ- or C-fibers from the L6 dorsal roots were recorded during bladder filling. The BOO group showed a higher number of microcontractions and lower SAAs of Aδ-fibers compared with those of the Sham group. These findings were significant at day 10 post-operatively. In contrast, SAAs of C-fibers were not significantly different between the groups at either day 4 or 10. In the BOO group at day 10, the SAAs of both Aδ- and C-fibers at the “ascending” phase of microcontractions were significantly higher than those at the other phases (descending or stationary), and a similar tendency was also observed at day 4. Taken together, during bladder filling, the bladder mechanosensitive SAAs of Aδ-fibers were attenuated, but SAAs of both Aδ- and C-fibers were intermittently enhanced by propagation of microcontractions.

Abstract Disappointing results of skeletal muscle precursor cell (skMPC) therapy for women with intrinsic urinary sphincter deficiency (ISD) associated urinary incontinence has increased interest in alternative sphincter regenerative approaches. This study was to measure the safety and efficacy of the cell homing chemokine CXCL12 versus skMPCs in a rat model of ISD. Thirty‐six adult female Sprague Dawley rats were divided into 6 treatment (Tx) conditions: (a) no ISD/noTx [Control]; (b) ISD/noTx; (c) ISD + skMPCs; (d) ISD + 3.5 mg CXCL12; (e) ISD + 7mg CXCL12; and (f) ISD + 14 mg CXCL12. Tx's were injected directly into the sphincter complex 30 days post ISD and rats euthanized 30 days post Tx. Blood samples for measurements of kidney and liver function, white and red blood cell counts, were taken at baseline and at euthanasia. Leak point pressures (LPP) were measured prior to, and sphincter collagen/muscle content measured after, euthanasia. There were no effects of treatments on white or red/white blood cell counts, kidney/liver function tests or histopathology of the urinary sphincter complex or surrounding tissues. ISD lowered LPP 35% and sphincter muscle content by 17% versus control rats. CXCL12, but not skMPC injections, restored both LPP to control values in a dose‐dependent fashion. Both skMPCs and CXCL12 restored sphincter muscle content to control values. This chemokine approach may represent a novel therapeutic option for ISD and appears, at least short‐term, to produce little clinical or tissue pathology. Stem Cells Translational Medicine 2017;6:1740–1746

Urinary incontinence (UI) is a major problem in health care and more than 400 million people worldwide suffer from involuntary loss of urine. With an increase in the aging population, UI is likely to become even more prominent over the next decades and the economic burden is substantial. Among the different subtypes of UI, stress urinary incontinence (SUI) is the most prevalent and focus of this review. The main underlying causes for SUI are pregnancy and childbirth, accidents with direct trauma to the pelvis or medical treatments that affect the pelvic floor, such as surgery or irradiation. Conservative approaches for the treatment of SUI are pelvic physiotherapy, behavioral and lifestyle changes, and the use of pessaries. Current surgical treatment options include slings, colposuspensions, bulking agents and artificial urinary sphincters. These treatments have limitations with effectiveness and bear the risk of long-term side effects. Furthermore, surgical options do not treat the underlying pathophysiological causes of SUI. Thus, there is an urgent need for alternative treatments, which are effective, minimally invasive and have only a limited risk for adverse effects. Regenerative medicine is an emerging field, focusing on the repair, replacement or regeneration of human tissues and organs using precursor cells and their components. This article critically reviews recent advances in the therapeutic strategies for the management of SUI and outlines future possibilities and challenges.

Urgency is the prevalent and most bothersome symptom of overactive bladder (OAB) and the treatment of urgency is the primary objective in the management of OAB. Urgency has a major impact on other symptoms of OAB and culminates in an increased frequency of micturition and reduced volume voided, which may contribute to shorter intervals between the need to void. Antimuscarinic agents and mirabegron, a β 3 -adrenoceptor agonist, constitute the main oral pharmacotherapeutic options for the treatment of urgency and other OAB symptoms. The reduction of urgency and other OAB symptoms significantly improve health-related quality of life. This review will explore the distinct mechanisms of action and effects of antimuscarinic agents and mirabegron, in relation to their effect on the pathophysiology of urgency. The review will also provide an overview of the various validated measurements of urgency and the numerous clinical trials regarding antimuscarinic agent monotherapy, mirabegron monotherapy, or combination treatment with mirabegron added on to the antimuscarinic agent solifenacin. A narrative review of the literature relating to pathophysiology of urgency, the validated measurements of urgency, and clinical trials relating to the pharmacological treatment of urgency. Antimuscarinic agent monotherapy, mirabegron monotherapy, or combination treatment with mirabegron added on to the antimuscarinic agent solifenacin statistically significantly reduce the symptoms of urgency compared with placebo. Combination therapy with mirabegron added on to solifenacin also statistically significantly reduces the symptoms of severe urgency compared with antimuscarinic agent monotherapy. A critique of the clinical benefits of combination therapy is also provided. Combination therapy provides an alternative treatment in patients with OAB that includes urgency who respond poorly to first-line monotherapy and who may otherwise often move on to more invasive treatments.

The etiology of interstitial cystitis/bladder pain syndrome (IC/BPS) remains elusive and may involve multiple causes. To better understand its pathophysiology, many efforts have been made to create IC/BPS models. Most existing models of IC/BPS strive to recreate bladder-related features by applying noxious intravesical or systemic stimuli to healthy animals. These models are useful to help understand various mechanisms; however, they are limited to demonstrating how the bladder and nervous system respond to noxious stimuli, and are not representative of the complex interactions and pathophysiology of IC/BPS. To study the various factors that may be relevant for IC/BPS, at least 3 different types of animal models are commonly used: (1) bladder-centric models, (2) models with complex mechanisms, and (3) psychological and physical stressors/natural disease models. It is obvious that all aspects of the human disease cannot be mimicked by a single model. It may be the case that several models, each contributing to a piece of the puzzle, are required to recreate a reasonable picture of the pathophysiology and time course of the disease(s) diagnosed as IC/BPS, and thus to identify reasonable targets for treatment.

The vascular supply to the human bladder is derived mainly from the superior and inferior vesical arteries, the latter being directly connected to the internal iliac artery. Aging is associated with an impairment of blood vessel function and changes may occur in the vasculature at the molecular, cellular and functional level. Pelvic arterial insufficiency may play an important role in the development of bladder dysfunctions such as detrusor overactivity (DO) and the overactive bladder syndrome. Chronic ischemia-related bladder dysfunction may progress to bladder underactivity and it would be desirable to treat not only lower urinary tract symptoms (LUTS) induced by chronic ischemia, but also the progression of the morphological bladder changes. Studies in experimental models in rabbits and rats have shown that pelvic arterial insufficiency may result in significant bladder ischemia with reduced bladder wall oxygen tension. In turn, this will lead to oxidative stress associated with upregulation of oxidative stress-sensitive genes, increased muscarinic receptor activity, ultrastructural damage, and neurodegeneration. The phosphodiesterase type 5 (PDE5) inhibitor tadalafil, the α 1 -adrenoceptor (AR) blocker silodosin, the β 3 -AR agonist mirabegron, and the free radical scavenger melatonin, exerted a protecting effect on urodynamic parameters, and on functional and morphological changes of the bladder demonstrable in vitro . Since the agents tested are used clinically for relieving LUTS, the results from the animal models seem to have translational value, and may be of relevance for designing clinical studies to demonstrate if the drugs may prevent progression of ischemia-related functional and morphological bladder changes.

ClockΔ19/Δ19 mice is an experimental model mouse for nocturia (NOC). Using the bladder mucosa obtained from ClockΔ19/Δ19 mice, we investigated the gene expression rhythms of mechanosensory cation channels such as transient receptor potential cation channel subfamily V member 4 (TRPV4) and Piezo1, and main ATP release pathways including vesicular nucleotide transporter (VNUT) and Connexin26(Cx26), in addition to clock genes.Eight- to twelve-week-old male C57BL/6 mice (WT) and age- and sex-matched C57BL/6 ClockΔ19/Δ19 mice, which were bred under 12-h light/dark conditions for 2 weeks, were used. Gene expression rhythms and transcriptional regulation mechanisms in clock genes, mechanosensor, Cx26 and VNUT were measured in the mouse bladder mucosa, collected every 4 hours from WT and ClockΔ19/Δ19 mice using quantitative RT-PCR, a Western blot analysis, and ChIP assays.WT mice showed circadian rhythms in clock genes as well as mechanosensor, Cx26 and VNUT. Their expression was low during the sleep phase. The results of ChIP assays showed Clock protein binding to the promotor regions and the transcriptional regulation of mechanosensor, Cx26 and VNUT. In contrast, all of these circadian expressions were disrupted in ClockΔ19/Δ19 mice. The gene expression of mechanosensor, Cx26 and VNUT was maintained at a higher level in spite of the sleep phase.Mechanosensor, Cx26 and VNUT expressed with circadian rhythm in the mouse bladder mucosa. The disruption of circadian rhythms in these genes, induced by the abnormalities in clock genes, may be factors contributing to NOC because of hypersensitivity to bladder wall extension.

PURPOSE:To describe atherosclerosis may lead to chronic bladder ischemia, eventually resulting in lower urinary tract syndrome (LUTS), and peripheral arterial occlusive disease (PAOD). We investigated the association of LUTS with PAOD. METHODS:This nationwide population-based cohort study was based on data from the Taiwan National Health Insurance Database from 2000 to 2010; follow-up lasted until the end of 2011. We identified patients with newly diagnosed LUTS by using International Classification of Diseases, Ninth Revision, Clinical Modification codes. RESULTS:In total, 36,042 and 36,042 patients were enrolled in LUTS and non-LUTS cohorts, respectively. After adjustment for age, sex, and comorbidities, the risk of subsequent PAOD was 1.36-fold higher [95% confidence interval (CI) = 1.26-1.46] in the LUTS cohort than in the non-LUTS cohort. The adjusted risk of PAOD was the highest in patients with LUTS without any comorbidity [adjusted hazard ratio (aHR) = 1.93, 95% CI = 1.54-2.41]. The age-specific relative risk of PAOD was significantly higher in all age groups, particularly in those aged

Several members of the transient receptor potential (TRP) superfamily, including TRPV1, TRPV2, TRPV4, TRM4, TRPM8 and TRPA1, are expressed in the lower urinary tract (LUT), not only in neuronal fibers innervating the bladder and urethra, but also in the urothelial and muscular layers of the bladder and urethral walls. In the LUT, TRP channels are mainly involved in nociception and mechanosensory transduction. Animal studies have suggested the therapeutic potential of several TRP channels for the treatment of both bladder over- and underactivity and bladder pain disorders,; however translation of this finding to clinical application has been slow and the involvement of these channels in normal human bladder function, and in various pathologic states have not been established. The development of selective TRP channel agonists and antagonists is ongoing and the use of such agents can be expected to offer new and important information concerning both normal physiological functions and possible therapeutic applications.

Interstitial cystitis and bladder pain syndrome (IC/BPS) are terms used to describe a heterogeneous chronic pelvic and bladder pain disorder. Despite its significant prevalence, the disease etiology is not well understood and providing diagnosis and treatment can be challenging. In our study, published recently in the Journal of Urology (Colaco et al., 2014), we describe the use of microarrays as a tool to characterize IC/BPS and to determine if there are clinical factors that correlate with gene expression. This data-in-brief article describes the methodology for that study, including data analysis, in further detail. Deposited data can be found in the Gene Expression Omnibus (GEO) database: GSE57560.

An established standardized terminology is necessary for communication of scientific information, and for prevention of mistreatment and misdiagnosis. Terminology concerning the lower urinary tract has been much discussed; in particular, the meaning of terms like lower urinary tract symptoms (LUTS), urgency, frequency and nocturia, overactive bladder (OAB), and detrusor overactivity (DO). It is natural and desirable that all suggested definitions are subject to criticism, and it is important that discussions for improvement of the existing terminology continue.

Epidemiological studies have shown that lower urinary tract symptoms, including overactive bladder, commonly occur in both men and women, with an age-related increase in both sexes. Vascular endothelial dysfunction and urological symptoms are common in the metabolic syndrome; they also occur during the human ageing process and are independent risk factors for the development of atherosclerosis and hypertension. Pelvic arterial insufficiency may lead to impaired lower urinary tract perfusion and play an important role in the development of bladder dysfunction such as detrusor overactivity and overactive bladder. It seems reasonable, but has not been definitely established clinically, that chronic ischemia-related bladder dysfunction will progress to bladder underactivity. Studies in experimental models in rabbits and rats have shown that pelvic arterial insufficiency may result in significant bladder ischemia with reduced bladder wall oxygen tension, oxidative stress, increased muscarinic receptor activity, ultrastructural damage, and neurodegeneration. Several types of drug may be able to prevent some of these changes. Even if the α 1 -adrenoceptor blocker, silodosin, the phosphodiesterase type 5 inhibitor, tadalafil, the β 3 -α 1 -adrenoceptor agonist, mirabegron, and the free radical scavenger, melatonin, were unable to prevent the development of neointimal hyperplasia and consequent luminal occlusion in animal models, they all exerted a protecting effect on urodynamic parameters, and on the functional and morphological changes of the bladder demonstrable in vitro . The different mechanisms of action of the drugs suggest that many factors are involved in the pathogenesis of chronic ischemia-induced bladder dysfunction and can be targets for intervention. Since several of the agents tested are used clinically and effectively for relieving lower urinary tract symptoms, the results from animal models of chronic bladder ischemia seem to have translational value. Animal models may be of relevance for designing clinical studies to demonstrate if a certain drug may prevent progression of ischemia-related functional and morphological bladder changes.

Subtotal cystectomy (STC; surgical removal of ∼75% of the rat urinary bladder) elicits a robust proliferative response resulting in complete structural and functional bladder regeneration within 8-weeks. The goal of these studies was to characterize the early cellular response that mediates this regenerative phenomenon, which is unique among mammalian organ systems. STC was performed on eighteen 12-week-old female Fischer F344 rats. At 1, 3, 5 and 7-days post-STC, the bladder was harvested 2-hours after intraperitoneal injection of bromodeoxyuridine (BrdU). Fluorescent BrdU labeling was quantified in cells within the urothelium, lamina propria (LP), muscularis propria (MP) and serosa. Cell location was confirmed with fluorescently co-labeled cytokeratin, vimentin or smooth muscle actin (SMA), to identify urothelial, interstitial and smooth muscle cells, respectively. Expression of sonic hedgehog (Shh), Gli-1 and bone morphogenic factor-4 (BMP-4) were evaluated with immunochemistry. Three non-operated rats injected with BrdU served as controls. Less than 1% of cells in the bladder wall were labeled with BrdU in control bladders, but this percentage significantly increased by 5-8-fold at all time points post-STC. The spatiotemporal characteristics of the proliferative response were defined by a significantly higher percentage of BrdU-labeled cells within the urothelium at 1-day than in the MP and LP. A time-dependent shift at 3 and 5-days post-STC revealed significantly fewer BrdU-labeled cells in the MP than LP or urothelium. By 7-days the percentage of BrdU-labeled cells was similar among urothelium, LP and MP. STC also caused an increase in immunostaining for Shh, Gli-1 and BMP-4. In summary, the early stages of functional bladder regeneration are characterized by time-dependent changes in the location of the proliferating cell population, and expression of several evolutionarily conserved developmental signaling proteins. This report extends previous observations and further establishes the rodent bladder as an excellent model for studying novel aspects of mammalian organ regeneration.

Using transposon-mediated gene-trap mutagenesis, we have generated a novel mouse mutant termed Blad (Bloated Bladder). Homozygous mutant mice die perinatally showing a greatly distended bladder, underdeveloped diaphragm and a reduction in total skeletal muscle mass. Wild type and heterozygote mice appear normal. Using PCR, we identified a transposon insertion site in the first intron of Nmnat2 (Nicotinamide mononucleotide adenyltransferase 2). Nmnat2 is expressed predominantly in the brain and nervous system and has been linked to the survival of axons. Expression of this gene is undetectable in Nmnat2(blad/blad) mutants. Examination of the brains of E18.5 Nmnat2(blad/blad) mutant embryos did not reveal any obvious morphological changes. In contrast, E18.5 Nmnat2(blad/blad) homozygotes showed an approximate 60% reduction of spinal motoneurons in the lumbar region and a more than 80% reduction in the sensory neurons of the dorsal root ganglion (DRG). In addition, facial motoneuron numbers were severely reduced, and there was virtually a complete absence of axons in the hind limb. Our observations suggest that during embryogenesis, Nmnat2 plays an important role in axonal growth or maintenance. It appears that in the absence of Nmnat2, major target organs and tissues (e.g., muscle) are not functionally innervated resulting in perinatal lethality. In addition, neither Nmnat1 nor 3 can compensate for the loss of Nmnat2. Whilst there have been recent suggestions that Nmnat2 may be an endogenous modulator of axon integrity, this work represents the first in vivo study demonstrating that Nmnat2 is involved in axon development or survival in a mammal.

BACKGROUND: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. OBJECTIVE: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. METHODS: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). RESULTS: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. CONCLUSIONS: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

Lower urinary tract symptoms (LUTS), overactive bladder syndrome (OAB) and detrusor overactivity (DO) are all conditions that can have major effects on quality of life and social functioning. Antimuscarinic drugs are first-line treatment-they often have good initial response rates, but adverse effects and decreasing efficacy cause long-term compliance problems, and alternatives are needed. The recognition of the functional contribution of the urothelium, the spontaneous myocyte activity during bladder filling, and the diversity of nerve transmitters has sparked interest in both peripheral and central modulation of LUTS/OAB/DO pathophysiology. There may be several new possibilities to treat LUTS/OAB/DO. β 3 -AR agonists (YM178), PDE 5 inhibitors (sildenafil, tadalafil, vardenafil), vitamin D analogs (elocalcitol), combinations (α 1 -AR antagonist + antimuscarinic), and drugs with a central mode of action (tramadol, aprepitant) all have Randomized controlled trial (RCT) documented efficacy. Which of these therapeutic principles will be developed to clinically useful treatments remains to be established.